ID: 1101377726

View in Genome Browser
Species Human (GRCh38)
Location 12:104185167-104185189
Sequence CCTTGACACTATTAACATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1967
Summary {0: 4, 1: 22, 2: 154, 3: 481, 4: 1306}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101377726_1101377734 19 Left 1101377726 12:104185167-104185189 CCCAAATGTTAATAGTGTCAAGG 0: 4
1: 22
2: 154
3: 481
4: 1306
Right 1101377734 12:104185209-104185231 ATGAAGAAAAGGGGTGCTTAAGG No data
1101377726_1101377730 8 Left 1101377726 12:104185167-104185189 CCCAAATGTTAATAGTGTCAAGG 0: 4
1: 22
2: 154
3: 481
4: 1306
Right 1101377730 12:104185198-104185220 CCCTGATGCAGATGAAGAAAAGG No data
1101377726_1101377732 9 Left 1101377726 12:104185167-104185189 CCCAAATGTTAATAGTGTCAAGG 0: 4
1: 22
2: 154
3: 481
4: 1306
Right 1101377732 12:104185199-104185221 CCTGATGCAGATGAAGAAAAGGG No data
1101377726_1101377733 10 Left 1101377726 12:104185167-104185189 CCCAAATGTTAATAGTGTCAAGG 0: 4
1: 22
2: 154
3: 481
4: 1306
Right 1101377733 12:104185200-104185222 CTGATGCAGATGAAGAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101377726 Original CRISPR CCTTGACACTATTAACATTT GGG (reversed) Intergenic
900436610 1:2634066-2634088 CCTTGACATTGTTTCCATTTGGG - Intergenic
901136863 1:7003021-7003043 CCTTGGCACTATTCACATTCTGG + Intronic
901268605 1:7932846-7932868 CCTCAGCACTATTGACATTTGGG + Intronic
901487879 1:9577888-9577910 CCTTGGCGCTATTCACATTTGGG - Intronic
901746813 1:11379192-11379214 CCTTGGCACTATTCACATTTTGG - Intergenic
901747374 1:11383184-11383206 CCTTGGCACTATTCACACTTTGG - Intergenic
901869386 1:12128649-12128671 CCTTGGCACCATTGACATTTGGG + Intronic
901896488 1:12317432-12317454 CCTTAGCACTATCAACGTTTTGG + Intronic
902080037 1:13814523-13814545 CATTGACACTGTCAGCATTTGGG + Intronic
902158773 1:14512286-14512308 CCTTAGCACTATTGATATTTGGG + Intergenic
902178463 1:14669385-14669407 CCTTGGCACTGTGGACATTTGGG - Intronic
902249593 1:15145457-15145479 TTTTGGCACTATTGACATTTGGG - Intergenic
902261404 1:15227413-15227435 CCTCCACACTAGTGACATTTGGG - Intergenic
902261679 1:15229977-15229999 CCTTGGCACTATTGACATTTTGG + Intergenic
902320842 1:15664454-15664476 TATTGACACTGTTAATATTTTGG + Exonic
902365123 1:15968093-15968115 CCTTGACACTTCTGACATTTGGG - Intronic
902718571 1:18289624-18289646 CCTGGGCACTGTTGACATTTGGG + Intronic
902888227 1:19422327-19422349 CCTTAACTCTATTAACGTTTGGG - Intronic
903087075 1:20871293-20871315 CCTCAACACTACTGACATTTGGG + Intronic
903248440 1:22034293-22034315 CCTTGGCACTATTGGCATTTTGG + Intergenic
903303724 1:22397582-22397604 CCTTGGCACTATCCACATTTAGG + Intergenic
903397461 1:23012775-23012797 CCTTGGCACTATTGACATATTGG - Intronic
903446899 1:23428259-23428281 CCTTGGCACTATTAACATTTTGG + Intergenic
903534388 1:24057002-24057024 CCTTGGCACTTTTGACATCTGGG + Exonic
903561999 1:24235176-24235198 CCTTGGCACTATTGACATTTGGG - Intergenic
904060756 1:27708353-27708375 CCATATCACTATCAACATTTTGG - Intergenic
904375074 1:30075866-30075888 CCATATCACTATTAGCATTTTGG - Intergenic
904932983 1:34105208-34105230 CCTCAACACTATCAACATTTTGG + Intronic
904958934 1:34315652-34315674 CCATAACACTATAAGCATTTTGG - Intergenic
905615549 1:39395114-39395136 GCCTGCCACTATCAACATTTTGG + Intronic
905704524 1:40044754-40044776 CGTTGGCACAATTGACATTTTGG + Intronic
905751111 1:40464942-40464964 CCTTGGCACTACCAATATTTTGG + Intergenic
905944944 1:41893557-41893579 CCTTGGCACCATTGACATTTTGG - Intronic
906259101 1:44372867-44372889 CTTTGACACTATTGACATTTTGG - Intergenic
906371481 1:45257703-45257725 CCATGTCACTATCAGCATTTTGG - Intronic
907344159 1:53760271-53760293 CCATATCACTATCAACATTTTGG + Intergenic
907726924 1:57028609-57028631 CCTTATCACTATCAGCATTTTGG - Intronic
907976122 1:59433114-59433136 CCTTGGCACCATTGACATTTTGG + Intronic
908028819 1:59978198-59978220 CCTCAGCACTATTGACATTTTGG + Intergenic
908258515 1:62321285-62321307 ACTTCACACTATTTTCATTTGGG + Intergenic
908285422 1:62593196-62593218 TCTCGACTCTATTAACATTTTGG - Intronic
908330221 1:63063654-63063676 TCTTGACACTACTGACATTTGGG - Intergenic
908334432 1:63106339-63106361 CCTCAGCACTATTGACATTTTGG + Intergenic
908485139 1:64584317-64584339 CCTTGGCACTACTGTCATTTTGG - Intronic
908507520 1:64819782-64819804 TCTTGGTACTATTAACGTTTGGG + Intronic
908562926 1:65324893-65324915 CCTCGGCACTATTGACATTTTGG - Intronic
908661280 1:66438128-66438150 CTTTGGCACTATTGACATTTTGG - Intergenic
908772162 1:67607196-67607218 CCTATGCACTATTGACATTTGGG + Intergenic
908826758 1:68140890-68140912 CCTTGGCATTAGTAAGATTTTGG - Intronic
908963607 1:69730560-69730582 CCATATCACTATTAACATTTTGG + Intronic
909071939 1:71005183-71005205 CCTTGGCACTATTGACACATGGG - Intronic
909129428 1:71715774-71715796 CCATATCACTATTAGCATTTTGG + Intronic
909158962 1:72119792-72119814 CCTCAACACTATTGACATTTTGG - Intronic
909319243 1:74262188-74262210 CCTTGGCACTACTGACAATTTGG + Intronic
909356140 1:74712240-74712262 ACTTGGCACTATCAACATTTTGG + Intronic
909425872 1:75523897-75523919 CATTGCCACTATTAATATTTTGG - Intronic
909488215 1:76197773-76197795 CCTTAGCACTATCAACATTTTGG + Intronic
909525944 1:76622650-76622672 TCTCAGCACTATTAACATTTTGG - Intronic
909892868 1:81029629-81029651 CCTTGGTACTATTGACACTTTGG - Intergenic
909915790 1:81317211-81317233 CCTTGGTACTACTGACATTTTGG - Intronic
910694449 1:89996571-89996593 CCTTTAAACTATGAATATTTGGG + Intronic
910764715 1:90770178-90770200 CCTCAGCACTATTGACATTTTGG + Intergenic
910783000 1:90961942-90961964 CCTTGGCACAATTGACATTTTGG - Intronic
911115413 1:94241104-94241126 CCTTGACACTATTGACCTTTTGG - Intronic
911125588 1:94338244-94338266 CCTTGGCACTATTGACATTTTGG + Intergenic
911167436 1:94736717-94736739 CCTTTGCACTGTTGACATTTTGG + Intergenic
911200969 1:95043446-95043468 CCTCGTCACTATTGACATTTTGG - Intronic
911627006 1:100135179-100135201 TCTTGGCACTATTGACGTTTTGG - Intronic
911962787 1:104328434-104328456 CCTTGGCACTATCAACAATTTGG + Intergenic
912055385 1:105591796-105591818 AGTTGATACTATTGACATTTAGG + Intergenic
912083943 1:105976278-105976300 CCATGTCACTATCAGCATTTTGG - Intergenic
912096342 1:106149371-106149393 CCTTATCACTATTAGCATTTTGG - Intergenic
912147452 1:106810560-106810582 CCATGTCACTATCAGCATTTTGG + Intergenic
912198077 1:107423438-107423460 CCTTGGCACGATTGCCATTTTGG - Intronic
912995305 1:114527143-114527165 GATTACCACTATTAACATTTTGG + Intergenic
913015531 1:114730080-114730102 CCTTGGGATTATTGACATTTTGG - Intronic
913094384 1:115502719-115502741 CCATATCACTATCAACATTTTGG - Intergenic
913125360 1:115782434-115782456 CCTTAGCACTAGTGACATTTTGG - Intergenic
913127704 1:115808297-115808319 CCTCAGCACTATTGACATTTTGG - Intergenic
913134508 1:115874843-115874865 CTTCCACACTATTGACATTTGGG - Intergenic
913369997 1:118087808-118087830 CCTTGGCATTAATGACATTTTGG + Intronic
913391551 1:118318598-118318620 CAGTGACAGTAATAACATTTGGG + Intergenic
913504092 1:119499701-119499723 CCTTGATAGTCTTTACATTTTGG - Intergenic
913575858 1:120174088-120174110 CCTTGGCACTGTTGACATTTGGG - Intronic
914230420 1:145760901-145760923 CCATATCACTATTAGCATTTTGG - Intronic
914322817 1:146581661-146581683 CCCTGGCACTGTTGACATTTGGG + Intergenic
914388354 1:147194600-147194622 CCTTGACAGTCTTTACATTTTGG + Intronic
914558172 1:148789659-148789681 CCTTGGCACTGTTGACATTTGGG - Intergenic
914614662 1:149340571-149340593 CCTTGGCACTGTTGACATTTGGG + Intergenic
914684491 1:149966241-149966263 CCTTGGCACTATTGACATTTTGG - Intronic
914854857 1:151343454-151343476 CCTTCACTCTATTACCTTTTTGG - Intronic
914868043 1:151449473-151449495 TCTTGGCACTATTGACATTTAGG - Intronic
915168321 1:153960971-153960993 CTTTGGAACTATTAACATTTTGG + Intronic
915366549 1:155320165-155320187 CCTTGGCACTATTGAAATTTGGG - Intronic
915394446 1:155572120-155572142 CCTCAACACTGTTGACATTTGGG + Intergenic
915495450 1:156279379-156279401 CTTTGACACTGTTGACATTTTGG - Intronic
915694241 1:157722697-157722719 CCATATCACTATTAGCATTTTGG + Intergenic
916011004 1:160705752-160705774 TCTTGACATTATTGACATTTTGG + Intronic
916517211 1:165530476-165530498 CATTATCACTATTAACATTTTGG - Intergenic
916948968 1:169759467-169759489 CCATGTTACTATCAACATTTTGG + Intronic
916982446 1:170153444-170153466 CCTTGTCACTATCAGCATTTTGG - Intronic
917124675 1:171676519-171676541 CCTCAGCACTCTTAACATTTTGG + Intergenic
917202264 1:172530415-172530437 CCTTGGCACTTTTGACTTTTTGG + Intergenic
917275917 1:173332052-173332074 CCTTATCACTATTGGCATTTGGG - Intergenic
917833826 1:178923674-178923696 CCTTGGCATTATTGACATTCTGG - Intergenic
917882034 1:179346644-179346666 CCATGTCACTATTAACATTTTGG + Intronic
918028472 1:180778475-180778497 CCTTGATACTGTTGACATTTTGG + Intronic
918318658 1:183344610-183344632 CCTCGGCACTACTGACATTTTGG + Intronic
918499728 1:185180308-185180330 CCTTGTCACTATTAACCTTCAGG - Intronic
918610645 1:186486771-186486793 TCTTGGCACTATTGACATTTTGG + Intergenic
918643937 1:186880584-186880606 CCTTAATGCTATTGACATTTTGG - Intronic
918752546 1:188290589-188290611 CCATATCACTATCAACATTTTGG + Intergenic
918800076 1:188960364-188960386 CCATATCACTATTAGCATTTTGG - Intergenic
918910772 1:190565667-190565689 CATTGGCACTTTTAACCTTTGGG + Intergenic
918930935 1:190856143-190856165 CCATATCACTATCAACATTTTGG - Intergenic
919011826 1:191974666-191974688 CCATATCACTATCAACATTTTGG + Intergenic
919097239 1:193052515-193052537 CCTTGGCACTGTTGATATTTTGG - Intronic
919179316 1:194060358-194060380 CATCACCACTATTAACATTTCGG + Intergenic
920193655 1:204211924-204211946 CCTCCCCACTATTGACATTTTGG - Intronic
920708360 1:208271879-208271901 CAGTGGCACTATTGACATTTGGG - Intergenic
920875664 1:209833066-209833088 CATTGATACTATTTATATTTAGG - Intronic
921037217 1:211392409-211392431 GCTAACCACTATTAACATTTGGG + Intergenic
921539477 1:216395844-216395866 TCTTGGCACTACTGACATTTTGG - Intronic
921553080 1:216562661-216562683 CCTTGGCATTATTGATATTTGGG - Intronic
921597149 1:217066660-217066682 CCTAGGCACTGTTGACATTTGGG + Intronic
921822872 1:219637604-219637626 CCCTGACACTATTGACAATTTGG + Intergenic
922008159 1:221552903-221552925 TCTTGGCACTAATGACATTTTGG - Intergenic
922170756 1:223152517-223152539 CCTTATCACTATCAGCATTTTGG - Intergenic
922546639 1:226462944-226462966 CCTTGGCACTATTGACATTTTGG + Intergenic
922948848 1:229541095-229541117 AATTAACATTATTAACATTTTGG - Intronic
923078805 1:230634374-230634396 CCTTGGCACAACTGACATTTTGG - Intergenic
923367202 1:233274248-233274270 TCTTGACACTACTGACATCTTGG + Intronic
923380976 1:233417525-233417547 CCTTGGCACTATCGACATTCTGG + Intergenic
923827234 1:237513998-237514020 CCTTGTCATTTTTAACCTTTAGG - Intronic
924368411 1:243321000-243321022 CCTTGGTGCTATTGACATTTTGG + Intronic
924661245 1:246019320-246019342 GTTTGACACTAGTGACATTTTGG - Intronic
1062859171 10:796624-796646 CCATATCACTATTAGCATTTTGG - Intergenic
1062888859 10:1040406-1040428 ACTTGACACTGTTGACATTTGGG - Exonic
1064279525 10:13938873-13938895 ACTTGGTACTATTGACATTTGGG - Intronic
1065042586 10:21712642-21712664 CCTCCACACTATTAACACTATGG + Intronic
1065213692 10:23429608-23429630 CCTTGGTACTATTGACATTTTGG + Intergenic
1065274372 10:24070626-24070648 CCCTGAGACTTTTAACTTTTGGG - Intronic
1065417912 10:25509029-25509051 CTTTGGCACTATTGCCATTTTGG + Intronic
1065462121 10:25979750-25979772 CCTTGGCACTGTTGACATTGTGG + Intronic
1065699592 10:28411789-28411811 TCTTGGTATTATTAACATTTGGG - Intergenic
1066098894 10:32099276-32099298 CCACATCACTATTAACATTTTGG + Intergenic
1066377307 10:34869009-34869031 CCTTGGCACCATTGACATTTTGG + Intergenic
1066684129 10:37964410-37964432 CCATGTCACTATCAGCATTTTGG - Intronic
1067195070 10:44110825-44110847 CCTTGACAGTCTTTACATTTTGG + Intergenic
1067261921 10:44700279-44700301 CCTTGGCACTATTGGCATCTAGG - Intergenic
1067679203 10:48416987-48417009 CCTTGCCACTATTGACATTTTGG + Intronic
1067818434 10:49502835-49502857 CCTTGACACAATTGACACTTAGG - Intronic
1067917233 10:50413521-50413543 CCATAACACTACTGACATTTTGG + Intronic
1067971700 10:50978521-50978543 CCTCAGCACTATTCACATTTGGG - Intergenic
1068312649 10:55297956-55297978 CCTCCACAATACTAACATTTGGG + Intronic
1068461709 10:57337647-57337669 GCTTGGCACTATTGATATTTTGG + Intergenic
1068822642 10:61395433-61395455 CCTTGACACTATTAACATTTTGG - Intergenic
1068834501 10:61538985-61539007 CCTTGGCACTATTGACATTTTGG - Intergenic
1069040720 10:63693206-63693228 CCTTATCACTATCAGCATTTTGG - Intergenic
1069286786 10:66724661-66724683 TGTTGACACTATATACATTTAGG + Intronic
1069387347 10:67896122-67896144 ATTTGGCACTATTGACATTTTGG + Intronic
1069493296 10:68880019-68880041 CTTTGGCACTTTTGACATTTGGG - Intronic
1069765923 10:70859728-70859750 CCTAGACAATGTCAACATTTTGG + Intronic
1070082863 10:73206055-73206077 CCATTTCACTATTAGCATTTTGG - Intronic
1070309138 10:75260678-75260700 CCTTGGCCCTACTGACATTTTGG + Intergenic
1070396798 10:76018203-76018225 CCTTGACACCAGTGACACTTTGG + Intronic
1070502408 10:77084096-77084118 CCTCGACACCATTAACATTCTGG + Intronic
1070691722 10:78532063-78532085 CCTTCGCACTATCAATATTTTGG - Intergenic
1070706744 10:78645267-78645289 CCTTGGCACTGTTGACATATTGG + Intergenic
1070893219 10:79958199-79958221 CCTTGACGGTCTTTACATTTTGG - Intronic
1071192911 10:83123233-83123255 ATTTGACACTATTAAAATTTTGG + Intergenic
1071267738 10:83979262-83979284 CCTGGACTCTATTGACATTTTGG - Intergenic
1071386229 10:85124071-85124093 GCTTGGCACTATCAACATTTGGG + Intergenic
1071445516 10:85742893-85742915 ACCTGACACTATTGGCATTTGGG + Intronic
1071714203 10:88078718-88078740 CCTTGGCAATATTGACATTTTGG + Intergenic
1071719758 10:88131467-88131489 CCTCAGCACTATTGACATTTTGG - Intergenic
1071842323 10:89485290-89485312 CCTTGTCACTGTTGACATTTGGG - Intronic
1072018570 10:91375635-91375657 TCTTGGCACTATTGACATTTTGG - Intergenic
1072019354 10:91382880-91382902 CCTTGACATTATAAACATTTTGG - Intergenic
1072035879 10:91562328-91562350 CCATATCACTATTAGCATTTTGG + Intergenic
1072065749 10:91869664-91869686 CCTTGGCACTATTGACGTTTTGG + Intergenic
1072138035 10:92565575-92565597 CCTTGACAATGCTCACATTTAGG - Intronic
1072330749 10:94349083-94349105 GTTTGATACTATTAACAGTTCGG - Intronic
1072342123 10:94462334-94462356 CCCTCACAATATTTACATTTAGG - Intronic
1072415221 10:95241596-95241618 CCTTGGTGCTATTGACATTTTGG - Intronic
1072566628 10:96621775-96621797 CCTTGGCACTATTGACATTTTGG + Intronic
1072933756 10:99692213-99692235 CGTTGGCACTCTTGACATTTTGG + Intronic
1073810880 10:107151257-107151279 CCATGTCACTATCAGCATTTTGG - Intronic
1073880213 10:107972716-107972738 CCATGTCACTATCAGCATTTTGG - Intergenic
1073952797 10:108830059-108830081 CCATCTCACTATCAACATTTTGG + Intergenic
1074026325 10:109639766-109639788 CCTTGACATTATTGACATTTAGG + Intergenic
1074271592 10:111958985-111959007 TCATGACCCTATTCACATTTTGG - Intergenic
1074429246 10:113379534-113379556 TCTTGCCACTATTCACATTGAGG - Intergenic
1074501181 10:114026307-114026329 CCTCAGCACTATTGACATTTGGG + Intergenic
1074614163 10:115049631-115049653 CTTTGGCACTATTGATATTTGGG - Intergenic
1074653038 10:115546659-115546681 CCTTGGCAATATTAGCATTCTGG + Intronic
1074657879 10:115616067-115616089 CCATATCACTATTATCATTTTGG - Intronic
1074659964 10:115643056-115643078 CCTTGCCAATATTAACATTTTGG - Intronic
1074669009 10:115766294-115766316 CCTTGACACTACTGACATTTTGG + Intronic
1074699360 10:116079704-116079726 CATTGGCACTATTGACATTTTGG - Intronic
1074788824 10:116865788-116865810 CCTTGGCGCTATTGACATTTGGG - Intronic
1074851059 10:117440015-117440037 CCTTGGCACTATTGACATTTAGG + Intergenic
1075220207 10:120578078-120578100 CCTGGGCAGTATTGACATTTGGG - Intronic
1075234545 10:120714878-120714900 TCTTGGCACTATTGACACTTTGG - Intergenic
1075475683 10:122731400-122731422 ACCTCACACTATTGACATTTGGG - Intergenic
1075507484 10:123037205-123037227 CCTTGGCACTATTGACATTTTGG - Intronic
1075739412 10:124685195-124685217 CCAATCCACTATTAACATTTCGG - Intronic
1075792459 10:125094748-125094770 CTTTGGCACTGTTGACATTTTGG - Intronic
1075837679 10:125469640-125469662 CCTTGGCACCACTGACATTTTGG + Intergenic
1076030360 10:127152570-127152592 CCTCAGCACTATTGACATTTGGG + Intronic
1076095639 10:127733418-127733440 CCTCAGCACTATTGACATTTGGG - Intergenic
1077276319 11:1711524-1711546 TCTTGACATTATCAGCATTTGGG - Intergenic
1077399806 11:2348998-2349020 CCATATCACTATTAGCATTTTGG - Intergenic
1077875880 11:6305186-6305208 TCTTGGCAATATTGACATTTTGG + Intergenic
1077990425 11:7405210-7405232 CCTTAGCACTATTGACCTTTTGG + Intronic
1078124123 11:8542590-8542612 CGTTGGCCCTATTGACATTTTGG - Intronic
1078308372 11:10214103-10214125 ACTAAACACTATTGACATTTTGG + Intronic
1078624347 11:12940236-12940258 CCTTGACACCATTGACATTTTGG + Intronic
1078672685 11:13378675-13378697 TCTAGGCACTACTAACATTTTGG - Intronic
1078703958 11:13719811-13719833 CCTTGGCACTATAAATATTGTGG - Intronic
1079362510 11:19780830-19780852 ACTTGGCACTATTGACTTTTGGG - Intronic
1079435768 11:20447436-20447458 TATTGACACTAATGACATTTTGG - Intronic
1079968603 11:27008283-27008305 CCTTGATACTATTGACATTTTGG - Intergenic
1080064615 11:27996596-27996618 CCTTGACACTATTAACATTTTGG - Intergenic
1080079055 11:28192811-28192833 TCTTGGCACTACTGACATTTGGG - Intronic
1080112118 11:28580182-28580204 CCTCTGCACGATTAACATTTTGG + Intergenic
1080405600 11:31976115-31976137 CCTTGGCACTATTGACATTTGGG + Intronic
1080425991 11:32154676-32154698 TCTTGGCCCTATTGACATTTTGG - Intergenic
1080552491 11:33385344-33385366 CGTCAGCACTATTAACATTTTGG + Intergenic
1080707596 11:34712624-34712646 CCATATCACTATTAGCATTTTGG - Intergenic
1080737860 11:35034858-35034880 CCTTGGCACTGTTGACACTTTGG + Intergenic
1080773702 11:35366026-35366048 CCTCAGCACTATTGACATTTGGG - Intronic
1080832685 11:35910715-35910737 CCTTGGCATTACTGACATTTTGG + Intergenic
1081137011 11:39450950-39450972 CCATTTCACTATCAACATTTTGG + Intergenic
1081383462 11:42443955-42443977 CCTTGGCATTTTTGACATTTGGG - Intergenic
1081531983 11:43968189-43968211 CCTTGGCACTATTGACATTTGGG - Intergenic
1081538456 11:44012957-44012979 CCTTGGCACTATTGATATTTAGG - Intergenic
1081722478 11:45300520-45300542 CCTTGGCACTACTGACATTTGGG - Intergenic
1081832658 11:46127217-46127239 CCTCAGCACTATTGACATTTTGG + Intergenic
1081938688 11:46922221-46922243 CCTTGGCACTATTAACATTTTGG - Intergenic
1082215726 11:49566213-49566235 CCTGAGCACTATTGACATTTTGG - Intergenic
1082240674 11:49866946-49866968 CCTTGACGGTATTTACATTTTGG - Intergenic
1082676890 11:56115976-56115998 AATTGGCACTATTAACATTCCGG + Intergenic
1082677960 11:56132007-56132029 AATTGGCACTATTAACATTCTGG + Intergenic
1082692039 11:56317915-56317937 CCTTAGCACTATTGATATTTGGG + Intergenic
1082830114 11:57610662-57610684 CCTTGGCACTATTGACATATTGG + Intronic
1082866114 11:57901675-57901697 CCTTGACACTACTGACATATGGG - Intergenic
1083403350 11:62440030-62440052 CCTTGGCACTATTCACATTTTGG + Intronic
1083987613 11:66226541-66226563 CCTTGGCACGATTGACATTTGGG - Intronic
1084206427 11:67597171-67597193 CCTTGACACTATGGCCATTTGGG - Intergenic
1084567820 11:69941745-69941767 CCTTAGCACTACTAACACTTGGG + Intergenic
1084622687 11:70283910-70283932 CCTGGACACTTCCAACATTTGGG - Intronic
1085131128 11:74039791-74039813 CTTTGGCACTATTGACATTCTGG - Intronic
1085353955 11:75818895-75818917 CCTTGGGACTGTTGACATTTTGG + Intronic
1085571228 11:77559583-77559605 TCTTGGCACTAATAGCATTTGGG + Intronic
1085585501 11:77700425-77700447 CATTGCCACTATTAACAGTTTGG - Intronic
1085631567 11:78121999-78122021 ACTAATCACTATTAACATTTTGG - Intronic
1085867331 11:80309871-80309893 CCTTGGACCTATTCACATTTTGG + Intergenic
1085966841 11:81538381-81538403 CCTTGACAGTCTTTACAATTTGG + Intergenic
1086361084 11:86060231-86060253 CCTTCACACTTTTAAAATTGAGG + Intronic
1086407447 11:86510561-86510583 CTTTGGCACTATTGACATTTTGG + Intronic
1086466715 11:87061403-87061425 CCTTGGCACTATTGACATTTTGG - Intronic
1086633855 11:89058263-89058285 CCTGAGCACTATTGACATTTTGG + Intronic
1086838867 11:91659826-91659848 CCTTAGCACTACTGACATTTAGG - Intergenic
1086879005 11:92132201-92132223 ACTTGACACTGATAACAATTTGG - Intergenic
1086954765 11:92924731-92924753 CCATGTCACTATCAGCATTTTGG - Intergenic
1087119997 11:94563806-94563828 CCTTAGCAGTATTCACATTTTGG - Intronic
1087126952 11:94637770-94637792 CTTTGGCATTATTGACATTTTGG - Intergenic
1087157626 11:94920336-94920358 CCTCAACACTGTTGACATTTGGG - Intergenic
1087195755 11:95302842-95302864 CTTTGACACTGTTGACATTTGGG + Intergenic
1087474420 11:98618736-98618758 CCATGTCACTATCAGCATTTTGG + Intergenic
1087496015 11:98891451-98891473 CCCTGTCACTATCAGCATTTTGG + Intergenic
1087653413 11:100895310-100895332 CCTCAGCACTATTAACATTTTGG + Intronic
1087668873 11:101082498-101082520 CCATGTCACTATCAGCATTTTGG - Intronic
1088484843 11:110330535-110330557 CCATGTCACTATCAGCATTTTGG + Intergenic
1088857014 11:113765142-113765164 CCTTGTCACTATTGATGTTTTGG - Intronic
1088944928 11:114501993-114502015 CCATTGCACTATTGACATTTTGG + Intergenic
1089423793 11:118352771-118352793 TATCTACACTATTAACATTTTGG + Intronic
1089473305 11:118738311-118738333 CCATATCACTATTAGCATTTTGG - Intergenic
1089820436 11:121220925-121220947 TCTTAAGTCTATTAACATTTGGG - Intergenic
1089992980 11:122879143-122879165 CCTCGGCATTATTGACATTTTGG + Intergenic
1090006236 11:123005059-123005081 CCTTGGCACTCTTGACATTTTGG + Intergenic
1090034625 11:123237990-123238012 ACATGGCACTATTGACATTTTGG - Intergenic
1090090183 11:123689711-123689733 CCTCTGCACTATTGACATTTTGG + Intergenic
1090233546 11:125128389-125128411 CCTTGGCACTATTAACATGTTGG + Intergenic
1090469532 11:126967901-126967923 CCTTGGCATTATTGATATTTTGG - Intronic
1090498245 11:127235588-127235610 CCTTGGCACTATTGATATTTTGG + Intergenic
1090595436 11:128315763-128315785 CCATATCACTATCAACATTTTGG + Intergenic
1090704811 11:129326599-129326621 AATAGACACTTTTAACATTTTGG + Intergenic
1091428497 12:412471-412493 CCTCGGCATTATTGACATTTTGG + Intronic
1091656622 12:2351100-2351122 CCTTGGCCCTATTGACATTTGGG + Intronic
1091849575 12:3684393-3684415 CCTTGGCACTACCGACATTTTGG + Intronic
1092797660 12:12129304-12129326 CCTAGACAATATTAACAATGGGG - Intronic
1092856575 12:12679733-12679755 CCTTAGCACTATTGGCATTTGGG - Intronic
1093206971 12:16263178-16263200 CCATGTCATTATTAGCATTTTGG - Intronic
1093650216 12:21634544-21634566 CCTCAACACTATTGACCTTTTGG - Intergenic
1093931036 12:24955305-24955327 CTTTGGCACTATTGACATTTAGG - Intergenic
1094070469 12:26407319-26407341 GCTTAACATTATTAATATTTTGG + Intronic
1094261619 12:28507295-28507317 CCTTGGCATAATTGACATTTTGG + Intronic
1094327869 12:29259335-29259357 TCTTGGCACTATTGACATTTTGG - Intronic
1094680154 12:32660516-32660538 CCTCGGCACCATTGACATTTTGG - Intergenic
1094743414 12:33315289-33315311 CCGTATCACTATTAGCATTTTGG + Intergenic
1095655141 12:44660271-44660293 CCTTGGGACTATTGACATTTTGG + Intronic
1095734301 12:45539812-45539834 CCTTGGCATTATTAACATTTGGG + Intergenic
1095782801 12:46078749-46078771 CCTTATCACTATCAGCATTTTGG + Intergenic
1095800021 12:46262004-46262026 CCTTCACACTACTGGCATTTGGG - Intronic
1095906436 12:47382919-47382941 CCTTGGCACTATTGACTTTTAGG - Intergenic
1095937623 12:47703328-47703350 CCTTGGGACTACTGACATTTTGG + Intronic
1095980085 12:47967729-47967751 CCTTGGCACTACGAACATTTTGG + Intronic
1096084499 12:48856722-48856744 CCCTGGAACTATTGACATTTTGG - Intergenic
1096599153 12:52717247-52717269 CCTTGGCGCTATTGACATTTTGG + Intergenic
1097302840 12:58036529-58036551 CCATATCACTATGAACATTTTGG + Intergenic
1097319609 12:58210600-58210622 TCTCGGCACTATTGACATTTTGG + Intergenic
1097541012 12:60943202-60943224 TATTAACACTAATAACATTTTGG - Intergenic
1097558249 12:61167084-61167106 CCATATCACTATTAGCATTTTGG + Intergenic
1097612282 12:61838950-61838972 CCTTGGCACTATTGATATTTGGG - Intronic
1097705478 12:62864189-62864211 CCTTGGCACTAATGACATTTTGG - Intronic
1097903503 12:64896929-64896951 CTTTGACACTACTGACTTTTTGG - Intergenic
1097936792 12:65261675-65261697 CCCTGGCACTAGTAACATTAGGG - Intergenic
1098096354 12:66960800-66960822 CCTTGGCACTACTGACATTTTGG - Intergenic
1098202668 12:68072953-68072975 CCTTGGCTCTACTGACATTTGGG + Intergenic
1098423809 12:70335986-70336008 CCTCCACACTGTTGACATTTGGG + Intronic
1098549624 12:71748923-71748945 CCTTGGCAACATTGACATTTTGG + Intergenic
1098664001 12:73136734-73136756 CCTTGGCATTATTGACATTTTGG - Intergenic
1098845062 12:75524675-75524697 CCTTGGCACTATTGATATTTTGG - Intergenic
1098867128 12:75775764-75775786 CCTTGGCACTACTGACACTTTGG + Intergenic
1099156533 12:79183531-79183553 CCTTGACACTGTTGACATTTTGG - Intronic
1099204071 12:79708418-79708440 CCTTCACTCAATAAACATTTTGG + Intergenic
1099288651 12:80747336-80747358 CCTTGCCACTACTGACATATTGG - Intergenic
1099386349 12:82018159-82018181 CCATATCACTATCAACATTTTGG - Intergenic
1099536737 12:83855082-83855104 CTATATCACTATTAACATTTTGG - Intergenic
1099633437 12:85179867-85179889 CCTTGAAAAGATTAACAGTTGGG - Intronic
1099790542 12:87329157-87329179 CCTTGGCACTATTAGCAATTTGG + Intergenic
1099800474 12:87451098-87451120 CCATGTCGCTATTAGCATTTTGG - Intergenic
1099907756 12:88791968-88791990 CCATATCACTATTAGCATTTTGG - Intergenic
1100001976 12:89848314-89848336 CCTCGTCACTATTGACATTTTGG + Intergenic
1100060337 12:90567073-90567095 CATTATCACTATTAGCATTTTGG + Intergenic
1100159583 12:91842920-91842942 CCATATCACTATCAACATTTTGG - Intergenic
1100527549 12:95433662-95433684 TCCTGGCACTATTGACATTTTGG + Intergenic
1100571843 12:95850186-95850208 CCTTGATATTATTGACATTTTGG - Intergenic
1100654296 12:96624159-96624181 CCTCGACACTATCAGCATTTTGG + Intronic
1100658056 12:96668063-96668085 CCATATCACTATCAACATTTTGG + Intronic
1100728362 12:97434928-97434950 CCTTGTCATTATTAACATTTTGG + Intergenic
1101012829 12:100468816-100468838 CTTTGGCACTATTGACATTTGGG + Intergenic
1101022368 12:100566208-100566230 CCTCAGCACTGTTAACATTTTGG - Intergenic
1101203956 12:102466521-102466543 CCTCAACACTATTGACATTTTGG - Intronic
1101209665 12:102523413-102523435 CCTTGGCACTATTGACATTTGGG - Intergenic
1101209770 12:102524217-102524239 CCTTGGCATTATTCACATTTGGG + Intergenic
1101377726 12:104185167-104185189 CCTTGACACTATTAACATTTGGG - Intergenic
1101416875 12:104516088-104516110 CCTTGGCAGTATTGACATTTAGG + Intronic
1101615309 12:106330539-106330561 CCTCGGCACTATTGACATTTTGG - Intronic
1101622255 12:106399883-106399905 CCTTGACAGTCTTTACAATTTGG - Intronic
1101633392 12:106517127-106517149 GCTTGGCACTACTCACATTTGGG + Intronic
1102005665 12:109587827-109587849 CATTGGCACTATTGAGATTTGGG + Intronic
1102137282 12:110585981-110586003 GCTTGACACTATTGACATTTTGG + Intergenic
1102214288 12:111149395-111149417 CCTTGACACTTTTGACATTTGGG + Intronic
1102289477 12:111687317-111687339 ACTCTGCACTATTAACATTTTGG + Intronic
1102637125 12:114334277-114334299 CCTCAACACTATTGACATTTGGG + Intergenic
1102706753 12:114887711-114887733 CCTGGGCCCTATAAACATTTTGG - Intergenic
1102766591 12:115439048-115439070 CCTTGGCACTGTTGACATTTAGG - Intergenic
1102766729 12:115440049-115440071 CTTTGACACTATTGACATTTAGG + Intergenic
1102769552 12:115463172-115463194 CCTGAACACTATTGACATTTTGG - Intergenic
1102791771 12:115652333-115652355 CCTTGGCACTGTTGACATTTGGG - Intergenic
1102902907 12:116652324-116652346 CCATGGCACTATTAATATTCTGG - Intergenic
1102976317 12:117209376-117209398 CCTTAGCACTATTGGCATTTGGG - Exonic
1103013916 12:117479420-117479442 CCTTGGCACTATTGACATTTGGG + Intronic
1103025483 12:117570423-117570445 CCTTGGCACTATTGGCATTTGGG - Intronic
1103027471 12:117585172-117585194 CCTTGATGCTATTGACATTTTGG - Intronic
1103054678 12:117809276-117809298 CTTTGACATTGTTAACTTTTGGG + Intronic
1103057866 12:117835784-117835806 CCTTGGCACTGTTGACATTTGGG - Intronic
1103080271 12:118018339-118018361 CCTCAGCACTATTGACATTTTGG + Intronic
1103084911 12:118055347-118055369 CCTTGGCATTGTTGACATTTTGG - Intronic
1103141458 12:118552390-118552412 CCTTGGCACTGTTGACATTACGG + Intergenic
1103192217 12:119011295-119011317 CCTTGGCACTACTGACATTTAGG + Intronic
1103284683 12:119790813-119790835 AGTTGGCACTATTGACATTTTGG - Intronic
1103287758 12:119816972-119816994 CCTTGGCACTGTTGACATTTGGG - Intronic
1103358247 12:120337718-120337740 CCATATCACTATCAACATTTTGG + Intergenic
1103380533 12:120490815-120490837 CCTTGGCACTATTCACCTTTTGG - Intronic
1103844827 12:123893940-123893962 CCTTGGCGCTATTGACATCTGGG - Intronic
1104262021 12:127193380-127193402 CCTTGGCACTATTGCTATTTAGG + Intergenic
1104494460 12:129223908-129223930 ACTTGACACTATTGATATTTTGG + Intronic
1104570713 12:129922906-129922928 CTTTGGCACTATTAATATTTTGG - Intergenic
1105044919 12:132994813-132994835 CCTCAGCACTATTGACATTTTGG + Intronic
1105467385 13:20658614-20658636 CCTTGGCACCTTTGACATTTGGG + Intronic
1105491150 13:20889569-20889591 ACTTGCCATTATTAGCATTTCGG - Intronic
1106508417 13:30391961-30391983 CCTCAACACTATTGACATTTTGG - Intergenic
1106532283 13:30604543-30604565 CCTTGGTACTATCAACGTTTTGG - Intronic
1106598380 13:31166412-31166434 CCTTGGCACTGTTGACATTTTGG + Intergenic
1106695649 13:32169932-32169954 CCTTGGCACTATTGACATTTTGG + Intronic
1106821731 13:33472397-33472419 TGTTAACACTATTGACATTTGGG + Intergenic
1106914222 13:34495002-34495024 CCTTGACGGTCTTTACATTTTGG - Intergenic
1107226434 13:38054407-38054429 CTTGGGCACTATTAACATTTCGG - Intergenic
1107266665 13:38563582-38563604 CTTTGGCACCTTTAACATTTTGG - Intergenic
1107364018 13:39650885-39650907 CTTTGGCACCATTGACATTTGGG - Intergenic
1107660015 13:42629176-42629198 CCTTGGCACCATTGACCTTTTGG + Intergenic
1107866477 13:44708053-44708075 CTTTGGCACTATGGACATTTGGG - Intergenic
1108086565 13:46799304-46799326 CCTCGGCACTGTTGACATTTGGG + Intergenic
1108273910 13:48789111-48789133 CCTTGACACCACTGACATTTTGG - Intergenic
1108603466 13:52014806-52014828 CCTTGACACTACTGACATTTTGG - Intronic
1108972839 13:56399200-56399222 CCTTGGCACTATTGATATTCTGG - Intergenic
1109031955 13:57202214-57202236 TTTTGACACTAGCAACATTTTGG - Intergenic
1109111187 13:58319815-58319837 CCTTAGCACTATTAGCATTTTGG - Intergenic
1109187365 13:59286185-59286207 CCTTGGCACCACTGACATTTTGG - Intergenic
1109263407 13:60169607-60169629 CCTTGGCACCATTGACATTTGGG + Intergenic
1109324743 13:60853534-60853556 CCATGTCACTATCAGCATTTTGG + Intergenic
1109374094 13:61466552-61466574 CCTCGACACTATGAGCATTTTGG - Intergenic
1109393738 13:61726271-61726293 CCATATCACTATCAACATTTTGG + Intergenic
1109416773 13:62051072-62051094 CCATGTCACTATCAGCATTTTGG - Intergenic
1109480498 13:62945881-62945903 CCATGTCACTATCAGCATTTTGG + Intergenic
1109645590 13:65250545-65250567 CCTTGATACTATTGCCATTTGGG + Intergenic
1109692057 13:65907370-65907392 CCATGTCACTATCAGCATTTTGG - Intergenic
1109710170 13:66148901-66148923 CCATGGCACCATTGACATTTTGG - Intergenic
1109742563 13:66574001-66574023 CCTAGATACTCTTATCATTTTGG + Intronic
1110040122 13:70744393-70744415 CAGTTACCCTATTAACATTTTGG - Intergenic
1110174561 13:72540283-72540305 CCTTGGCACTATTGACATTTTGG + Intergenic
1110215133 13:73017003-73017025 CCTGCCCACTATTGACATTTTGG + Intergenic
1110231586 13:73173018-73173040 TCTCAACACTATTGACATTTGGG + Intergenic
1110284076 13:73729592-73729614 TCTTGACATTTTTAAGATTTTGG - Intronic
1110460424 13:75738929-75738951 CCTTGGCACTGTTGACACTTTGG + Intronic
1110487818 13:76067556-76067578 CCATATCACTATCAACATTTTGG - Intergenic
1110646421 13:77890573-77890595 CCTCAGCACTATTGACATTTTGG - Intergenic
1110711226 13:78653182-78653204 CTTTGACATTACTAACATTTTGG + Intronic
1111205648 13:85006510-85006532 CCTTAACACTATTGAGATTTGGG + Intergenic
1111227203 13:85289353-85289375 CTATATCACTATTAACATTTTGG + Intergenic
1111280393 13:86015437-86015459 CCTTGACACTATTGACATTTTGG + Intergenic
1111435017 13:88195091-88195113 TCTTGACACTACTGACACTTTGG - Intergenic
1111650181 13:91080755-91080777 CCTTGACACTACTAATATTTTGG + Intergenic
1111740695 13:92202041-92202063 CATTTACACTATAAAGATTTTGG + Intronic
1111801414 13:92986027-92986049 CCTTGAGAACATTAACATATAGG + Intergenic
1111879165 13:93933362-93933384 CCTTGAAACTATTGTCACTTAGG - Intronic
1112352752 13:98650308-98650330 CCTTGGCACTATTGACACTTGGG - Intergenic
1112359582 13:98705343-98705365 CCTTGGCACTGTGAACATTTGGG + Intronic
1112392087 13:98994468-98994490 CCTTAGCACTGTTGACATTTTGG - Intronic
1112704888 13:102056286-102056308 CCTTGAGACTACCTACATTTAGG + Intronic
1112718527 13:102214848-102214870 CCTTGACATCACTGACATTTTGG - Intronic
1112825127 13:103383076-103383098 CCATGTCACTATCAGCATTTTGG + Intergenic
1112857868 13:103792981-103793003 CCATATCACTATTAGCATTTTGG + Intergenic
1112896888 13:104310359-104310381 AATTGACACTACTGACATTTTGG - Intergenic
1112949320 13:104971945-104971967 CCATAGCACTATTAATATTTTGG - Intergenic
1113030641 13:105990393-105990415 CCTTAACCCTATTGACATTTTGG + Intergenic
1113031604 13:105999497-105999519 CCTTGGCTGTATTGACATTTGGG + Intergenic
1113127441 13:106995464-106995486 CTTTGGCATTATTAACATTTGGG - Intergenic
1113591177 13:111502298-111502320 CCTTGGCACCACTGACATTTTGG - Intergenic
1114130248 14:19783410-19783432 TCTCGGCACTATTGACATTTTGG - Intronic
1114141645 14:19918199-19918221 CTTTGGCATTATTGACATTTGGG - Intergenic
1114355177 14:21899694-21899716 CCTTGGCACTACTGACATTTTGG + Intergenic
1114397729 14:22382080-22382102 TCTTGATTCTATTTACATTTTGG - Intergenic
1114645811 14:24255502-24255524 CCTTGTCACTATTCACCTGTGGG + Exonic
1114786731 14:25608740-25608762 CCTTGGCACTACTGACATTTTGG - Intergenic
1115052240 14:29077284-29077306 CCTTGACACTATTGCCATTTTGG + Intergenic
1115061251 14:29192813-29192835 CCTTGACACAATGGATATTTTGG - Intergenic
1115097859 14:29660389-29660411 CCTCAGCACTATTGACATTTTGG + Intronic
1115140242 14:30162465-30162487 TTTTGGCACTATTGACATTTTGG - Intronic
1115183425 14:30656400-30656422 CCTTGGCATTATTGACGTTTTGG + Intronic
1115312021 14:31988326-31988348 CCATGTCACTATCAGCATTTTGG - Intergenic
1115417390 14:33152190-33152212 CCTTGGTACTACTGACATTTGGG - Intronic
1115788759 14:36856034-36856056 CCTCGACTCTATTGACACTTTGG - Intronic
1115855539 14:37625930-37625952 CATTGGCACTATTGACATTTTGG + Intronic
1115978156 14:39019215-39019237 CCTTGACGGTCTTTACATTTTGG - Intergenic
1116086395 14:40244207-40244229 CCTTGGCACTATTAACATTTTGG + Intergenic
1116263393 14:42659524-42659546 CCATATCACTATCAACATTTTGG - Intergenic
1116485422 14:45443307-45443329 CCATATCACTATTAGCATTTTGG - Intergenic
1116491672 14:45510946-45510968 CCTTGGTACTATTAACATTTTGG - Intergenic
1116560327 14:46370457-46370479 CCTTCACAACATTAACATTTAGG - Intergenic
1116625182 14:47254529-47254551 CCTTATCACTATCAGCATTTTGG + Intronic
1116675376 14:47900068-47900090 CCTTAAAAATATTAACATTACGG - Intergenic
1116718817 14:48466039-48466061 CCTTGTGACTATTAACATTTTGG - Intergenic
1116742577 14:48775843-48775865 CCATATCACTATTAGCATTTTGG - Intergenic
1116823514 14:49648747-49648769 CCTTGGCACTTTTGACATTTTGG - Intronic
1116832562 14:49736685-49736707 CCTTGGCATTACTGACATTTTGG + Intronic
1116837608 14:49786225-49786247 CTTTGGCACTATTAACATTAGGG - Exonic
1117007879 14:51440920-51440942 CCCTGGCACTATTAAGATTTGGG + Intergenic
1117032223 14:51684746-51684768 ACTTGCCACTACTGACATTTTGG - Intronic
1117109231 14:52431586-52431608 CCTTGGCACGACTACCATTTCGG + Exonic
1117430819 14:55658246-55658268 CCTCAACTCTAGTAACATTTTGG - Intronic
1117439057 14:55743465-55743487 CCTCAACCCTATTGACATTTTGG - Intergenic
1117515127 14:56493095-56493117 TATTGGCACTATTGACATTTGGG - Intronic
1117549725 14:56822538-56822560 CCTTGGAACTATTAACACTTTGG - Intergenic
1117758142 14:58998041-58998063 CCATAACACTATCACCATTTTGG - Intergenic
1117771037 14:59134877-59134899 CCTCAACACTCTTCACATTTTGG - Intergenic
1118105022 14:62648994-62649016 CTTTGTGGCTATTAACATTTAGG + Intergenic
1118221554 14:63859197-63859219 CCCTGGCACTACTAACACTTTGG - Intronic
1118471783 14:66081191-66081213 GCTTGTCACTACTGACATTTGGG + Intergenic
1118475691 14:66114898-66114920 ACTTGGCTCTATTGACATTTTGG + Intergenic
1118495660 14:66305930-66305952 CCTCGGCACTATTAACAATTAGG - Intergenic
1118575640 14:67239457-67239479 CCTTGGCACTATTGACATTTGGG - Intergenic
1118790723 14:69089898-69089920 CCTTATCATTGTTAACATTTTGG - Intronic
1118974202 14:70663482-70663504 CCTCAGCACTATTGACATTTTGG - Intronic
1119125509 14:72122044-72122066 TCTTGGCACTACTGACATTTTGG - Intronic
1119199592 14:72742709-72742731 CCTGGAGACTATTAAAATGTGGG + Intronic
1119316371 14:73698958-73698980 CCTTGGAACTATTAACATTTTGG + Exonic
1119591512 14:75892646-75892668 CCTTGCCACTACTGACATGTTGG - Intronic
1119658188 14:76432295-76432317 CCTCGGCACTACTAACATCTGGG - Intronic
1120048197 14:79832649-79832671 CCTCTACACTATTGCCATTTTGG - Intronic
1120457026 14:84744723-84744745 TCTTGGCACTATTGACATTTTGG + Intergenic
1120504283 14:85335335-85335357 CTTTGATGCTATTGACATTTTGG + Intergenic
1120583144 14:86279122-86279144 CCATATCACTATCAACATTTTGG - Intergenic
1120597533 14:86460014-86460036 TCTTGGCACTATTAACATTTAGG + Intergenic
1120728427 14:87973718-87973740 CCTCAGCACTATTAACATTTTGG + Intronic
1120753097 14:88216533-88216555 CCTCGATACTATTGACATTTTGG - Intronic
1120854205 14:89198763-89198785 CCTTAGCACTATTCACCTTTTGG - Intronic
1120870201 14:89329900-89329922 CCTTGGTACTATTGACATTTGGG - Intronic
1121080569 14:91104489-91104511 CTGTGACACTACTGACATTTGGG - Intronic
1121128693 14:91426208-91426230 CCTTATCACTATCAGCATTTTGG - Intergenic
1121162213 14:91754250-91754272 CCTTGATACTATTGACATTTTGG - Intronic
1121162309 14:91755070-91755092 CCTTAGCACTATTGACATTCTGG - Intronic
1121366840 14:93320435-93320457 CCTTGGCACTCTTGACATTTGGG - Intronic
1121471081 14:94154955-94154977 CCATATCACTATCAACATTTTGG - Intronic
1121603440 14:95223203-95223225 CCTTGGCACTGTTGACATTTGGG - Intronic
1121718505 14:96092966-96092988 CCTCGGCACTATTGGCATTTTGG - Exonic
1121881062 14:97500639-97500661 CCTTGGCACTATGGAAATTTAGG + Intergenic
1121951082 14:98171710-98171732 CCTTGGCCCTGTTGACATTTGGG + Intergenic
1121979659 14:98443750-98443772 CCTCAGCACTATTGACATTTGGG + Intergenic
1121989986 14:98547929-98547951 CCTTGAGAATATAAACTTTTAGG - Intergenic
1121998338 14:98624621-98624643 CCTCAACACCATTGACATTTTGG + Intergenic
1122045702 14:99021649-99021671 CCTTGACACTGTTGACGTTTGGG + Intergenic
1122109502 14:99487305-99487327 CTTTGGCACTATTGACATGTTGG + Intronic
1122332316 14:100930529-100930551 CTTTGGCTCTATTGACATTTTGG + Intergenic
1123573518 15:21641113-21641135 TCTTGGCACTATTGACATTTTGG - Intergenic
1123610138 15:22083729-22083751 TCTTGGCACTATTGACATTTTGG - Intergenic
1124366494 15:29075357-29075379 CAATGACACCATTAACATTGAGG + Intronic
1124444877 15:29721743-29721765 CCATATCACTATTAGCATTTTGG - Intronic
1124446064 15:29733821-29733843 CCTTGGCACTGTTGACATTTTGG - Intronic
1124474854 15:30024360-30024382 CACTGGCACTATTGACATTTTGG + Intergenic
1125222992 15:37361288-37361310 CATTCACATTATAAACATTTGGG + Intergenic
1125455383 15:39853812-39853834 ACCTGACACTATTGACATTCTGG - Intronic
1125464952 15:39941672-39941694 CCTTGGCACTACTGACATGTGGG + Intronic
1125869303 15:43084166-43084188 CCTTAATACTACTGACATTTTGG + Intronic
1125882537 15:43207043-43207065 ATTTGACACCATTGACATTTGGG - Intronic
1125912166 15:43450698-43450720 ACTTGTCACTGTTAACAGTTTGG - Intronic
1126273166 15:46845591-46845613 CCATATCACTATCAACATTTTGG + Intergenic
1127116660 15:55734158-55734180 CCTTGGCACAACTGACATTTTGG - Intronic
1127205644 15:56715148-56715170 CCTAGAAACTCTTAACTTTTTGG - Intronic
1127445393 15:59057247-59057269 CCTTGGCAATACTAACATTTTGG - Intronic
1127544271 15:59975730-59975752 CATTGGCACTATTGTCATTTTGG - Intergenic
1127692549 15:61412383-61412405 CCTTAGCACTATTGACATTTGGG + Intergenic
1127815110 15:62601303-62601325 CCTTGGCACAATTGACATTTTGG - Intronic
1127990608 15:64113257-64113279 CCTTAGCACTATTAACATTTTGG + Intronic
1128220020 15:65962501-65962523 CCTTGCCACCATGAACATTTTGG - Intronic
1128270314 15:66303789-66303811 CCTACACACTGTTAACAGTTTGG - Intronic
1128645915 15:69378931-69378953 TTTTGACACTATTGACACTTTGG - Intronic
1128673898 15:69594984-69595006 CCTTGGCATTGTTAACAATTGGG + Intergenic
1128739330 15:70072828-70072850 CCTTGACACTGTTGAAATTTGGG - Intronic
1128828041 15:70739250-70739272 TCTTGGCACTACTGACATTTTGG + Intronic
1128875698 15:71199407-71199429 CCTAGACACTGTTGACATTTTGG + Intronic
1129342567 15:74895841-74895863 CCTTGGCGCTACTGACATTTGGG - Intronic
1129565751 15:76621447-76621469 CCTTGGTACTATTAACATTTTGG + Intronic
1129820176 15:78595641-78595663 CCTTAGCACTATGGACATTTTGG - Exonic
1129854934 15:78816788-78816810 CCTTGGTACTATTGACACTTGGG - Intronic
1129911293 15:79228933-79228955 CCTTGACACTATTGACATTTGGG - Intergenic
1129929837 15:79401600-79401622 TCTTGGCACTATTGACATTTGGG - Intronic
1129945824 15:79538732-79538754 CTTTGGCAATATTGACATTTGGG - Intergenic
1129969929 15:79769246-79769268 CCTTGGCACTGTTGACACTTTGG + Intergenic
1130182704 15:81646388-81646410 CCTGGACACTATTGACACTTTGG - Intergenic
1130239482 15:82173760-82173782 CGTAGCCACTATTGACATTTTGG - Intronic
1130369503 15:83272813-83272835 CTTTGGCACTACTGACATTTTGG + Intronic
1130693496 15:86106639-86106661 CTTTGGCACTGTTGACATTTTGG - Intergenic
1130791377 15:87159716-87159738 CCATGTCACTATAAGCATTTTGG - Intergenic
1130826948 15:87558810-87558832 CCTCGGCACTATTAACATTCAGG + Intergenic
1130913449 15:88286739-88286761 CATTGGTACTATTGACATTTTGG - Intergenic
1130980461 15:88808737-88808759 CCTTGGGACTATTGACATTTTGG - Intronic
1131018984 15:89081983-89082005 CCTCAGCACTATTGACATTTGGG + Intergenic
1131256690 15:90867621-90867643 CCTTGGCATTATCAACATCTTGG - Intergenic
1131382260 15:91973782-91973804 GCTTGGCATTATTGACATTTGGG - Intronic
1131540406 15:93270741-93270763 CCTTGGCACCATTGACATTTTGG + Intergenic
1131649896 15:94387227-94387249 TCTTGGCACTATTGATATTTGGG + Intronic
1131667150 15:94582507-94582529 TCTTGACACAATTCACACTTTGG + Intergenic
1131732639 15:95297959-95297981 CCTTGGCACTATTGACATTTTGG - Intergenic
1131854084 15:96574116-96574138 AATTCACTCTATTAACATTTTGG - Intergenic
1132075758 15:98818532-98818554 CATTGGCAGTATTGACATTTTGG + Intronic
1132121846 15:99183115-99183137 CCTTATCACTATCAGCATTTTGG - Intronic
1132303899 15:100794685-100794707 CCATATCACTATTAGCATTTTGG + Intergenic
1132371213 15:101300709-101300731 CCTCGGCACTATTGACATTTTGG + Intronic
1202982386 15_KI270727v1_random:375526-375548 TCTTGGCACTATTGACATTTTGG - Intergenic
1133151105 16:3831454-3831476 CTTTTCCAATATTAACATTTGGG - Intronic
1133387518 16:5381888-5381910 TCTTGGCGCTATTGACATTTGGG + Intergenic
1133411423 16:5572412-5572434 TCTTGGCGCTGTTAACATTTTGG + Intergenic
1133478444 16:6146393-6146415 CCTCAACACTATTGACATTTGGG + Intronic
1133619576 16:7513495-7513517 CCTTGGCACTATTAACATTTGGG + Intronic
1133703236 16:8329093-8329115 CCTTGGCACTATTGACATTTTGG + Intergenic
1133710141 16:8393449-8393471 CCTTGGCACTATGCACCTTTGGG + Intergenic
1133711659 16:8407435-8407457 CCTTGGCACTATTGAAATTTGGG - Intergenic
1133761594 16:8802946-8802968 CCTTCGCACTATTGATATTTTGG + Intronic
1133815091 16:9190961-9190983 CCTTGGCATTATTGACATTTTGG - Intergenic
1133844064 16:9438168-9438190 CCTTGGCACTATTGATATTTTGG + Intergenic
1133934454 16:10257275-10257297 CCTTGGAACTGTTGACATTTGGG + Intergenic
1133968177 16:10546820-10546842 CCTTGCCACTATTGTCATTTTGG - Intronic
1134112157 16:11522377-11522399 CCTGGGCACTATTAATAGTTGGG + Intronic
1134115058 16:11541888-11541910 CCTTGGCACTATTGACACCTTGG - Intergenic
1134124576 16:11607757-11607779 CCTTGGCACTATTAGTATTTGGG + Intronic
1134213382 16:12296878-12296900 CCCCAACACTATTGACATTTTGG + Intronic
1134389081 16:13802083-13802105 ACTTGACCCTATTGACATTTGGG - Intergenic
1134395734 16:13861206-13861228 TCTTGGCACTATTGACATCTGGG - Intergenic
1134557156 16:15175117-15175139 CCTTGGCACTGTTGGCATTTTGG - Intergenic
1134661432 16:15987454-15987476 CTTTGGCACTGTTGACATTTGGG + Intronic
1134774351 16:16838846-16838868 CCTTGGCACTGCCAACATTTTGG + Intergenic
1134779359 16:16881829-16881851 TCTTGGCATTATCAACATTTGGG + Intergenic
1134788417 16:16965614-16965636 CGTCCACACTATTGACATTTGGG - Intergenic
1134829100 16:17309142-17309164 CCTTGACACTGCTGACATTTTGG + Intronic
1134871437 16:17655695-17655717 CCTTGACTCTATTGACATTTTGG + Intergenic
1134872152 16:17661712-17661734 CCTTGGCACTTTTGACATTTGGG - Intergenic
1134917734 16:18086828-18086850 CCTTGGCACTGTTGGCATTTTGG - Intergenic
1135120998 16:19766580-19766602 CCTTGGCACTATTGACATTTAGG + Intronic
1135187137 16:20324850-20324872 CCTTGGCACTATTGACATTTTGG + Intronic
1135210459 16:20521593-20521615 CTTTGGCACTATTAACTGTTTGG + Intergenic
1135237402 16:20770459-20770481 CCATGGAACTATTGACATTTCGG - Intronic
1135257175 16:20950310-20950332 CCTTGGCACTCTTAACATGTTGG + Intronic
1135294945 16:21271083-21271105 CCTCGGTACTACTAACATTTGGG + Intronic
1135392741 16:22107372-22107394 ATTTGGCACTATTGACATTTGGG - Intronic
1135484498 16:22852212-22852234 CCTCAGCACTATTGACATTTGGG - Intronic
1135615374 16:23907056-23907078 CCTTGGCATTATTGACATTGGGG + Intronic
1135704761 16:24665574-24665596 CCTCAGCACTATTCACATTTTGG + Intergenic
1135815831 16:25632686-25632708 TCTTGAAACTATTGAGATTTTGG + Intergenic
1135855417 16:26005804-26005826 CTCTGGCACTATTACCATTTGGG + Intronic
1135878625 16:26229912-26229934 TCTGGACACTATTAGCGTTTGGG - Intergenic
1136014031 16:27383521-27383543 CCTTGATAGTGTTGACATTTGGG - Intergenic
1136134191 16:28244726-28244748 CTTTGTCACTGTTGACATTTGGG - Intergenic
1137551473 16:49440483-49440505 CCTTGGCACTGTTGACATTCTGG + Intergenic
1137712486 16:50575986-50576008 CCTTGGCACTGTTTACATTTGGG - Intronic
1137783809 16:51120905-51120927 CCTCGGCACTATTGACCTTTGGG + Intergenic
1138154835 16:54693473-54693495 CCTTGGCACTATTGACATTTTGG + Intergenic
1138378035 16:56580374-56580396 CTTTGGCAATATTGACATTTGGG + Intergenic
1138490830 16:57375493-57375515 CAGTGACACTACTGACATTTTGG - Intronic
1138726800 16:59149142-59149164 CCTTGGCACTGTTGAAATTTTGG + Intergenic
1138735400 16:59244949-59244971 TCTTGGCACTGTTGACATTTGGG - Intergenic
1139179496 16:64729275-64729297 ACTGGGCACTATTGACATTTTGG - Intergenic
1139283986 16:65794408-65794430 CCTTGGCAGTTTTAACATTTGGG - Intergenic
1139557291 16:67720324-67720346 CAGTGGCACTATTGACATTTTGG + Intergenic
1140010744 16:71129189-71129211 CCCTGGCACTGTTGACATTTGGG - Intronic
1140053176 16:71501226-71501248 CCTTGGCTCTATAGACATTTGGG - Intronic
1140080291 16:71740192-71740214 CCTTGACAGTAATAGCTTTTAGG + Intronic
1140401300 16:74674072-74674094 CCCTTACACTATTGACATTGGGG + Intronic
1140632572 16:76871850-76871872 CCTTGGCACTGTTGACCTTTGGG + Intergenic
1140932424 16:79640191-79640213 TCTTGGCATTATTGACATTTGGG - Intergenic
1140953316 16:79839612-79839634 CCTTGGCACTCTTGACATTTGGG + Intergenic
1140971198 16:80014450-80014472 CCTCAGCACTATTGACATTTGGG + Intergenic
1140999765 16:80297391-80297413 CCTTGGCACTATTGACATTTGGG + Intergenic
1141022485 16:80510431-80510453 CCTCAACACTACTGACATTTGGG + Intergenic
1141057794 16:80834611-80834633 CCTTGGCACTATTGGCATTTGGG + Intergenic
1141150086 16:81558563-81558585 CCTGGGCACTGTTGACATTTGGG - Intronic
1141218929 16:82050833-82050855 TCTTGGCACTATTGACATTTGGG + Intronic
1141222499 16:82084216-82084238 CCTTGGCACTACTGGCATTTTGG + Intronic
1141229412 16:82150744-82150766 CCTTGGCAGTGTTAACATTTGGG - Intronic
1141355702 16:83344735-83344757 CCTTGGCAATATTGAAATTTTGG - Intronic
1141586944 16:85040342-85040364 CAATGACACTGTTAATATTTGGG - Intronic
1141664941 16:85461173-85461195 CCTTGGGACTGTTGACATTTGGG + Intergenic
1142842208 17:2641891-2641913 TCTTGGCACGATTGACATTTTGG + Intronic
1142965761 17:3580072-3580094 CCTTGGCACTGTTGATATTTTGG - Intronic
1142990953 17:3730561-3730583 CCTCCACACTATTGACGTTTTGG + Intronic
1143050974 17:4125569-4125591 CTTTGATCCTATTAACTTTTTGG - Intronic
1143236472 17:5405596-5405618 CCTTTGTACTATTGACATTTTGG - Intronic
1143402271 17:6654105-6654127 CCTTGGCACTATTGACATTTTGG - Intergenic
1143774895 17:9192622-9192644 CCTTGGCACCATCACCATTTGGG - Intronic
1144238947 17:13290454-13290476 TCTTGGCACTGTTAATATTTTGG + Intergenic
1144472081 17:15553028-15553050 CCTTGGCACAACTGACATTTTGG + Intronic
1144477307 17:15599419-15599441 CCTTGGCACTATTGCCATCTGGG - Intronic
1144662568 17:17080683-17080705 CCTTGGCACTGTTGACATTTTGG - Intronic
1144803584 17:17948962-17948984 GCTTGGCACTCTTAACTTTTTGG - Intronic
1144920932 17:18763950-18763972 CCTTGGCACTATTGCCATCTGGG + Intronic
1144924392 17:18791685-18791707 CCTTGGCACAACTGACATTTTGG - Intronic
1145772458 17:27503382-27503404 ACCTTGCACTATTAACATTTGGG - Intronic
1146198858 17:30837962-30837984 CCTTGCTATTATTGACATTTTGG + Intronic
1146239760 17:31209004-31209026 TGTTGGCACTATTAACATTTTGG + Intronic
1146451071 17:32974480-32974502 CCTTGCCACGACTGACATTTGGG + Intronic
1146702246 17:34971267-34971289 CCTCTACACTATTGACATTTGGG + Intronic
1146720118 17:35118298-35118320 CCTTGGCACTATTGATATTTAGG - Intronic
1147227766 17:38993338-38993360 TCTTGGCACTATTGACATTTTGG + Intergenic
1147560630 17:41506856-41506878 CCTCAACACTATTGATATTTTGG - Intergenic
1147640667 17:41997018-41997040 CCTTGACACTACTGACATTTGGG - Intronic
1147753492 17:42752442-42752464 ACATGACACTAGTAACATATGGG - Intergenic
1148208735 17:45795402-45795424 CCTCAGCACTATTGACATTTGGG + Intronic
1148715418 17:49712253-49712275 CCTTGGCACCACTGACATTTTGG + Intronic
1149086965 17:52729629-52729651 CCTCAGCACTATTGACATTTTGG - Intergenic
1149200791 17:54183612-54183634 CTTCAGCACTATTAACATTTGGG + Intergenic
1149297045 17:55270627-55270649 CCTTGGCACTGTTAATGTTTTGG + Intronic
1149347460 17:55752471-55752493 CCTTGGCAATATTACAATTTGGG - Intronic
1149382651 17:56109340-56109362 CCTCAGCACTATTAACATTTTGG + Intergenic
1149433707 17:56616220-56616242 CCTTGACACTCTTGACATTTTGG + Intergenic
1149459023 17:56812247-56812269 CTTTGGCACTACTGACATTTTGG + Intronic
1149607111 17:57932911-57932933 CTTAGGCACTATTGACATTTGGG + Intronic
1149769737 17:59310885-59310907 CCTCAGCACTATTGACATTTTGG + Intergenic
1149999593 17:61425483-61425505 ACTCGACACTACTGACATTTGGG - Intergenic
1150030562 17:61729971-61729993 ACTTGGCACTATTGACATTTTGG - Intronic
1150350314 17:64439218-64439240 CCATATCACTATCAACATTTTGG + Intergenic
1150439293 17:65178435-65178457 CCATGGCCCTATTGACATTTTGG + Intronic
1150481201 17:65512680-65512702 CCTTGGCACTATTGACATTTTGG - Intergenic
1150570581 17:66382877-66382899 CCTTGGCACTACTGGCATTTTGG - Intronic
1150658046 17:67053448-67053470 CCTTGACACTCTTGATATTTTGG + Intronic
1150673275 17:67221146-67221168 TATCAACACTATTAACATTTTGG + Intronic
1150730209 17:67686171-67686193 CTTTGGTACTATTGACATTTTGG + Intronic
1150767371 17:68012833-68012855 CCTTGACACAGTTGACATTTTGG + Intergenic
1150898040 17:69236892-69236914 CCTTGGTACTATTGACATTTTGG - Intronic
1151102522 17:71572229-71572251 TAATGACACTATTGACATTTTGG + Intergenic
1151124718 17:71832388-71832410 CCTTGGCACCATTGACATTTGGG - Intergenic
1151363540 17:73603027-73603049 CCTTGACACTATTGACAGCTTGG + Intronic
1151474019 17:74335279-74335301 GCTTGGCACTGTTGACATTTTGG - Intronic
1151731302 17:75913085-75913107 ACTTTTCACTTTTAACATTTTGG - Intronic
1151792571 17:76317965-76317987 CCTTAGCACTACTGACATTTTGG + Intronic
1152187789 17:78869011-78869033 TCTCAGCACTATTAACATTTGGG - Intronic
1152198433 17:78931033-78931055 CCTTGGCACAGTTGACATTTGGG + Intergenic
1152547791 17:81011046-81011068 CCACAACACTATGAACATTTTGG - Intergenic
1153440753 18:5116845-5116867 CCATATCACTATTAGCATTTTGG - Intergenic
1153510883 18:5850711-5850733 CCTTGACACTACTGACATTTTGG - Intergenic
1153726783 18:7964987-7965009 TTTTGACACTTTTAACTTTTTGG + Intronic
1154007888 18:10548731-10548753 TCTCAACACTGTTAACATTTGGG + Intronic
1154935161 18:21047424-21047446 GCTTAATACTATTGACATTTTGG - Intronic
1155330316 18:24709297-24709319 CCTTCACACTATTGACATTTTGG + Intergenic
1155515913 18:26623930-26623952 CCATGTCACTATCAGCATTTTGG - Intronic
1155625627 18:27831310-27831332 CCTGGACACAATTAAGAATTAGG - Intergenic
1155707924 18:28838847-28838869 CCATATCACTATTAACATTTTGG + Intergenic
1155719546 18:28993902-28993924 CCTTGGCATTATTGAAATTTTGG + Intergenic
1155993624 18:32306382-32306404 CCTTGGCACTACTGACATTTTGG + Intronic
1156040805 18:32820064-32820086 CCTTAGCACTATTGACATTTTGG - Intergenic
1156187012 18:34675115-34675137 CCTGGGTACTATCAACATTTTGG + Intronic
1156247191 18:35312642-35312664 CCTTAGCACTATTGACATTTTGG + Intergenic
1156362233 18:36393341-36393363 CCTTGACACAATTGACATTTGGG + Intronic
1156452030 18:37272211-37272233 CTTTGACACTATTACCATCTGGG + Intronic
1156925202 18:42569060-42569082 CCTTGGCACTATTTATATTTTGG + Intergenic
1157068828 18:44382256-44382278 CCATATCACTATCAACATTTTGG + Intergenic
1157176339 18:45456025-45456047 CTTGGGCACTATTAACATTTTGG + Intronic
1157288788 18:46395322-46395344 CTTTGTCACTACTGACATTTTGG + Intronic
1157601568 18:48896403-48896425 CCTAGACATTATTGACATTTGGG - Intergenic
1157676694 18:49573869-49573891 CCTAGGCAATATTGACATTTGGG + Intronic
1157716046 18:49888136-49888158 CCTTGACACTGTCAACATTCTGG + Intronic
1157735969 18:50049579-50049601 CCTTGTCACTGTTAACATCTGGG + Intronic
1157864438 18:51168619-51168641 CCTTAGTACTATTGACATTTTGG - Intergenic
1157882229 18:51331428-51331450 CCTTGGCACTATTGGCATTTGGG + Intergenic
1157932189 18:51835284-51835306 CCTTGGCACCACTGACATTTAGG + Intergenic
1157956110 18:52099453-52099475 CATCAACACTATTGACATTTTGG + Intergenic
1157992326 18:52511658-52511680 CCTTGGAGCTATTGACATTTGGG - Intronic
1158271777 18:55724236-55724258 TCTCAACACTATTGACATTTTGG - Intergenic
1158283541 18:55853367-55853389 CCTTGACACTATTGATATTTTGG + Intergenic
1158501426 18:58005600-58005622 CCTTGGCACTACTGACATTTGGG - Intergenic
1158793873 18:60817783-60817805 CCTTGAAGATATTAGCATTTTGG - Intergenic
1158902231 18:61974583-61974605 CCTTGGCACTATTGCCATTGGGG - Intergenic
1159218404 18:65427792-65427814 CCATATCACTATCAACATTTGGG - Intergenic
1159722098 18:71903793-71903815 CCTTAGCGCTATTAACTTTTGGG - Intergenic
1159887962 18:73927442-73927464 CCTTGGAACTGTTGACATTTTGG - Intergenic
1159928451 18:74289900-74289922 CCCTGGCACTGTTGACATTTTGG - Intronic
1159932775 18:74331694-74331716 CCTCCACACTATTGACACTTTGG - Intronic
1161525885 19:4754938-4754960 TCTCGGCACTAATAACATTTGGG + Intergenic
1161751417 19:6100003-6100025 CCCTGGCACTATTGACATTTGGG - Intronic
1161894534 19:7070138-7070160 CCTGGGCACTAATGACATTTGGG - Intronic
1161918836 19:7251016-7251038 CCTCAGCACTATTGACATTTGGG + Intronic
1161938039 19:7384154-7384176 CCTTAGCACTGTCAACATTTGGG + Intronic
1162059800 19:8087528-8087550 GCTTGACACTATGAACATTTGGG + Intronic
1162066604 19:8129530-8129552 CCTGGACACTGCTGACATTTGGG + Intronic
1162180290 19:8864268-8864290 CCTTGAAATTATTGGCATTTGGG + Intronic
1162190537 19:8942355-8942377 CTTTGACACTATTGTCATTTGGG - Intronic
1162780459 19:13004195-13004217 CCTTGGCACTACTGACATTTGGG - Intronic
1162850368 19:13426509-13426531 CCTTGGCACAATTGACATTTTGG - Intronic
1163016639 19:14459835-14459857 CCTTGGCACTGTTGACATCTGGG + Intronic
1163044189 19:14627064-14627086 CCTTGGCACTGTTGACATCTTGG + Intronic
1163382788 19:16979762-16979784 CCTTGGCACTATCAACATTTGGG - Intronic
1164235483 19:23329216-23329238 CTTCAACACTCTTAACATTTAGG - Intronic
1164300806 19:23961299-23961321 CTTCAACACTCTTAACATTTAGG + Intergenic
1164474498 19:28564785-28564807 CCGTGACACTTTCAGCATTTGGG + Intergenic
1164631673 19:29765918-29765940 CCTTGGCACGGTTAGCATTTGGG - Intergenic
1164757471 19:30700846-30700868 CCTTGAAATTAGGAACATTTAGG - Intronic
1164793687 19:31009112-31009134 CCTTGGAACCATTGACATTTTGG - Intergenic
1165588549 19:36944550-36944572 CCTTGACACTATTGACATTTTGG + Intronic
1165632050 19:37309925-37309947 CTCTGACACTATTTACACTTTGG + Intergenic
1165949419 19:39465692-39465714 CCTTGGCACTATTGACTTTTTGG - Intronic
1166052978 19:40271716-40271738 CCTCAACACTAGTGACATTTGGG + Intronic
1166609932 19:44182222-44182244 CCTTGGCACAACTGACATTTTGG + Intergenic
1166736034 19:45085530-45085552 TCTGGACACTATTGACATTTGGG - Intronic
1167215960 19:48164816-48164838 CCTAGACACTATTGACATGTTGG + Intronic
1167582522 19:50354386-50354408 CCTTGACACTATTGACATTTGGG - Intronic
1168227146 19:55003850-55003872 TCTCCACACTATTGACATTTGGG + Intergenic
1168490538 19:56805086-56805108 CCTTGGCTCTACTGACATTTTGG + Intronic
1168522257 19:57061675-57061697 CCTTGGCACTCTTCACATCTGGG + Intergenic
1168522310 19:57062150-57062172 CCTCGGAACTATTGACATTTGGG + Intergenic
1168529552 19:57116987-57117009 CCTGGGCACTACTGACATTTGGG + Intergenic
1168545453 19:57245912-57245934 CCTTAGCACAATTGACATTTAGG - Intronic
925264211 2:2553410-2553432 CCATATCACTATCAACATTTGGG + Intergenic
925402734 2:3587160-3587182 CCTTGGCACTGTTAGCTTTTAGG + Intergenic
925774741 2:7323722-7323744 ACTTGGCACTATTGACACTTTGG - Intergenic
925921491 2:8641025-8641047 CCTTGTCACCATTGACATGTTGG - Intergenic
925969680 2:9097405-9097427 GCTTGACATTCTTGACATTTCGG - Intergenic
925970398 2:9102823-9102845 CCTTGGCACTAGTAAGGTTTTGG + Intergenic
926490058 2:13514294-13514316 GCTTGACATTGTTAACTTTTTGG - Intergenic
926513793 2:13815620-13815642 CCTTAGCACTATTAGAATTTTGG + Intergenic
926581076 2:14633407-14633429 ACTTGACACCAGCAACATTTTGG - Intronic
926596476 2:14795657-14795679 GCTTGGCACTATTAATATTTTGG + Intergenic
926798081 2:16635253-16635275 CCTTGGCACTAGGAACATGTTGG - Intronic
926875905 2:17478440-17478462 CCTTCACACATTTAATATTTGGG + Intergenic
926918223 2:17913936-17913958 CCTCGGCACTATTGACATTGTGG - Intronic
926973166 2:18486956-18486978 CCTTGGCAATGTTGACATTTGGG + Intergenic
926986724 2:18632455-18632477 CCATATCACTATCAACATTTTGG - Intergenic
927242243 2:20929258-20929280 CCATATCACTATCAACATTTTGG + Intergenic
927341982 2:21992984-21993006 CCATATCACTATCAACATTTTGG + Intergenic
927366458 2:22302604-22302626 CCTCAACACTATTGACATTTGGG + Intergenic
927612603 2:24556961-24556983 CCTTGATACTATTGATATTTTGG + Intronic
928592145 2:32828006-32828028 CCATGACACTGTTGGCATTTGGG + Intergenic
928855085 2:35793362-35793384 TCTTGACACTCTTAAAATTAGGG + Intergenic
928997339 2:37307018-37307040 CCTCAGCATTATTAACATTTTGG + Intronic
929020069 2:37544724-37544746 CCTCAGCACTATTGACATTTTGG + Intergenic
929134966 2:38614910-38614932 CCTTGGCACCATTGACATTTTGG + Intergenic
929693569 2:44094885-44094907 CCTTGGCATTATCAACATTTTGG - Intergenic
930002174 2:46868943-46868965 CCTTGGCACTGGTGACATTTTGG - Intergenic
930274628 2:49297095-49297117 CCTTGACACTATTCGTATTTTGG + Intergenic
931000400 2:57773865-57773887 CCTTGGCACTATTAAAATTTGGG - Intergenic
931119296 2:59198697-59198719 CCATATCACTATCAACATTTTGG - Intergenic
931226034 2:60333095-60333117 TCTTGGCACTATGGACATTTTGG - Intergenic
931424887 2:62161782-62161804 ACTTAGCACTATTAGCATTTTGG - Intergenic
931525732 2:63150470-63150492 CCTTAGCGCTATTGACATTTTGG - Intronic
931675836 2:64695339-64695361 CCTTGACACTACTGACATTTTGG + Intronic
931714034 2:65014440-65014462 CCATGACACTATTGACATTTTGG + Intronic
931745773 2:65290834-65290856 CCTCAACACTATTGACATTTTGG - Intergenic
931906486 2:66848923-66848945 CCTCGGCACTATTGAAATTTGGG - Intergenic
931910451 2:66893879-66893901 CCTTGGCACCATTGACATTTTGG + Intergenic
931968499 2:67560155-67560177 CCTTCACACTATTGACATTTTGG + Intergenic
931990835 2:67788620-67788642 CCTAGACCCTATTAACATTTTGG + Intergenic
932056670 2:68452411-68452433 CTTTATCACTATTAACATTCTGG - Intergenic
932083535 2:68737391-68737413 CCTAGATACCATTGACATTTGGG + Intronic
932122546 2:69115015-69115037 CCTCAACACTACTGACATTTTGG + Intronic
932179413 2:69632462-69632484 CCTTGGCACTACTAACATTTTGG - Intronic
932244591 2:70185863-70185885 CCTTGGCACTGCTGACATTTAGG + Intronic
932522675 2:72429801-72429823 CCTTGGCACCATTGACATGTTGG - Intronic
932562314 2:72884084-72884106 CCATATCACTATCAACATTTTGG + Intergenic
932638334 2:73413441-73413463 CCTTGGCACTATTGACATTTTGG + Intronic
932642448 2:73462505-73462527 CCTTGACAGTCTTTACATTTTGG - Intronic
932710237 2:74057734-74057756 CCTTGACAGAACTGACATTTTGG - Intronic
932813159 2:74841044-74841066 CCTTGGTGCTATTGACATTTTGG + Intronic
932985076 2:76716266-76716288 CCTTGGCACTGTTGACATTTGGG - Intergenic
933040486 2:77458779-77458801 CCTTAACAATATTAAAATCTAGG - Intronic
933085022 2:78045390-78045412 CCATGTCACTATCAACATTTTGG - Intergenic
933092374 2:78137304-78137326 CCATATCACTATTATCATTTTGG - Intergenic
933261205 2:80133506-80133528 CCTTTACTCTATATACATTTGGG - Intronic
933351605 2:81159571-81159593 CCTCGGCACTATTGACAATTTGG + Intergenic
933774323 2:85762751-85762773 CCTTGGCACTATCGACATTTGGG + Intronic
933798302 2:85939066-85939088 CCTTGTCACGATTGACATTTTGG + Intergenic
933842577 2:86299278-86299300 CCTTGGCACTACTGACATTTGGG + Intronic
934482555 2:94664888-94664910 CCATATCACTATTAGCATTTTGG + Intergenic
934606647 2:95700285-95700307 CCTTAACAGTGTTGACATTTTGG + Intergenic
934976638 2:98807341-98807363 CCTTGGCACTGCTGACATTTTGG + Intronic
935013917 2:99161419-99161441 CCTAATCACAATTAACATTTTGG - Intronic
935036250 2:99377379-99377401 CCTTGGCACTATTAAAATTTGGG + Intronic
935262068 2:101364250-101364272 CCTTGGCACGGTTGACATTTTGG + Intronic
935419841 2:102855389-102855411 CCATATCACTATTAGCATTTTGG + Intergenic
935827017 2:106962207-106962229 CCTTGGCACTATAGACGTTTGGG - Intergenic
936735206 2:115432880-115432902 TCTTGGCACTACTGACATTTTGG - Intronic
936770888 2:115911934-115911956 TATTGAGACTATTAAGATTTTGG - Intergenic
936905661 2:117533256-117533278 CCTTATCACTATCAGCATTTTGG - Intergenic
936989498 2:118347647-118347669 CTTTAACACTATTGGCATTTTGG + Intergenic
936997426 2:118430198-118430220 TCTTGACACTATTGACATTTTGG + Intergenic
937050659 2:118885860-118885882 CCTTGGCACTATGGACATTTTGG - Intergenic
937163149 2:119785029-119785051 CTTTAGCACTATTGACATTTTGG + Intronic
937330273 2:121022312-121022334 CCTGGGCACTAGTGACATTTTGG - Intergenic
937380649 2:121373589-121373611 CCATATCACTATTAGCATTTTGG - Intronic
937752057 2:125488163-125488185 CCTTGACACTATTGATATTTTGG + Intergenic
937850030 2:126623721-126623743 TCTTGACACCATTGACATTTTGG - Intergenic
938044582 2:128106417-128106439 GATTGACACCATTAACATTCTGG + Intronic
938461318 2:131499318-131499340 CCTTGGTGCTATTGACATTTTGG - Intergenic
938630816 2:133165185-133165207 CCTTGACACTATTGACATTTTGG - Intronic
938663393 2:133509807-133509829 CCTCGACACTATCGACAGTTTGG - Intronic
938832184 2:135062251-135062273 CCTTGGCACTATTGACATTTTGG + Intronic
938872998 2:135501300-135501322 AATTCACACTGTTAACATTTTGG + Intronic
938925631 2:136038985-136039007 CCTTGGCACTATTGATATTTGGG + Intergenic
939086519 2:137725772-137725794 CCTTAGCACTATTGACACTTTGG - Intergenic
939249127 2:139663275-139663297 CCATGTCACTATCAACATTTTGG + Intergenic
939288609 2:140164543-140164565 CTTTGGCACTATTGATATTTTGG + Intergenic
939372973 2:141326743-141326765 ACTTGGCACTACTGACATTTTGG - Intronic
939482768 2:142770370-142770392 CCATGTCACTATCAGCATTTTGG - Intergenic
939667022 2:144964934-144964956 CCCTATCACTATTAGCATTTTGG - Intergenic
939738039 2:145873785-145873807 CCATGGCACTATTAAAATCTTGG - Intergenic
939885628 2:147678311-147678333 CCCTGGCACTACTGACATTTCGG + Intergenic
940150225 2:150592076-150592098 CATTGCCACTATTGACATTTTGG + Intergenic
940357987 2:152766467-152766489 CCTTGGCACTATTGATATTTTGG - Intergenic
940386938 2:153084988-153085010 CCATGTCACTATCATCATTTTGG - Intergenic
940450005 2:153825265-153825287 CCTCAGTACTATTAACATTTTGG - Intergenic
940467325 2:154047767-154047789 CTTTGGCTCTATTGACATTTGGG + Intronic
940578923 2:155550889-155550911 CCATAACACTATCAGCATTTTGG + Intergenic
940621642 2:156120988-156121010 CCATATCACTATTAGCATTTTGG - Intergenic
940635323 2:156292341-156292363 CCTTGGCACTATTGATATTTTGG - Intergenic
940977163 2:159958871-159958893 ACCTTACACTATTGACATTTGGG - Intronic
941051544 2:160739540-160739562 CCTAAACATTATTAATATTTAGG + Intergenic
941174308 2:162178357-162178379 CTCTGACACTATTGACAGTTTGG + Intronic
941213224 2:162669765-162669787 CCTCAGCACTATTGACATTTGGG - Intronic
941363679 2:164583481-164583503 ACATGACAATATTAACATTAAGG + Intronic
941766472 2:169302589-169302611 CCTTCACACTAATGACATTTGGG - Intronic
941967171 2:171311940-171311962 CCCTGTCACTATCAGCATTTTGG - Intergenic
942260452 2:174156183-174156205 CCTTGGCACTACAAACATTTTGG + Intronic
942419888 2:175796773-175796795 CCATATCACTATTAGCATTTTGG - Intergenic
943174924 2:184459421-184459443 TCTTGCCACTATTGAGATTTTGG - Intergenic
943263930 2:185701167-185701189 CGTTGGCACTATTAAAGTTTTGG - Intergenic
943467966 2:188253939-188253961 CCTTGGCACTATTGACATTTGGG + Intergenic
943473112 2:188319934-188319956 TCTTGGCAATATTGACATTTTGG + Intronic
943644315 2:190392294-190392316 CTTTATCACTATTGACATTTTGG + Intergenic
943760661 2:191605069-191605091 CAGTGGCACTATTGACATTTCGG + Intergenic
943818439 2:192286373-192286395 CCTCAACACTATTAACACTTTGG - Intergenic
943880763 2:193141126-193141148 CCATTACACTATCAACATTTTGG + Intergenic
943889475 2:193268514-193268536 CCATGTCACTATCAGCATTTTGG + Intergenic
943889818 2:193272271-193272293 CCATGTCACTATCAGCATTTTGG + Intergenic
944011560 2:194980204-194980226 CCATAACACTATTAACATTTTGG + Intergenic
944199771 2:197094086-197094108 CCTTCACACGATTAGAATTTGGG + Intronic
944310902 2:198232812-198232834 CCTCAGCACTATTGACATTTTGG - Intronic
944513942 2:200492172-200492194 CCTCGGCACTATTACCATTTTGG + Intronic
944521889 2:200578919-200578941 CCTTGGCACTGTTGACCTTTGGG + Intronic
944572306 2:201056857-201056879 CCTTGGCACTATTGGCATTTTGG + Intronic
944816032 2:203376349-203376371 CAGTGGCACTATTGACATTTTGG - Intronic
944916154 2:204362734-204362756 CCTTGGCACTGCTGACATTTTGG + Intergenic
945067132 2:205956687-205956709 GCTTGGCACCATTAACATTTTGG - Intergenic
945319880 2:208408878-208408900 CCTTGGCATTGTTGACATTTTGG + Intronic
945330836 2:208537298-208537320 CCATGTCACTATCAGCATTTTGG + Intronic
945432479 2:209780520-209780542 CCTTGGCACTGTTGGCATTTGGG + Intronic
945549981 2:211209187-211209209 CCTCTGCACTACTAACATTTTGG - Intergenic
946123983 2:217543540-217543562 CCATGTCACTATCAGCATTTTGG + Intronic
946270036 2:218584236-218584258 CTTTGGCACCATTACCATTTGGG + Intronic
946453459 2:219800837-219800859 CCTTGACATTCATGACATTTGGG - Intergenic
946665106 2:222041355-222041377 CCTCAACACTATTGATATTTTGG + Intergenic
946697148 2:222371419-222371441 CCTTGGCAATATTGACATTTGGG + Intergenic
946995210 2:225383550-225383572 CCATGTCACTATCAGCATTTTGG - Intergenic
947189446 2:227486975-227486997 CTTTGACACTATTGACATTTTGG - Intronic
947239632 2:227979746-227979768 ACTTGGCACTATTGACATTTGGG - Intergenic
947339932 2:229127578-229127600 CCTTGTCACTACCGACATTTTGG + Intronic
947448648 2:230184517-230184539 TCTTGGCATTATTGACATTTTGG - Intronic
947580586 2:231314517-231314539 CCTTGGCACTATTGACATTTTGG + Intronic
947831171 2:233142837-233142859 CCTCGACACTGGTGACATTTGGG + Intronic
948956360 2:241295305-241295327 CTTTGACAATAGTAACATCTTGG - Intronic
1169098139 20:2921921-2921943 CCTTGGCATTGTTGACATTTGGG + Intronic
1169453608 20:5733089-5733111 CCTTGGCACTATTGGCATTTTGG - Intergenic
1169508316 20:6237234-6237256 CCTTGACACTGCTAAAATTTTGG - Intergenic
1169580812 20:7021770-7021792 CCATATCACTATCAACATTTTGG - Intergenic
1169682481 20:8231235-8231257 CCTCAGCACTATTGACATTTGGG + Intronic
1169769810 20:9188467-9188489 CCTCGACACTAGTGACATTCTGG + Intronic
1169807712 20:9576524-9576546 CCTTGACACTATGAACATTTTGG - Intronic
1169859756 20:10138995-10139017 CCTTGAAACTGTAGACATTTGGG + Intergenic
1170116063 20:12861025-12861047 CCTTGGCACTATTAACATTTAGG + Intergenic
1170309261 20:14974979-14975001 CCTTGGCACTATTGACATTGTGG + Intronic
1170371401 20:15652573-15652595 AGTGGACACTATTAACATTTGGG + Intronic
1170531622 20:17298513-17298535 CCTCAACACTATTGGCATTTTGG - Intronic
1170586024 20:17734767-17734789 CCTCGGCACTATTGATATTTTGG - Intronic
1171490579 20:25514131-25514153 CCATATCACTATTAGCATTTTGG - Intronic
1171722623 20:28579454-28579476 CCTTGACACTGTTAGCATTCTGG + Intergenic
1171755460 20:29103992-29104014 CCTTGGCACTGTTAGCATTCTGG - Intergenic
1171786467 20:29470237-29470259 CCTTGACGGTCTTTACATTTTGG + Intergenic
1171787224 20:29478892-29478914 CCTTGGCACTGTTAGCATTCTGG + Intergenic
1171860734 20:30400495-30400517 CCTTGGCACTGTTAGCATTCTGG - Intergenic
1172041657 20:32050950-32050972 ATTTGGCACTATTGACATTTGGG - Intergenic
1172204409 20:33152666-33152688 TGTTGGCACTATTGACATTTTGG - Intergenic
1172288770 20:33759864-33759886 CCTTGCCACTACTGACGTTTTGG + Intronic
1172608899 20:36234768-36234790 CCTTGGCACTATTGACATTTGGG - Intergenic
1173077937 20:39838700-39838722 CCTTGGCACTGTTGACAATTTGG + Intergenic
1173098302 20:40059717-40059739 CCATATCACTATTAGCATTTTGG - Intergenic
1173187670 20:40853535-40853557 CCTCAACACTATTGGCATTTAGG + Intergenic
1173201502 20:40958600-40958622 CCTTGGCACTACTGACATTTTGG + Intergenic
1173359952 20:42334172-42334194 TCTTGGCACTACTGACATTTTGG + Intronic
1173366269 20:42388148-42388170 CCTTAGCACTATTAATGTTTTGG - Intronic
1173549421 20:43922214-43922236 CCTCGGCGCTATTGACATTTTGG + Intronic
1173566918 20:44047171-44047193 CCTCAGCACTATTGACATTTTGG + Intronic
1173708327 20:45131509-45131531 CCTTGGCACTATTGACATTGGGG - Intergenic
1173782263 20:45765866-45765888 CCTTGGTCCTATTAATATTTTGG - Intronic
1173820795 20:46019092-46019114 CCTCTACACTATTGACATTTTGG + Intergenic
1173865719 20:46311530-46311552 CTTTGGCCCTATTGACATTTGGG + Intergenic
1173914899 20:46700029-46700051 CCTCAGCACTATTGACATTTTGG - Intergenic
1173928136 20:46796211-46796233 CCTCAGCACTATTGACATTTTGG - Intergenic
1174176462 20:48648482-48648504 CCTTGACACTGGTGACATTTGGG - Intronic
1174213814 20:48900686-48900708 TCTTGGCACTACTGACATTTTGG + Intergenic
1174219379 20:48940883-48940905 CCTTGGCACCACTGACATTTGGG - Intronic
1174288646 20:49490720-49490742 TCTTGCCACTATTGACATTTGGG - Intergenic
1174325103 20:49772630-49772652 CCTTGGCGCTACTGACATTTTGG + Intergenic
1174403403 20:50288517-50288539 CTTCGGCACCATTAACATTTGGG + Intergenic
1174415699 20:50365117-50365139 CCTTGACACTATTGACATTTTGG - Intergenic
1174544283 20:51313873-51313895 CCTTGGCGCTATTGACATTTTGG - Intergenic
1174588868 20:51629461-51629483 CCTCGTCACTGTGAACATTTGGG + Intronic
1174590406 20:51640444-51640466 CCTCAGCACTATTGACATTTGGG - Intronic
1174607791 20:51773492-51773514 CCTTGGCACTATTGACATTTGGG + Intergenic
1174672145 20:52318367-52318389 CCTTGACACTGTTGACTTTTGGG + Intergenic
1174695299 20:52551049-52551071 TTTGGGCACTATTAACATTTAGG + Intergenic
1174712211 20:52718958-52718980 CCTTGGAACCATTGACATTTTGG - Intergenic
1174735289 20:52960280-52960302 CCTTGACACTGTTGGCATTTAGG + Intergenic
1174753383 20:53134636-53134658 CATGGACACTCTTAACAATTCGG + Intronic
1174784995 20:53424005-53424027 CTTTGGCACTATTGACATTTGGG - Intronic
1174797157 20:53531733-53531755 TCTTGACACTATTGATGTTTTGG - Intergenic
1174840504 20:53896985-53897007 TCATGGCACTATTGACATTTGGG - Intergenic
1174912633 20:54623288-54623310 CCTTGGCCCTATTGACATTTGGG - Intronic
1175052448 20:56167797-56167819 CCTTGGCATTATTGCCATTTTGG - Intergenic
1175069635 20:56322367-56322389 CCTGGGCACTATTGACATCTGGG + Intergenic
1175159603 20:56998205-56998227 CCTTGGCACTATTGCCATCTGGG - Intergenic
1176725620 21:10430105-10430127 CTTTGGCACTATTGACATCTTGG + Intergenic
1177082036 21:16651558-16651580 CCTCAACACTATTGACATTTTGG - Intergenic
1177085341 21:16695795-16695817 CCATGTCACTATCAGCATTTTGG + Intergenic
1177517591 21:22175778-22175800 CCATAGCACTATCAACATTTTGG - Intergenic
1177793979 21:25753436-25753458 ACTTGACCCTGTAAACATTTAGG + Intronic
1177860568 21:26448551-26448573 GCTTGACCCTATTGACATTTTGG + Intergenic
1178029674 21:28510067-28510089 CATTGGCAGTATTGACATTTTGG + Intergenic
1178072504 21:28984501-28984523 CTTTAACAAGATTAACATTTTGG - Intronic
1178076909 21:29020718-29020740 CCTCAACACTATCAACATTTTGG - Intergenic
1178132152 21:29585883-29585905 CCTTGGTGCTATTGACATTTTGG + Intronic
1178155840 21:29853277-29853299 CCTCAGCACTATTGACATTTTGG + Intronic
1178476303 21:32940222-32940244 CCTTGGCACCACTGACATTTGGG - Intergenic
1178696199 21:34794748-34794770 TGTTGACACTGTTGACATTTTGG + Intronic
1178737032 21:35161704-35161726 CCTTGGCACCATTGGCATTTGGG - Intronic
1178761595 21:35408133-35408155 CGCTGGCACTATTGACATTTGGG + Intronic
1178902402 21:36607745-36607767 CCTTGGCATTATTGACATTTGGG - Intergenic
1178905880 21:36635614-36635636 CCTTGGCACTATTGAGATTTGGG - Intergenic
1178944417 21:36934369-36934391 CCATGGCACTATTGACATTTTGG - Intronic
1179117953 21:38511753-38511775 CCTTGGCAGCATCAACATTTTGG + Intronic
1179284311 21:39963565-39963587 CCTTGGCACTGCTGACATTTGGG - Intergenic
1179597450 21:42452333-42452355 CCTTGGCACTATTGACATTTGGG + Intergenic
1179964095 21:44790954-44790976 CCATGTCACTATCAGCATTTTGG - Intronic
1180296178 22:10938132-10938154 CCTTGACACTGTTAACATTCTGG + Intergenic
1180412494 22:12627872-12627894 CCTTGGCACTGTTAGCATTCTGG - Intergenic
1180893158 22:19306288-19306310 CCTGGCCATTATTAAAATTTTGG + Intergenic
1180907765 22:19427097-19427119 CCTTAGCACTATTGATATTTGGG + Intronic
1181114639 22:20623712-20623734 CGTTGATGCTATTGACATTTTGG + Intergenic
1181741452 22:24924765-24924787 CCTCGACATTACTGACATTTGGG + Exonic
1181763595 22:25075318-25075340 CCTTGTCACAATTGACACTTTGG - Intronic
1181781628 22:25197946-25197968 CCTTGACACTACTGCCATTTGGG - Intergenic
1181844964 22:25699559-25699581 CCTCGGCACTGTTGACATTTAGG - Intronic
1181850483 22:25746422-25746444 CGTAGACACTATTGACATTTGGG + Intronic
1181879229 22:25964527-25964549 CCTTGGCATTATTGACATCTAGG + Intronic
1181909008 22:26223010-26223032 CCTAGGCGCTATTGACATTTGGG - Intronic
1181952252 22:26563047-26563069 CCTTGGCACTAGTGACATTTGGG - Intronic
1182000611 22:26916668-26916690 CCTTGACACTATTGACGTATCGG + Intergenic
1182012348 22:27011419-27011441 CCTTGGCACTATTGACATTTGGG + Intergenic
1182114543 22:27748066-27748088 CCTTGGCACTATTGACATTTTGG - Intergenic
1182168306 22:28199656-28199678 CAGTGACACTATTAACATTTTGG + Intronic
1182340587 22:29617356-29617378 CCCTGGCACTATTGACATTTTGG + Intronic
1182346812 22:29672189-29672211 CCTGGGCACTACTGACATTTGGG + Intronic
1182728874 22:32471544-32471566 CCTCAGCACTATTGACATTTTGG - Intergenic
1182752376 22:32651994-32652016 CTCTGGCACTATTAACGTTTTGG - Intronic
1182958173 22:34446855-34446877 CCTTGGCACTATTGGAATTTGGG + Intergenic
1182966982 22:34531495-34531517 CCTTGGCACTATTGACATTTGGG + Intergenic
1183020489 22:35022541-35022563 CTTTGGCACTATTGACCTTTGGG + Intergenic
1183150152 22:36030471-36030493 CCTCCGCACTATTGACATTTGGG - Intergenic
1183258889 22:36781458-36781480 CCTCGGCACTATTGACATTTGGG + Intergenic
1183769597 22:39912624-39912646 CCTTGTCACTATTGACATTTGGG - Intronic
1184138588 22:42564146-42564168 GCTTGACACTAATATTATTTTGG + Intronic
1184217222 22:43075868-43075890 CCTTGGCACAGTTGACATTTGGG - Intronic
949162623 3:898987-899009 CCTTTGCACTATTGATATTTTGG - Intergenic
949176535 3:1069700-1069722 CTTTGGCACCATTGACATTTGGG - Intergenic
949235041 3:1798709-1798731 TCTTGGCACTATTGACACTTTGG + Intergenic
949263910 3:2135047-2135069 CCTTGATACTACTGACATTTTGG - Intronic
949269720 3:2200568-2200590 CCTTGGCACTATTGACCTTTGGG - Intronic
949390522 3:3557335-3557357 CCTTTTCACTATTGACATTTGGG + Intergenic
949402965 3:3684538-3684560 CCTTGGCATTATTGAGATTTGGG - Intergenic
949539149 3:5018713-5018735 CCTTGGCACTACTGACATTTGGG + Intergenic
949596438 3:5552862-5552884 CCTTAGCACTATTGAAATTTTGG + Intergenic
949830861 3:8212668-8212690 CCTTGACACGATCAACATTTTGG - Intergenic
949844292 3:8354231-8354253 CCTTAACACTATTGATATTTAGG + Intergenic
949854710 3:8450960-8450982 CTTTGACACTACTGACATTTGGG - Intergenic
949974113 3:9438729-9438751 TCTTGACACTGTTGACAGTTTGG + Intronic
950274663 3:11649376-11649398 GATGGGCACTATTAACATTTTGG - Intronic
950447022 3:13044363-13044385 CCTTGGCACTACTGACATTTTGG - Intronic
950589229 3:13924147-13924169 CTATGTCACTATCAACATTTTGG - Intergenic
950697667 3:14716037-14716059 CATTGACACTACTGACATTTTGG + Intronic
950699688 3:14732734-14732756 TCTTGGCACTATTGACATTTTGG - Intronic
950893202 3:16423386-16423408 CCTTGGTACTATTGACATTTTGG - Intronic
950893627 3:16427829-16427851 CCTTCCCACTATTGACATTGTGG - Intronic
950987812 3:17394120-17394142 CCTTGGGAGTATTAACATTTTGG - Intronic
951110062 3:18792675-18792697 TGTTGGTACTATTAACATTTTGG - Intergenic
951148304 3:19256052-19256074 CCTTGCCACTGTTGACATTTTGG + Intronic
951276291 3:20690234-20690256 CCTTGGAACTATTGACGTTTTGG + Intergenic
951466577 3:23006468-23006490 CGTTGACACTATTGATACTTGGG - Intergenic
951580703 3:24159863-24159885 CCTTGGCACTATTGACATTGGGG - Intronic
951729423 3:25794599-25794621 CCTTGGCACTATTAATATTTGGG + Intergenic
951936595 3:28029417-28029439 CCTTGGCACTATTAACATCTGGG - Intergenic
952000804 3:28783936-28783958 CCTTAGCACTATTGACATTTTGG + Intergenic
952143516 3:30505483-30505505 ACTTGGCACTCTAAACATTTTGG + Intergenic
952237172 3:31492271-31492293 CCTGGGCACTATTGGCATTTTGG + Intergenic
952322648 3:32292651-32292673 CCTGGGCACTGTTGACATTTTGG + Intronic
952359472 3:32615372-32615394 CCTCAACACTATTGACATTTTGG + Intergenic
952624964 3:35392819-35392841 CCATAACACTATCAGCATTTTGG + Intergenic
952674813 3:36015268-36015290 CCTTAACACTGTTGACATTTGGG + Intergenic
952699638 3:36312438-36312460 CCTTGACACTCCTAACATTTTGG + Intergenic
952766038 3:36955266-36955288 CCTTGGCATTACTGACATTTTGG - Intergenic
952943214 3:38458852-38458874 CCTTGACACTATTACATTTTGGG + Intronic
953167655 3:40479690-40479712 CCTTGGCATCATTTACATTTGGG + Intronic
953243932 3:41174004-41174026 CCTTGGCACTACTGGCATTTGGG - Intergenic
953608846 3:44430578-44430600 TCTTGGCACTCTTGACATTTGGG + Intergenic
953629733 3:44603368-44603390 CCTTGGCCTTATTGACATTTTGG + Intronic
953682153 3:45047674-45047696 CCTCGCCACTATTGGCATTTGGG + Intergenic
953847160 3:46436820-46436842 CCTTGGCACTATTGACATTTGGG + Intronic
953898596 3:46824037-46824059 CCATATCACTATCAACATTTTGG + Intergenic
954567859 3:51614027-51614049 CCTTAGCACTACTAACATTTGGG - Intronic
954911729 3:54116452-54116474 CCATAACACTATCAACATTTTGG - Intergenic
955096803 3:55806706-55806728 CCTTGCCACTATTGGCATTTTGG - Intronic
955154449 3:56402873-56402895 CCTCAGCACTATTGACATTTTGG + Intronic
955354084 3:58216078-58216100 CCTTGGCACGATTGACATTTGGG + Intergenic
955558532 3:60163670-60163692 CCTCAACACTGTTCACATTTGGG + Intronic
955641785 3:61093482-61093504 CCTTGGCATTATTGGCATTTTGG - Intronic
955671737 3:61409683-61409705 CCTTGGCACTACTGCCATTTGGG + Intergenic
955685567 3:61545275-61545297 CCTTGGCACTATTGACATTTGGG - Intergenic
955709660 3:61764988-61765010 TCTTGGCACTATTGGCATTTGGG - Intronic
955721065 3:61881882-61881904 CCTCAACACTATTGACATTTTGG + Intronic
955732974 3:62006848-62006870 CAGTGACACTAGTGACATTTTGG - Intronic
955833331 3:63027387-63027409 CCATATCACTATTAGCATTTTGG + Intergenic
955872018 3:63449392-63449414 ACTTGGTACTATTAACATTCTGG + Intronic
955883647 3:63574578-63574600 CCTCGGCACTATTGACATTTTGG - Intronic
955932064 3:64067164-64067186 CCTTGGCACCATGGACATTTTGG + Intergenic
955977680 3:64493701-64493723 CCTGGGCACTACTGACATTTTGG + Intergenic
955986873 3:64582739-64582761 CCTTGGCACTATTCATATTTGGG - Intronic
956090713 3:65663703-65663725 CCTTGACACTACCGACATTTGGG + Intronic
956142951 3:66164021-66164043 CCCCAACACTATTGACATTTTGG - Intronic
956202325 3:66719314-66719336 CCTTGGCACTCTTGATATTTTGG - Intergenic
956204623 3:66742380-66742402 CCTTGCTACTAGTGACATTTTGG + Intergenic
956205785 3:66753390-66753412 CATTGGCACTGTTGACATTTTGG + Intergenic
956263149 3:67367563-67367585 CCTTGGCACTATTGACACTTTGG + Intronic
956263276 3:67368985-67369007 CCTTGACACTATTGACATTTTGG + Intronic
956380686 3:68661592-68661614 CCTCAGCACTATTAACATTTTGG + Intergenic
956383956 3:68697065-68697087 TCTTGGCAATATTGACATTTTGG - Intergenic
956387508 3:68735831-68735853 CCTTCATACTATTGACATTTGGG + Intronic
956493752 3:69802292-69802314 CCTTGGCACGATTGACATTTGGG - Intronic
956517532 3:70065785-70065807 CCTTGGCGCTATTAACATTTGGG - Intergenic
956707904 3:72015182-72015204 CCTCGGCACTATTGACATTTGGG + Intergenic
956726592 3:72161712-72161734 CCTTGGCACTATTGACATTTTGG + Intergenic
956786948 3:72650710-72650732 CCTTGGCACTATTGACATTTGGG - Intergenic
956827964 3:73016452-73016474 CCTTGACACTACTGACATTTGGG - Intronic
956901920 3:73725842-73725864 CCTCAGCACTATTGACATTTTGG - Intergenic
956971736 3:74533981-74534003 CCTTGACATGATTGTCATTTGGG - Intergenic
956992150 3:74779428-74779450 CCTTGGTACTATTGACATTACGG + Intergenic
957347929 3:78985562-78985584 ACTTGGCACTACTGACATTTCGG + Intronic
957351623 3:79030392-79030414 TCTAGATACTATTGACATTTTGG - Intronic
957603323 3:82366913-82366935 CATTGGTACTATTGACATTTTGG - Intergenic
957775182 3:84749857-84749879 CCTAGGCACTATTGACATATTGG + Intergenic
957956497 3:87195421-87195443 ACATGTCACTATTAGCATTTTGG - Intergenic
957957316 3:87204877-87204899 CCTTTACTCTACTGACATTTAGG + Intergenic
958711797 3:97725644-97725666 CCTTAGCACTATTGACATTTGGG + Intronic
958715141 3:97771806-97771828 CCTTGATACTATTAATCTTATGG + Intronic
958795906 3:98705979-98706001 CCTTGGCACTATTGACACTTTGG - Intergenic
958819861 3:98960923-98960945 CCTAAGCACTATTGACATTTGGG - Intergenic
958910317 3:99986859-99986881 CCTTGGCACTATAGACATTTTGG - Intronic
958956554 3:100470670-100470692 CCATATCACTATTAGCATTTTGG + Intergenic
959483995 3:106907349-106907371 CCTTGGCACTATAGACATTTTGG + Intergenic
959500156 3:107097814-107097836 CCTTGGCACGACTGACATTTGGG - Intergenic
959507304 3:107170629-107170651 CCATGTCACTATCAGCATTTTGG - Intergenic
959647530 3:108720641-108720663 CCATGACCCTACTAACATTTGGG - Intergenic
960176068 3:114518946-114518968 CTTTGGCCCTATTAACCTTTGGG - Intronic
960321121 3:116237912-116237934 CCTTGGCACTATTGACATTTTGG + Intronic
960563953 3:119114599-119114621 CCTTTTCACTATCAGCATTTTGG + Intronic
960680889 3:120246519-120246541 CCTTAGCACTGTTGACATTTGGG - Intronic
960704820 3:120471921-120471943 CCTTGACACTATTGACATTTGGG + Intergenic
960708080 3:120500609-120500631 CCTTGAAACTTTAAATATTTAGG - Intergenic
961238878 3:125392626-125392648 CCTTGGCACTGTTGACATTTTGG - Intergenic
961321846 3:126082428-126082450 CCTCCACACTACTGACATTTGGG - Intronic
961733606 3:128986006-128986028 TCTTGGCACTATTGACATTTTGG - Intronic
961919450 3:130410647-130410669 TCTTGACACTACTGAAATTTGGG + Intronic
961973301 3:130993485-130993507 CCTTGGCACCATTGACATTTTGG + Intronic
962024930 3:131537903-131537925 TCTTGACACTATTGACATTTGGG + Intronic
962034119 3:131632787-131632809 TCTTGGTACTGTTAACATTTCGG + Intronic
962399703 3:135047924-135047946 CCTTGACACTATTGACATTTGGG - Intronic
962556366 3:136556466-136556488 TCTTGACACTATTGAGTTTTTGG - Intronic
962572601 3:136726141-136726163 CCTTGCCACTAGTGACATTTTGG + Intronic
962634905 3:137320616-137320638 CCTTGTCTCTATTGATATTTTGG + Intergenic
962952051 3:140228403-140228425 CCATATCACTATTAACATTTTGG + Intronic
963151586 3:142051102-142051124 CCTTGGCACTACTGACATTTTGG + Intronic
963328122 3:143884558-143884580 CCCTGATACTATCAATATTTTGG + Intergenic
963720127 3:148852448-148852470 CCTTGGCACTCTTGACGTTTTGG - Intronic
963929737 3:150991418-150991440 CATAGCCACTATTAATATTTTGG - Intergenic
964019431 3:151990659-151990681 CCTTAACACTATTGACATTTAGG + Intergenic
964054094 3:152431132-152431154 CATTGACAGTATTGACTTTTGGG + Intronic
964211158 3:154229559-154229581 CCTTGGCACGATTGACATTTTGG + Intronic
964271005 3:154956827-154956849 CCTTGGTAATATTGACATTTTGG - Intergenic
964342071 3:155718237-155718259 CCATATCACTATTACCATTTTGG + Intronic
964472284 3:157068272-157068294 CGTTGGCACCATTGACATTTGGG - Intergenic
964504728 3:157386671-157386693 CCTTGGCAATATTGACATTTTGG - Intronic
964800525 3:160552051-160552073 CCTTGGCACTATTGACGTTTTGG - Intronic
964840194 3:160985012-160985034 CCTTGGCACTACTTACATTTTGG - Intronic
964880106 3:161413718-161413740 CCCTGACACAACTGACATTTTGG - Intergenic
964880693 3:161419522-161419544 TCTTGAAACTGTGAACATTTGGG + Intergenic
964989210 3:162785621-162785643 CCATATCACTATCAACATTTTGG + Intergenic
965090081 3:164150455-164150477 TCATGTCACTATCAACATTTTGG + Intergenic
965092919 3:164184401-164184423 CCATATCACTATTATCATTTTGG + Intergenic
965146909 3:164916566-164916588 CCTTGGTACTACTTACATTTTGG + Intergenic
965213411 3:165826822-165826844 CCTTGGCATTATTTACATTTTGG + Intronic
965249028 3:166318034-166318056 CGTTGAGACTATTGACACTTGGG - Intergenic
965268734 3:166584686-166584708 CCTTTACAGTAATAATATTTTGG + Intergenic
965305633 3:167059957-167059979 CCTTATCACTATCAGCATTTTGG + Intergenic
965349303 3:167594279-167594301 CCATATCACTATGAACATTTTGG - Intronic
965455700 3:168897143-168897165 CCATAACACTATCAGCATTTTGG + Intergenic
965831926 3:172800386-172800408 CATTGACACTAGTAAAGTTTTGG - Intronic
965857324 3:173104163-173104185 CCATATCACTATTAACATTTTGG + Intronic
966490727 3:180525692-180525714 CCTTGATACTGCTAACATTTTGG - Intergenic
966707590 3:182933585-182933607 CCTTGGCATTATTGACACTTAGG + Intergenic
967004061 3:185366676-185366698 CCTTGACATCATTCACTTTTAGG - Intronic
967278587 3:187800793-187800815 CCTTGGCACTCTAGACATTTTGG + Intergenic
967385030 3:188902859-188902881 CCTTGACACTAGGGATATTTTGG + Intergenic
967396485 3:189015075-189015097 CCATATCACTATTACCATTTTGG - Intronic
967464177 3:189783372-189783394 CGTAGACACCATTAGCATTTTGG - Intronic
967805869 3:193714194-193714216 CCATGTCACTATCAACATTTTGG - Intergenic
968204090 3:196783344-196783366 CCTCAACACTATTGACATCTTGG + Intronic
969103534 4:4788001-4788023 CCCTATCACTATCAACATTTTGG - Intergenic
969170112 4:5355553-5355575 CCTTGACATTATTGATATTTTGG + Intronic
969501831 4:7558241-7558263 CTTTGGCACTGTTAATATTTGGG + Intronic
969808129 4:9626773-9626795 CCTCAGCACTATTGACATTTGGG + Intergenic
969960415 4:10939599-10939621 CCTTAACACTAACAGCATTTTGG - Intergenic
969986885 4:11221615-11221637 CCTTGTCAATGTTCACATTTTGG + Intergenic
970022116 4:11581471-11581493 CCTTGACGGTCTTTACATTTTGG + Intergenic
970036087 4:11737641-11737663 CCATATCACTATTAACAGTTTGG - Intergenic
970228240 4:13881912-13881934 CCTTGGCACTGTTGACATTTTGG + Intergenic
970308038 4:14753229-14753251 CCATATCACTATTAGCATTTTGG + Intergenic
970392908 4:15633947-15633969 CCTTGACAATACTGACATTTTGG + Intronic
970468049 4:16347698-16347720 CTTTGCCACTATTAACATGTTGG + Intergenic
970538885 4:17057704-17057726 CCGTGGCACTATTGACATTGGGG - Intergenic
970550144 4:17171954-17171976 CCTCGGCACTATTGACATTTTGG - Intergenic
970615049 4:17761103-17761125 CCTGGACACTACTGACGTTTTGG - Intronic
970634721 4:17995446-17995468 CCTTGGTGCTATTGACATTTTGG - Intronic
970682481 4:18526773-18526795 ACCTGACACTATTAACATTTTGG + Intergenic
970684993 4:18556990-18557012 ACATGACACTATTACCAGTTGGG - Intergenic
970772155 4:19626785-19626807 CCATGGCACTATACACATTTTGG + Intergenic
970868247 4:20783148-20783170 CCATATCACTATTAGCATTTTGG + Intronic
970884419 4:20970683-20970705 CCTTGGCACTATGAACACTTGGG - Intronic
970997349 4:22282596-22282618 CCTTATCACTATCAGCATTTTGG - Intergenic
971354097 4:25878912-25878934 CCTTGGCACTCGTGACATTTTGG - Intronic
971440290 4:26678140-26678162 CCATATCACTATCAACATTTTGG - Intronic
971649624 4:29256032-29256054 CCATATCACTATTAGCATTTTGG - Intergenic
971684618 4:29747985-29748007 CCATATCACTATCAACATTTTGG + Intergenic
971767673 4:30854208-30854230 CCTTGGCACTCTGGACATTTTGG + Intronic
971823609 4:31592090-31592112 TCTTGGCACCATTGACATTTTGG - Intergenic
971900394 4:32650738-32650760 CCATGTCACTATCAGCATTTTGG + Intergenic
971973269 4:33649126-33649148 TTGTGACACTATTGACATTTTGG + Intergenic
972087713 4:35241055-35241077 CCATAACACTATCAACATTTTGG - Intergenic
972413503 4:38816136-38816158 CCCTGTCACTATCAGCATTTTGG + Intronic
972471922 4:39413907-39413929 CCTGGTCACTATTGACATTTGGG + Intronic
972503843 4:39702791-39702813 CCTTGGCACTACTGACATTTTGG + Intronic
972524301 4:39893121-39893143 CCTGGAAAATATTAAAATTTGGG + Intronic
972844497 4:42971175-42971197 CCATATCACTATCAACATTTTGG + Intronic
972849673 4:43033723-43033745 TCTTGGCACTACTGACATTTTGG - Intergenic
972897876 4:43645347-43645369 CCATGTCACTATTTGCATTTAGG + Intergenic
972999848 4:44933011-44933033 CATTGGCACTACTGACATTTGGG - Intergenic
973185073 4:47317082-47317104 CCTTGGCACCATTGACATTTTGG + Intronic
973553952 4:52063346-52063368 TCTTGTCCCCATTAACATTTTGG + Intronic
973588125 4:52412696-52412718 CCTTAGCACAATTGACATTTGGG - Intergenic
973954110 4:56046579-56046601 CCTTAGCACTATTGTCATTTGGG + Intergenic
974036987 4:56826074-56826096 CCTTATCACTATCAGCATTTTGG - Intergenic
974061437 4:57039565-57039587 CCTCAGCACTATTGACATTTGGG - Intronic
974248804 4:59359132-59359154 CCATATCACTATCAACATTTTGG - Intergenic
974252398 4:59403762-59403784 CTTTTATACTATTAACGTTTTGG + Intergenic
974311119 4:60210696-60210718 CCATGTCACTATCAGCATTTTGG + Intergenic
974380060 4:61127833-61127855 CCATATCACTATCAACATTTTGG - Intergenic
974490783 4:62561106-62561128 CTTTGATATTATCAACATTTTGG - Intergenic
974556804 4:63461283-63461305 CCATATCACTATCAACATTTTGG + Intergenic
974882379 4:67775457-67775479 CTTTAACACTATTGACATGTGGG - Intergenic
974923548 4:68270953-68270975 CCATATCACTATCAACATTTTGG + Intergenic
975095899 4:70456022-70456044 CCATATCACTATCAACATTTTGG + Intronic
975361390 4:73475748-73475770 CCATGTCACTATCAGCATTTTGG + Intergenic
975435403 4:74345330-74345352 CCATTTCACTATTAGCATTTTGG + Intergenic
975814328 4:78202143-78202165 CCATGACACTATTGACATTTGGG - Intronic
976223071 4:82773623-82773645 CCATGGCACTATTAACATTTTGG + Intronic
976328109 4:83795811-83795833 CCTCGGCACTATTGACACTTGGG - Intergenic
976337375 4:83906033-83906055 TCTTGGCACTATTGGCATTTTGG + Intergenic
976657617 4:87505950-87505972 TCTTGGCACTGTTAACATTTTGG + Intronic
976759649 4:88534387-88534409 CCTGGTCACTGTTGACATTTTGG - Intronic
976772303 4:88666068-88666090 CCTTGGTACTATTGACTTTTGGG - Intronic
977252035 4:94700212-94700234 CCCTGACAGTATTATCATTCAGG - Intergenic
977396475 4:96477996-96478018 CCATGTCACTATTAGAATTTTGG - Intergenic
977415743 4:96730639-96730661 CCTTAGCACTATTGACATTTGGG - Intergenic
977911368 4:102541044-102541066 ACTTGGCATTATTGACATTTGGG + Intronic
978043512 4:104098752-104098774 CCATATCACTATTAGCATTTTGG - Intergenic
978145325 4:105365553-105365575 CCATATCACTATTAGCATTTTGG - Intergenic
978309007 4:107364868-107364890 CCATATCACTATTAGCATTTTGG - Intergenic
978954941 4:114600648-114600670 TCTTAACACTATTAAAATATTGG - Intronic
978996076 4:115154927-115154949 CCTTAGCACTACTGACATTTGGG + Intergenic
979137417 4:117127388-117127410 CCATGTCACTATCAGCATTTTGG - Intergenic
979721366 4:123904496-123904518 CCTTATCACTATCAGCATTTTGG - Intergenic
979741516 4:124156833-124156855 CAGTGGCACTATTGACATTTTGG - Intergenic
979741636 4:124158607-124158629 CAGTGGCACTATTGACATTTTGG - Intergenic
979775303 4:124582503-124582525 CCATATCACTATTAGCATTTTGG + Intergenic
979797289 4:124862062-124862084 CCAAGGCATTATTAACATTTTGG - Intergenic
979918517 4:126470156-126470178 CCTTGGCAATATTGACATTTTGG - Intergenic
980027948 4:127788814-127788836 CCTTGGCACTACTGACATCTTGG - Intronic
980085662 4:128387540-128387562 CCTTGGCACTGTTGACATTTTGG + Intergenic
980229030 4:130024193-130024215 CCTTCACACTATTGACATTGTGG - Intergenic
980250306 4:130306650-130306672 CCCTGGCATTATTGACATTTGGG + Intergenic
980797039 4:137698434-137698456 CTTTGCCACTACTAACATTTTGG + Intergenic
980948446 4:139347137-139347159 CCTTGGCGCTGTTGACATTTTGG + Intronic
981084730 4:140671345-140671367 CCTTGGAGCTATTGACATTTTGG - Intronic
981350404 4:143722841-143722863 CCTTGGCACTATTGACATTTTGG + Intergenic
981362945 4:143868276-143868298 CCTTGGCACTATTGATATTTTGG + Intergenic
981373673 4:143989083-143989105 CCTTGGCACTATTGATATTTTGG + Intergenic
981382773 4:144092338-144092360 CCTTGGCACTATTGATATTGTGG + Intergenic
981503195 4:145474190-145474212 CCATATCACTATTAGCATTTTGG + Intergenic
981784333 4:148460992-148461014 TCTTGGCTCTATTGACATTTTGG + Intergenic
981914242 4:150016199-150016221 CCATATCACTATCAACATTTTGG + Intergenic
981915281 4:150026491-150026513 CCATATCACTATCAACATTTTGG - Intergenic
982028038 4:151271613-151271635 CCTTGGCACTATTGACATTTTGG - Intronic
982115220 4:152093414-152093436 CCTTGGCTCTGTTAACATTTTGG + Intergenic
982208054 4:153012006-153012028 CCATATCACTATCAACATTTTGG + Intergenic
982215055 4:153075396-153075418 CCTTGGCACTATTGATATTTTGG - Intergenic
982347796 4:154380093-154380115 TCTAGGCACTACTAACATTTCGG - Intronic
982518948 4:156389061-156389083 CTTTGGCACTCTTGACATTTTGG - Intergenic
982566963 4:156997657-156997679 CCTTATCACTATCAGCATTTTGG + Intergenic
982904375 4:161049257-161049279 TCATAACACTATTAGCATTTTGG + Intergenic
983112557 4:163771301-163771323 CCTCAGCACTATTGACATTTTGG - Intronic
983266362 4:165512304-165512326 CCTTGACCCAACTGACATTTTGG + Intergenic
983454983 4:167952553-167952575 CCATGTCACTATCACCATTTTGG - Intergenic
983573442 4:169234804-169234826 TCTTGGCACTACTGACATTTGGG + Intronic
983863201 4:172734007-172734029 CCATATCACTATCAACATTTTGG - Intronic
983900338 4:173126920-173126942 CCTGGGCACTATTTACATTGTGG - Intergenic
983952694 4:173661338-173661360 CCATATCACTATCAACATTTTGG - Intergenic
984604441 4:181768364-181768386 CCTTGGCACTACTGACGTTTTGG - Intergenic
985151908 4:186955721-186955743 CTATGACACTATTGACATTGTGG - Intergenic
985223575 4:187734081-187734103 TCTTGATGCTATTAACATTTTGG - Intergenic
985439546 4:189970550-189970572 CGTTGGCACTATTAGCATTCGGG - Intergenic
986070056 5:4273904-4273926 CCTTGAGAGTTTTATCATTTAGG - Intergenic
986294668 5:6427807-6427829 CTTTGGCACTACCAACATTTTGG - Intergenic
986440092 5:7773383-7773405 CCTCAGCACTATTGACATTTTGG + Intronic
986567441 5:9128814-9128836 CATCGGCACTATTGACATTTGGG + Intronic
986600035 5:9464001-9464023 CCTCGACACTGTTGACATCTGGG + Intronic
986617251 5:9630959-9630981 TCTTTACATTATTGACATTTTGG + Intronic
986637374 5:9836370-9836392 CCTTGGCACTACTGACATTTGGG + Intergenic
986648160 5:9938751-9938773 CCTTAACACTATTGACATTTGGG - Intergenic
986864670 5:11972380-11972402 CCTCAACACTATTGACATTTAGG - Intergenic
986869320 5:12028677-12028699 CCATATCACTATTAGCATTTTGG + Intergenic
986924688 5:12732198-12732220 CCATATCACTATTAACATTTTGG + Intergenic
986949239 5:13061420-13061442 CCATATCACTATCAACATTTTGG + Intergenic
987006528 5:13715953-13715975 CCTTGGCACTATTGACATTCAGG - Intronic
987196834 5:15535410-15535432 CTATGTCACTATTAGCATTTTGG - Intronic
987204940 5:15615257-15615279 CCTTGGTACCATTGACATTTGGG + Intronic
987285645 5:16453885-16453907 CCTTGGCACTATTGACATTTTGG - Intronic
987373413 5:17213651-17213673 CCTTGCCATTATTGACATTTTGG + Intronic
987488521 5:18549420-18549442 TCATGTCACTATCAACATTTTGG + Intergenic
987533211 5:19148798-19148820 CCTCGTCACTATCAGCATTTTGG + Intergenic
987576959 5:19741942-19741964 TCTTTCCACTATTAACACTTTGG - Intronic
987674966 5:21062882-21062904 CCATGTCACTATCAGCATTTTGG - Intergenic
987709125 5:21486672-21486694 CCATATCACTATTAACATTTTGG + Intergenic
987829593 5:23077970-23077992 CCTTGGCACTATTGACATTTGGG - Intergenic
988041033 5:25888976-25888998 CCATATCACTATTAGCATTTTGG + Intergenic
988159153 5:27496680-27496702 ACTTGACACTGTCGACATTTGGG - Intergenic
988162787 5:27543330-27543352 CCATGTCACTATCAGCATTTTGG - Intergenic
988222068 5:28360405-28360427 CCTTGGCACCATTAATATCTTGG + Intergenic
988408678 5:30857546-30857568 CCTTGACACTATTGACTGTTTGG - Intergenic
988456309 5:31390008-31390030 CCATATCACTATTAGCATTTTGG + Intergenic
988603197 5:32658004-32658026 CCATAGCACTATTAGCATTTTGG + Intergenic
988699564 5:33660079-33660101 CCTCAGCACTATTAACATTTGGG - Intronic
988750487 5:34187481-34187503 CCATATCACTATTAACATTTTGG - Intergenic
988950390 5:36252634-36252656 GATGGTCACTATTAACATTTTGG - Intronic
989067889 5:37482079-37482101 CCATATCACTATTAACATTTTGG + Intronic
989106590 5:37868720-37868742 CCTCAGCACTATTGACATTTTGG + Intergenic
989154891 5:38335055-38335077 CCTTGACACTATTGACATTTGGG - Intronic
989203170 5:38786065-38786087 CCATATCACTATTAGCATTTTGG - Intergenic
989241511 5:39207931-39207953 TCTTGGCACTATCCACATTTTGG - Intronic
989507812 5:42247612-42247634 CCATATCACTATCAACATTTTGG + Intergenic
989621785 5:43391590-43391612 ACTTAACATTAATAACATTTGGG - Intronic
989642966 5:43601690-43601712 CCTCAGCACTATTGACATTTGGG + Intergenic
989666194 5:43857193-43857215 CCTTGGCACTATAGACATTTAGG - Intergenic
990078250 5:51878645-51878667 CCTTGGCACTATTATTAATTTGG - Intergenic
990153355 5:52845764-52845786 CTTTGGAACTATTCACATTTGGG - Intronic
990273474 5:54171101-54171123 ACTTGACACTGAAAACATTTTGG + Intronic
990320626 5:54626759-54626781 CCTTAGCACTACTGACATTTTGG - Intergenic
990558999 5:56965213-56965235 CCTCGGCACTATTGACCTTTTGG - Intronic
990905289 5:60796368-60796390 CCTCGACAGTATTGATATTTGGG + Intronic
990926354 5:61029437-61029459 TTTTGACACTATTTCCATTTGGG + Intronic
991061846 5:62384416-62384438 CCTTGACACTGTTAACATTTGGG + Intronic
991124427 5:63053385-63053407 CCTTGGCAGTGTTGACATTTTGG + Intergenic
991186485 5:63814841-63814863 CCATGTCACTATCAGCATTTTGG - Intergenic
991197120 5:63948204-63948226 CCTCAACACTATTGATATTTTGG + Intergenic
991206798 5:64059171-64059193 CCATATCACTATTAGCATTTTGG - Intergenic
991605123 5:68393523-68393545 CCTTGGCATTATTAACATTTTGG - Intergenic
991738748 5:69650679-69650701 CCATATCACTATTAACATTTTGG - Intergenic
991759449 5:69905748-69905770 CCATATCACTATTAACATTTTGG + Intergenic
991787886 5:70212370-70212392 CCATATCACTATTAACATTTTGG - Intergenic
991790323 5:70230420-70230442 CCATATCACTATTAACATTTTGG - Intergenic
991815072 5:70505511-70505533 CCATATCACTATTAACATTTTGG - Intergenic
991818207 5:70526796-70526818 CCATATCACTATTAACATTTTGG - Intergenic
991838678 5:70780814-70780836 CCATATCACTATTAACATTTTGG + Intergenic
991880332 5:71212734-71212756 CCATATCACTATTAACATTTTGG - Intergenic
991882772 5:71230760-71230782 CCATATCACTATTAACATTTTGG - Intergenic
992045527 5:72884718-72884740 CCTTGGCACTATTGGCATTTTGG + Intronic
992276634 5:75127458-75127480 CCTTGACATAAATGACATTTGGG - Intronic
992706157 5:79395332-79395354 CCTTGGCATTATTGACATTTTGG + Intronic
993456392 5:88131927-88131949 CCATATCACTATTAGCATTTTGG + Intergenic
993542849 5:89173609-89173631 CCCTGACACTACTGACATTTTGG - Intergenic
993621001 5:90167690-90167712 ATTTGACACTACTAACATTTTGG - Intergenic
993723168 5:91341680-91341702 CCTTGGCACTATTGACATTTTGG + Intergenic
993809628 5:92459258-92459280 CTTTGAAATTATTGACATTTTGG + Intergenic
993896565 5:93542349-93542371 CCTTGGCATTATTGATATTTGGG + Intergenic
994421249 5:99528015-99528037 CCATATCACTATGAACATTTTGG + Intergenic
994424057 5:99561839-99561861 CCTTGACAGTCTTTACAATTTGG + Intergenic
994485791 5:100386299-100386321 CCATATCACTATGAACATTTTGG - Intergenic
994563019 5:101401146-101401168 CCTTGGCACTATTGACATTTGGG + Intergenic
995006649 5:107204777-107204799 CATTGATACTCTTTACATTTTGG - Intergenic
995429028 5:112054181-112054203 CCATAACACTATCAGCATTTTGG - Intergenic
995484553 5:112627195-112627217 CCTTGGCACTGTTGACATTTTGG + Intergenic
995828707 5:116330128-116330150 CCATGTCACTATCAGCATTTTGG + Intronic
995839098 5:116426394-116426416 CCTCATCACTATTGACATTTTGG - Intergenic
995913594 5:117216416-117216438 CTTTGACACTGTTTATATTTTGG - Intergenic
995956740 5:117785691-117785713 CCTTAGCACTATTGACATTTTGG + Intergenic
996038840 5:118788114-118788136 CCTTGGCAATATTGACATTTGGG + Intergenic
996216305 5:120870910-120870932 ATTTGACACTATTGAAATTTTGG - Intergenic
996298033 5:121947045-121947067 CCTCAGCACTATTGACATTTGGG + Intergenic
996304327 5:122029224-122029246 CCTTAGCACTGTTAACATTTTGG - Intronic
996541510 5:124634238-124634260 CCTTGGCACTATTGACATATGGG - Intergenic
996811452 5:127520081-127520103 CTTTGGCACTATTGAAATTTGGG + Intronic
996947331 5:129086154-129086176 CCTTGACACAATTGACATTTTGG + Intergenic
997113415 5:131100269-131100291 CCTTGGCACTATTAACATTTGGG + Intergenic
997221899 5:132175302-132175324 CCTGGGCACTACTGACATTTGGG + Intergenic
997270423 5:132532169-132532191 CCCTGCCACTACTGACATTTTGG + Intergenic
998128535 5:139639592-139639614 ACTTCACACTATTGACATTTTGG + Intergenic
998394962 5:141812350-141812372 CCTCAGCACTATTGACATTTGGG + Intergenic
998585295 5:143420728-143420750 CCTCGGCACTATTGACATTTTGG - Intronic
998654418 5:144160822-144160844 TCTTGGCACTACTGACATTTGGG + Intronic
998671567 5:144359753-144359775 CTTTGGCCCTATTGACATTTGGG - Intronic
998683989 5:144503539-144503561 CCTCAACACTACTGACATTTTGG - Intergenic
998753740 5:145352941-145352963 CCATATCACTATCAACATTTTGG + Intergenic
999039054 5:148386323-148386345 CCTTGACACTATTTAATCTTGGG + Intronic
999217571 5:149948000-149948022 CCTTGACACTATCAGCATTTTGG + Intergenic
999436806 5:151569557-151569579 CCATGGCACTATTGACATTGGGG - Intergenic
999464894 5:151793578-151793600 TCTTGGCACTGTTGACATTTTGG + Intronic
999540927 5:152571961-152571983 CCATATCACTATCAACATTTTGG - Intergenic
999609180 5:153350915-153350937 CATTGTTACTATTGACATTTGGG + Intergenic
999841004 5:155426387-155426409 CCTTGACACTATCGACAATTTGG + Intergenic
999917497 5:156279090-156279112 CCTTGGCACTACTGAAATTTTGG - Intronic
1000121824 5:158204834-158204856 CCTGGACAACATTAATATTTGGG - Intergenic
1000162887 5:158617398-158617420 CCTTGGCACTATTGAGAATTGGG + Intergenic
1000324062 5:160158685-160158707 CTTTGACACTATTGACATTTTGG - Intergenic
1000381772 5:160636014-160636036 CTTTGAAAGTATTCACATTTTGG - Intronic
1000382620 5:160642618-160642640 CTTTGGCACCATTGACATTTTGG - Intronic
1000392899 5:160743966-160743988 TCTTGGTATTATTAACATTTTGG - Intronic
1000522064 5:162307516-162307538 CCTTGGCACTATTGACATTTTGG + Intergenic
1000702432 5:164469436-164469458 ACTTGGAACTATTGACATTTTGG - Intergenic
1000721643 5:164715291-164715313 CCTTGGCAACATCAACATTTGGG - Intergenic
1000750450 5:165089179-165089201 CCTTGGCACTATTGACGTTTTGG + Intergenic
1000910355 5:167014203-167014225 CTTTGACACTATGAAACTTTAGG - Intergenic
1001001471 5:168011476-168011498 CCTTGGCACTATTATCATTTTGG - Intronic
1001017956 5:168158522-168158544 CCTTAGCACAGTTAACATTTTGG + Intronic
1001152158 5:169241401-169241423 CTTTGGCACTAGTGACATTTTGG + Intronic
1001193044 5:169648162-169648184 CCTTGTCACTATTGACATTGTGG + Intronic
1001554552 5:172627019-172627041 CTTTGCAACTATTTACATTTAGG - Intergenic
1001643421 5:173261773-173261795 CCTCAGCACTATTGACATTTAGG + Intergenic
1001740799 5:174051277-174051299 CCTTGGCGCTGTTGACATTTGGG - Intronic
1001831734 5:174794773-174794795 CCTTGGCATTATCGACATTTTGG + Intergenic
1001832355 5:174799415-174799437 CCTTGGCACTGTTACCCTTTTGG + Intergenic
1001929452 5:175662433-175662455 CCTCGGCACTATTGACATTTGGG - Intronic
1002346344 5:178550304-178550326 CCTGGGCACTACTAACATTTGGG + Intronic
1002463607 5:179389742-179389764 CCTCAACACTATTGACATTTTGG - Intergenic
1002549354 5:179975434-179975456 CCTTGGCACTGTTGACATTTGGG - Intronic
1002663341 5:180805383-180805405 CCCTGACACTTTTTACAATTTGG + Intronic
1002712037 5:181201144-181201166 CCTTAACACAGTTGACATTTTGG + Intronic
1002869722 6:1156176-1156198 CCATATCACTATTAGCATTTTGG - Intergenic
1002962614 6:1930268-1930290 ACTTGACACATTTAACAGTTTGG + Intronic
1002992209 6:2248256-2248278 CCTCAGCACTATTGACATTTTGG - Intergenic
1003158239 6:3614665-3614687 TATTAGCACTATTAACATTTGGG - Intergenic
1003255357 6:4470537-4470559 CCTTGGCACTATTGACATTTTGG + Intergenic
1003274833 6:4640696-4640718 CCTCAACACTATTCACATTTTGG + Intergenic
1003359754 6:5413470-5413492 CCTAGAAACCATTAAGATTTAGG + Intronic
1003423782 6:5982908-5982930 CCTTGGCACTACTGACATTTTGG + Intergenic
1003431001 6:6037252-6037274 CCTTGCCACTATTGACATCTTGG - Intergenic
1003745248 6:8993859-8993881 CCTTGGCCCTATTGACATTTTGG + Intergenic
1003902807 6:10670518-10670540 CCTTGGCACTATTGCCATTTGGG - Intergenic
1003962640 6:11223139-11223161 CCTTGGCACTATTGACACTTAGG - Intronic
1003973751 6:11323637-11323659 CCTTGAAACCATGAACATTTGGG - Intronic
1004029708 6:11854618-11854640 CCTTGGCATTATTGAGATTTGGG - Intergenic
1004119210 6:12803687-12803709 CTTTGGCACTATTGACATTTTGG + Intronic
1004142378 6:13030880-13030902 CCTGAGCACTATTGACATTTTGG + Intronic
1004628981 6:17403903-17403925 CTTTGCAACTATTCACATTTTGG + Intronic
1004699173 6:18062810-18062832 TCTTGGTACTATTAACATTTTGG - Intergenic
1004927432 6:20429136-20429158 CCTTGGCACTAGTGACATTTTGG - Intronic
1005427476 6:25717656-25717678 CCCTGGCACTTTTAGCATTTGGG + Intergenic
1005548556 6:26893783-26893805 CCATATCACTATTAACATTTTGG - Intergenic
1005604636 6:27463969-27463991 CCTTGGCGCTATTGATATTTTGG + Intronic
1006217992 6:32462160-32462182 CCTTGGCACTATTGACATTTTGG + Intergenic
1006219908 6:32480086-32480108 CCTCAGCACTATTGACATTTTGG + Intergenic
1006224347 6:32523859-32523881 CCTCAGCACTATTGACATTTTGG + Intronic
1006381244 6:33698623-33698645 CCTTGGCACTACCAACACTTTGG + Intronic
1006831992 6:36974171-36974193 CCTTGGCACTATTGACATTTTGG + Intronic
1007352533 6:41284317-41284339 ACATGGCACTATTGACATTTGGG - Intronic
1007993244 6:46279379-46279401 CCTTGGCACTATTGACATTTGGG + Intronic
1008314081 6:50017575-50017597 CCTTGACACTATTGATATTTTGG - Intronic
1008397082 6:51021510-51021532 CCTTGGCAATATTGATATTTTGG + Intergenic
1008469570 6:51868552-51868574 CCTTGGCACTATTGGCATTTTGG - Intronic
1008606662 6:53146661-53146683 GTTTGGCACTATTGACATTTTGG + Intronic
1008669291 6:53750527-53750549 CCTTGCTACTATAAATATTTAGG - Intergenic
1008670943 6:53768195-53768217 CCTTGGCACTATAAGCATTTTGG - Intergenic
1008762386 6:54868206-54868228 CCTTGGCACTGTTGACATTTTGG + Intronic
1008817989 6:55592494-55592516 CCTCAGCACTATTGACATTTTGG + Intergenic
1008870887 6:56271151-56271173 CATTGTCACTATCAGCATTTTGG - Intronic
1008885556 6:56428982-56429004 TCTGGGCACTATTGACATTTTGG - Intergenic
1009195900 6:60684033-60684055 CCTTGGCACCATTGACAGTTTGG - Intergenic
1009196635 6:60694653-60694675 CCTTGACAATATTGATATTTGGG - Intergenic
1009309568 6:62133707-62133729 CCATATCACTATCAACATTTTGG - Intronic
1009396534 6:63206264-63206286 CCATATCACTATCAACATTTTGG - Intergenic
1009637499 6:66284845-66284867 CCTTATCACTATCAGCATTTTGG - Intergenic
1009780387 6:68261180-68261202 CCCTATCACTATCAACATTTTGG + Intergenic
1010005447 6:70990916-70990938 CCATACCACTATTAGCATTTTGG - Intergenic
1010126735 6:72441203-72441225 CCTTGGTACTATTGACATTTGGG + Intergenic
1010159268 6:72832516-72832538 CCTTGGCACTGTTGACATTTTGG - Intronic
1010179833 6:73073353-73073375 CCTTGGCACTATTGACATTTGGG + Intronic
1010231617 6:73540141-73540163 CCTTGGCACTGTTGACATTTGGG - Intergenic
1010344898 6:74799927-74799949 CCATATCACTATTATCATTTTGG - Intergenic
1010405863 6:75505111-75505133 CCTTAGCACTATTGATATTTTGG - Intergenic
1010498710 6:76567824-76567846 CCATGTCACTATCAGCATTTTGG + Intergenic
1010544378 6:77131716-77131738 CCTCACCACTATTGACATTTTGG - Intergenic
1010583002 6:77622631-77622653 CCTTGATATTATTGATATTTTGG + Intergenic
1010688155 6:78876559-78876581 TCTTGGCAGTATTAACATTATGG + Intronic
1010860263 6:80901048-80901070 CCATATCACTATCAACATTTTGG + Intergenic
1010906743 6:81500777-81500799 CCATATCACTATTAGCATTTTGG - Intronic
1011092721 6:83624585-83624607 TCTTGGCACTATTGGCATTTGGG + Intronic
1011097298 6:83680673-83680695 CCTTGGCACTACTGATATTTTGG + Intronic
1011172692 6:84523557-84523579 CCTTGACACTGGAAATATTTGGG - Intergenic
1011248692 6:85347338-85347360 AATAAACACTATTAACATTTTGG - Intergenic
1011547182 6:88494095-88494117 CCTTGGCACTATTGACATTCTGG - Intergenic
1011574533 6:88781071-88781093 CCTTGGCACCATTGACATTTTGG - Intronic
1011738347 6:90334567-90334589 CCATATCACTGTTAACATTTTGG + Intergenic
1012008447 6:93747508-93747530 CATTGTTACTATTAACATTTGGG + Intergenic
1012097270 6:94977967-94977989 CCATGTCACTATCAGCATTTTGG + Intergenic
1012195740 6:96339855-96339877 CCTTGACAATGTGAACATTTGGG + Intergenic
1012313969 6:97762210-97762232 CCTTGGCATTATTGACACTTTGG - Intergenic
1012649808 6:101738669-101738691 CCTTGGCACTACTGACAATTTGG + Intronic
1013503127 6:110771952-110771974 CCTTATCACTATCAGCATTTTGG + Intronic
1013603057 6:111722809-111722831 CCTTGACACTATTAACATTTGGG - Intronic
1013642348 6:112098108-112098130 CCATGACACTATTCACAGCTGGG - Intronic
1013711442 6:112904743-112904765 CGTTGACACTGTTAACCTTTTGG - Intergenic
1013716507 6:112968686-112968708 CCATGTCACTATCAACATTTTGG + Intergenic
1013745674 6:113343446-113343468 CCTTGGCACTGTTGACATTTTGG + Intergenic
1013840364 6:114384820-114384842 CATTGCCACTATTATCAGTTCGG - Intergenic
1013852079 6:114528123-114528145 CCATGACACTATTGACATCTGGG - Intergenic
1013988558 6:116226015-116226037 CCTTGGCACTACTGAGATTTGGG - Intronic
1014102061 6:117522210-117522232 CCTTGGCACTATTGATATTTTGG + Intronic
1014131433 6:117838721-117838743 CTTCCACACTATTGACATTTTGG + Intergenic
1014134067 6:117867264-117867286 CCATATCACTATTAGCATTTTGG + Intergenic
1014412046 6:121136568-121136590 TCTTAGCACTATTAATATTTTGG - Intronic
1014677705 6:124388084-124388106 CCTTGGAACTGTTGACATTTCGG - Intronic
1014811717 6:125894123-125894145 CCTTAACACTATTGACATTTTGG + Intronic
1014883157 6:126747224-126747246 CCTTATCACTATTGGCATTTTGG + Intergenic
1015183817 6:130390878-130390900 CCTCTACACTATTGACAGTTTGG + Intronic
1015191583 6:130477551-130477573 CCTTGACAGTCTTTACAGTTTGG - Intergenic
1015830327 6:137362044-137362066 CCTCAGCACTATTGACATTTGGG - Intergenic
1015885923 6:137918697-137918719 TCTTGGCATTATTGACATTTTGG + Intergenic
1016424067 6:143915597-143915619 CCGTATCACTATCAACATTTTGG - Intronic
1016669490 6:146686395-146686417 CATAGGCCCTATTAACATTTTGG + Intronic
1016672889 6:146729279-146729301 CACTCACACTATTGACATTTTGG + Intronic
1016696331 6:147000343-147000365 CCTTGACACTATTGAGATTCGGG - Intergenic
1016767431 6:147810666-147810688 TCTTAGCACAATTAACATTTCGG + Intergenic
1017462478 6:154664468-154664490 CCTTTTCTCCATTAACATTTTGG - Intergenic
1017557017 6:155582769-155582791 CCTGGGCACTGTTGACATTTTGG - Intergenic
1017832531 6:158143968-158143990 CCTCAACACTATTGACATTTTGG - Intronic
1018338140 6:162818150-162818172 CCTTGACCCCTCTAACATTTGGG + Intronic
1019089808 6:169519109-169519131 CCATAGCACTATCAACATTTTGG + Intronic
1020191362 7:6001190-6001212 CCTTTATACTATACACATTTAGG + Intronic
1020493891 7:8822883-8822905 CCATAACACTATCAGCATTTTGG + Intergenic
1020569283 7:9838181-9838203 CCTTGGCCCTATTGACATATTGG + Intergenic
1020612100 7:10411338-10411360 CCTTGTCGCTATTGACATTTTGG + Intergenic
1020712037 7:11618894-11618916 TCTGAACCCTATTAACATTTAGG - Intronic
1021005634 7:15391929-15391951 CGTCGGCACTATTGACATTTTGG - Intronic
1021016899 7:15547068-15547090 CCTTAACACTATTACAATTTGGG + Intronic
1021018221 7:15562861-15562883 CCAAAACGCTATTAACATTTTGG + Intergenic
1021023456 7:15634198-15634220 CCTCAGCACTATTGACATTTTGG + Intronic
1021081268 7:16368511-16368533 CATTGGCACTAGTAGCATTTTGG + Intronic
1021170753 7:17395212-17395234 CCGTAACATTATTAGCATTTTGG + Intergenic
1021179376 7:17488087-17488109 CCTTGCCATTATTGAGATTTGGG - Intergenic
1021273837 7:18625400-18625422 ACTTCGCACTATTAACATTTGGG + Intronic
1021339404 7:19444856-19444878 CCTAGTCACTATTGACATTTGGG - Intergenic
1021380339 7:19958583-19958605 CCATGACACTATTGACACTTTGG - Intergenic
1021406873 7:20280375-20280397 CCTTGTCACTATGAATATATTGG + Intergenic
1021407735 7:20292599-20292621 CTTCCACACTATTAAAATTTTGG - Intergenic
1021476841 7:21071478-21071500 TCTTGGCACTATTGACATTTGGG - Intergenic
1021595261 7:22309068-22309090 CCTTGGTAGTATTGACATTTGGG - Intronic
1021703967 7:23348583-23348605 CCTTGGCACTACTGACTTTTTGG + Intronic
1021936897 7:25640010-25640032 CCTTGACACTATAAACATTTTGG - Intergenic
1022132328 7:27416003-27416025 CCTTGGCACTATTAACATCCTGG + Intergenic
1022378252 7:29835418-29835440 CCTTGGCACCACTGACATTTGGG + Intronic
1022589292 7:31645859-31645881 CCTTGACACTACTGACATTTTGG - Intronic
1022601144 7:31761287-31761309 CATTTATATTATTAACATTTAGG + Intronic
1022613990 7:31909861-31909883 AATTGGCACCATTAACATTTTGG + Intronic
1022738744 7:33100979-33101001 CCTTGACCCTTTAAACCTTTAGG + Intronic
1022751528 7:33231819-33231841 CCTTGACGCTGTTGACATTTTGG + Intronic
1022771818 7:33481644-33481666 CCTTTACAGTATTAATATTTTGG - Intronic
1022788220 7:33660270-33660292 CCTTGGCACTCTTGGCATTTGGG - Intergenic
1022828345 7:34039544-34039566 CCTTCACACTCCTGACATTTGGG - Intronic
1023004977 7:35854528-35854550 TCTTGGCACTACTGACATTTTGG - Intronic
1023028406 7:36072569-36072591 CCTTGGCGCTACTGACATTTTGG - Intergenic
1023064159 7:36359346-36359368 CCTTGATACTGTTGACATTTTGG - Intronic
1023125353 7:36949545-36949567 CCTTGGCACTACTGACATTTGGG + Intronic
1023323211 7:39023566-39023588 CCATGACTCTGTTGACATTTGGG - Intronic
1023599622 7:41868704-41868726 TCTTGGAACTATTAATATTTGGG + Intergenic
1023665420 7:42518066-42518088 CCTTGGCACTGGTAACATTTTGG + Intergenic
1023665579 7:42519756-42519778 CCTTGGCACTGGTAACATTTTGG + Intergenic
1023695155 7:42837850-42837872 CCTCTGCACTATTGACATTTTGG - Intergenic
1023726353 7:43146209-43146231 CCTTGGCACTATTGACATTCTGG + Intronic
1023815103 7:43943543-43943565 CCTTGGCACTATTGACACTTGGG - Intronic
1023858024 7:44197311-44197333 CCTTGGCACTATTGACATTTTGG - Intronic
1024968157 7:55043716-55043738 CCTTAGAACTATTAACATTCTGG - Intronic
1025218397 7:57081158-57081180 TCTTGGCACTACTGACATTTTGG + Intergenic
1025267291 7:57474156-57474178 CCATATCACTATTAGCATTTTGG - Intergenic
1025629317 7:63254777-63254799 TCTTGGCACTACTGACATTTTGG + Intergenic
1025721508 7:64020019-64020041 CCATATCACTATTAGCATTTTGG - Intergenic
1025871043 7:65434487-65434509 CCTTGTCGCTATTGACACTTTGG - Intergenic
1026090377 7:67294663-67294685 CCTTTATACTATACACATTTAGG + Intergenic
1027119975 7:75509976-75509998 CCTTTATACTATACACATTTAGG + Intergenic
1027271857 7:76525633-76525655 CCTTTATACTATACACATTTAGG - Intergenic
1027488535 7:78792255-78792277 CCTTTACACAATAAACACTTAGG + Intronic
1027624660 7:80531397-80531419 CCATATCACTATCAACATTTTGG - Intronic
1027794666 7:82677409-82677431 CGGTGACACTATTGACGTTTTGG - Intergenic
1027809773 7:82880715-82880737 CCTTGGCTCTGTTGACATTTTGG - Intronic
1027859007 7:83551750-83551772 GCTCAACACTATTGACATTTTGG + Intronic
1028234137 7:88340209-88340231 CCTCGGCATTATTGACATTTTGG + Intergenic
1028275263 7:88848197-88848219 CCTTGATGTTATTGACATTTTGG - Intronic
1028454198 7:91020592-91020614 GCTTGCCACTGTTAACAGTTTGG + Intronic
1028516363 7:91681735-91681757 CCATAACACTATCAGCATTTTGG + Intergenic
1028779663 7:94721824-94721846 CTTTGGCACTATTGACATGTTGG + Intergenic
1028909628 7:96193686-96193708 CCTTGCCATTATTGGCATTTTGG + Intronic
1029024755 7:97404485-97404507 CCTTAACACTATCAACATTTTGG + Intergenic
1029043240 7:97599492-97599514 CCTTCACTCTATTCGCATTTGGG - Intergenic
1029717530 7:102340047-102340069 CCTTTATACTATACACATTTAGG - Intergenic
1029789901 7:102831456-102831478 CCCTGACACTATTCATATTTTGG - Intronic
1029914801 7:104198325-104198347 CCATATCACTATCAACATTTTGG - Intronic
1029924606 7:104302476-104302498 CCTCAGCACTATTAACATTTTGG + Intergenic
1029935889 7:104423755-104423777 CCTTGACACAACTGACATTTTGG - Intronic
1029946672 7:104540490-104540512 CCTTGGCACTATTGACATTTGGG - Intronic
1030198533 7:106877406-106877428 CCTTGGCACTGTTGCCATTTTGG - Intronic
1030235505 7:107256224-107256246 CCTTGGCATTACTGACATTTTGG + Intronic
1030392172 7:108941628-108941650 CCTTGACGGTCTTTACATTTTGG + Intergenic
1030405566 7:109107980-109108002 CCTTGGCACTATTGACATTTTGG + Intergenic
1030511005 7:110481855-110481877 CCATATCATTATTAACATTTTGG + Intergenic
1030834569 7:114266118-114266140 CCATATCACTATTAGCATTTTGG + Intronic
1030917710 7:115337524-115337546 CCTTGACACTATTGCAATTTGGG - Intergenic
1030991718 7:116309120-116309142 CCTTGGCACTATGTACACTTGGG - Intronic
1031095860 7:117419079-117419101 CCATGGCACTACTGACATTTGGG + Intronic
1031167226 7:118243896-118243918 CCGTGAAACTGTTGACATTTGGG - Intergenic
1031200315 7:118674945-118674967 CCTTTAATCTGTTAACATTTTGG + Intergenic
1031310794 7:120194773-120194795 CCATGTCACTATCAGCATTTTGG - Intergenic
1031409806 7:121427800-121427822 GCTTAACATTATTAACAATTAGG + Intergenic
1031469947 7:122156929-122156951 CCTCGTCACTATTGATATTTTGG + Intergenic
1031482383 7:122294269-122294291 TCTTGGCACTATTGACATTTTGG + Intergenic
1031716022 7:125109657-125109679 CCATATCACTATTAACATATTGG + Intergenic
1031722374 7:125193109-125193131 CCATGTCACTGTTAGCATTTTGG - Intergenic
1031872427 7:127101920-127101942 CCATATCACTATTAACATTTTGG - Intronic
1031984834 7:128157370-128157392 CCTGGGCACTATTGACATTTGGG + Intergenic
1032060053 7:128716716-128716738 CCTCGACACTATTAATGTTTTGG - Intronic
1032561240 7:132895277-132895299 CCTTGGCACTATCAACAATTTGG + Intronic
1032856529 7:135838251-135838273 CCTTGGCACTAATGACATGTTGG - Intergenic
1032920697 7:136543178-136543200 CCTCAGCACTATTGACATTTTGG + Intergenic
1032998900 7:137481075-137481097 GCTCTACACTATTGACATTTGGG + Intronic
1033029989 7:137816860-137816882 CCTTGGCACTAATGACACTTTGG + Intronic
1033042290 7:137929330-137929352 ACCTGGCACTAATAACATTTTGG + Intronic
1033489449 7:141827680-141827702 TCTTGGCACTATTAACATTTTGG - Intergenic
1034286221 7:149884969-149884991 CCCTGACACTGTTGACAATTTGG + Intergenic
1034359422 7:150480957-150480979 CCTTGGGACTATTGACATTTTGG - Intergenic
1034587668 7:152109924-152109946 CCTTGGCACTACTGACATTTTGG + Intronic
1034612252 7:152381467-152381489 CTTTGGCACTGTTGACATTTTGG - Intronic
1035119186 7:156550436-156550458 CCTTGGCAAAATTAACATTCAGG - Intergenic
1036029343 8:4949643-4949665 CCTTGGCACTATTGCCATGTGGG - Intronic
1036216868 8:6887803-6887825 CCTTGGCACAATTAACATTTGGG - Intergenic
1036723278 8:11198614-11198636 CCAAGAAACAATTAACATTTAGG + Intronic
1036920032 8:12843752-12843774 CCTCAGCACTATTGACATTTTGG + Intergenic
1037050532 8:14367271-14367293 CCATATCACTATTAGCATTTTGG + Intronic
1037347826 8:17918419-17918441 CCTTGATACTATTGACAGTTTGG - Intergenic
1037354821 8:18007032-18007054 CCTTGGCACTGTTGACATTTAGG - Intronic
1037378591 8:18260432-18260454 CCTTGACTTTTTGAACATTTTGG + Intergenic
1038225270 8:25650965-25650987 CCTTGACCCAATTGTCATTTAGG + Intergenic
1038357773 8:26846334-26846356 TCTTGGCACTATTGCCATTTTGG + Intronic
1038784720 8:30601565-30601587 CCTTGGCAGTGTTAACATTTGGG - Intronic
1038904933 8:31890000-31890022 CCTCTGCACTATCAACATTTTGG + Intronic
1039247092 8:35620940-35620962 CCTTAACACTGTTGACGTTTGGG + Intronic
1039308522 8:36290920-36290942 CCTTGGGACTAATGACATTTTGG + Intergenic
1039309144 8:36297082-36297104 CCATATCACTATCAACATTTTGG - Intergenic
1039341907 8:36659679-36659701 CCTTGCCATTATTGACATTTTGG + Intergenic
1040078767 8:43266944-43266966 CCATATCACTATTAGCATTTTGG + Intergenic
1040407104 8:47116074-47116096 CCCTATCACTATCAACATTTTGG + Intergenic
1040426423 8:47291903-47291925 CCTTGACACTCTTGACATTTTGG + Intronic
1040436321 8:47394614-47394636 CCTTGGCACTCTTGACATTTGGG - Intronic
1040559148 8:48508611-48508633 TCTCAACACTATCAACATTTTGG + Intergenic
1040563954 8:48549425-48549447 CCTTGGCACTGCTGACATTTGGG + Intergenic
1040694426 8:49979081-49979103 CCTTCACGCTGTTAAGATTTTGG + Intronic
1040813322 8:51481179-51481201 CCATGTCACTATCAGCATTTTGG - Intronic
1040863378 8:52023500-52023522 CCATGTCACTATGAGCATTTTGG - Intergenic
1040946317 8:52888448-52888470 TCTTGACACTATTAAGTTCTAGG + Intergenic
1041380368 8:57248339-57248361 CCTCGCCACTATAAACATGTAGG - Intergenic
1041430584 8:57777149-57777171 CCATATCACTATTAGCATTTTGG - Intergenic
1041437926 8:57862595-57862617 CCATATCACTATCAACATTTTGG - Intergenic
1041499042 8:58519516-58519538 ACTTGACACCATTAAATTTTAGG + Intergenic
1041733297 8:61084564-61084586 CCTTGGCACGATTGACCTTTTGG - Intronic
1042112180 8:65392308-65392330 CCTCAGCACTATTGACATTTGGG - Intergenic
1042235670 8:66611591-66611613 CCTTTGCACTATTGACATCTTGG - Intronic
1042354906 8:67816616-67816638 CCTCGGCACTGTTGACATTTTGG - Intergenic
1042518536 8:69684897-69684919 CCTCAGCACTATTGACATTTGGG - Intronic
1042602431 8:70511940-70511962 CCATGTCACTATCAGCATTTTGG - Intergenic
1042769383 8:72362824-72362846 CCTCAACACTATTGATATTTGGG - Intergenic
1043105170 8:76100148-76100170 TCTTGGCAGTATTAATATTTTGG - Intergenic
1043297564 8:78684001-78684023 CCATATCACTATTAGCATTTTGG + Intronic
1043704464 8:83331010-83331032 CCATATCACTATCAACATTTTGG + Intergenic
1043881305 8:85546441-85546463 CCTTGACACTGTTGACATTTTGG - Intergenic
1044115840 8:88332512-88332534 GCATGACACTAATAACATTAAGG - Intergenic
1044294328 8:90510200-90510222 CTTTGGCACTATTGACATTTGGG - Intergenic
1044395626 8:91707729-91707751 CCATGTCACTATTAGCATTTTGG - Intergenic
1044433467 8:92135475-92135497 CTTTGCCACTATTGATATTTGGG - Intergenic
1044477619 8:92646678-92646700 ACTTGGCCCTATTGACATTTGGG - Intergenic
1044743435 8:95350500-95350522 CCTTGGCACTCTTGCCATTTGGG + Intergenic
1045079131 8:98605064-98605086 CCATATCACTATCAACATTTTGG + Intronic
1045427879 8:102085147-102085169 CCTCAACACTATTAATATTTGGG + Intronic
1045496950 8:102717094-102717116 CCTTGGCTTTATTGACATTTGGG + Intergenic
1045675779 8:104606973-104606995 CCATGTCACTATCAGCATTTTGG - Intronic
1045759074 8:105582506-105582528 CATTGGCACTATTAAGCTTTGGG - Intronic
1045785661 8:105917980-105918002 CCATATCACTATTAGCATTTTGG - Intergenic
1045860898 8:106814077-106814099 CCTTGGCACTATTGACATTTTGG - Intergenic
1045903508 8:107313741-107313763 CTTTAAAACTAGTAACATTTTGG - Intronic
1046052039 8:109035161-109035183 AATTGACACTACTGACATTTTGG - Intergenic
1046105897 8:109666259-109666281 CCTCGACACTATTAACTTATTGG + Intronic
1046117130 8:109797934-109797956 CCTTAGCACTATTGACATTTTGG + Intergenic
1046216460 8:111153657-111153679 CCTAGACAAAATTGACATTTTGG - Intergenic
1046257136 8:111715307-111715329 CTTTGGCACTATTGACATTTTGG - Intergenic
1046264639 8:111814913-111814935 CCATATCACTATTAGCATTTTGG + Intergenic
1046326242 8:112650952-112650974 CCTCGGCACTGTTGACATTTTGG + Intronic
1046343082 8:112884434-112884456 CCTCCACACTACTGACATTTTGG + Intronic
1046433210 8:114154495-114154517 CCATGTCACTATCAGCATTTTGG + Intergenic
1046551514 8:115723697-115723719 CTTGGGCACTATTGACATTTTGG - Intronic
1046684377 8:117208450-117208472 TCTTGGTACTATTACCATTTGGG - Intergenic
1046747330 8:117890457-117890479 CCTTGACATTGTTGACATATTGG - Intronic
1046786562 8:118272809-118272831 CCATATCACTATTAGCATTTTGG + Intronic
1046892386 8:119436966-119436988 CCATGGCATTATTGACATTTGGG - Intergenic
1046928896 8:119823824-119823846 CCATATCACTATCAACATTTTGG - Intronic
1047115879 8:121841567-121841589 CCATATCACTATTAGCATTTTGG - Intergenic
1047139641 8:122123538-122123560 CCTTGGCACTACTCGCATTTGGG + Intergenic
1047237361 8:123053643-123053665 CCTGGGCACTGTTGACATTTTGG + Intronic
1047315317 8:123727674-123727696 CCTTGGCACTGCTGACATTTGGG - Intronic
1047318777 8:123759187-123759209 CCTTCACTCTATTGACACTTTGG + Intergenic
1047376118 8:124298841-124298863 TCTTGATACTAATGACATTTGGG + Intergenic
1047887761 8:129271393-129271415 CTTTGGCACTATTGACATTTTGG - Intergenic
1048010167 8:130448998-130449020 TCTTGGCAATATTAACATGTTGG + Intergenic
1048143575 8:131820007-131820029 CCTTAACACTATTGACATTTAGG - Intergenic
1048164112 8:132046923-132046945 GCTTCACATTATTGACATTTTGG + Intronic
1048637587 8:136314835-136314857 CTTTGACACCAAGAACATTTGGG - Intergenic
1048856093 8:138687789-138687811 CCTTGGCACTATTGACCTTCAGG + Intronic
1048936282 8:139359877-139359899 TCTTGGGACTATTCACATTTAGG - Intergenic
1049924800 9:398410-398432 CTTTGACACTATTAAAAATATGG - Intronic
1050002978 9:1098375-1098397 GCTTGACACTATTGACATTTGGG - Intergenic
1050028069 9:1356482-1356504 CCTTGGCTCTATTAATATTTGGG - Intergenic
1050121482 9:2313180-2313202 CCATGTCACTATCAGCATTTTGG - Intergenic
1050139807 9:2505706-2505728 CCTCGACACTATTGACATTTGGG + Intergenic
1050155891 9:2666160-2666182 CCGTATCACTATCAACATTTTGG - Intergenic
1050162217 9:2730771-2730793 GTTTGGCACTATTGACATTTTGG - Intronic
1050235610 9:3576046-3576068 TCTGGGCACTATTGACATTTTGG + Intergenic
1050623208 9:7476319-7476341 CCTTGACACTATTGACATTTTGG + Intergenic
1050686677 9:8178343-8178365 TCTTGGCACTATTGACATTTTGG - Intergenic
1050796699 9:9554797-9554819 CCTTGACATTATGTACATTATGG - Intronic
1050915311 9:11123287-11123309 CCATGTCACTATCAGCATTTTGG + Intergenic
1050922726 9:11225999-11226021 CCTTAGCACTACTAACATTTTGG - Intergenic
1051091260 9:13411587-13411609 CATACACACTATTAATATTTAGG - Intergenic
1051107094 9:13592756-13592778 TCTTAACACTATTGACAATTAGG - Intergenic
1051651765 9:19333375-19333397 CTTTGGCACTATTGATATTTTGG + Intronic
1051971660 9:22895118-22895140 ATGTGACACTATTAACATTCTGG - Intergenic
1052085233 9:24256771-24256793 CCTCAGCACTATTGACATTTTGG - Intergenic
1052367400 9:27628323-27628345 CCTTGGCATTGTTGACATTTTGG - Intergenic
1052526781 9:29629022-29629044 CCCTGTCACTATCAGCATTTTGG - Intergenic
1053083640 9:35198703-35198725 CCATATCACTATCAACATTTTGG - Intronic
1053128531 9:35601922-35601944 CCGTGGCACTATTGACATTTTGG - Intergenic
1053153855 9:35760309-35760331 CAGTGACACTGTTAACATTTTGG + Intergenic
1053571859 9:39318202-39318224 CCATGTCACTATCAACATTTTGG - Intergenic
1053622388 9:39833036-39833058 CCATGTCACTATCAGCATTTTGG - Intergenic
1053747912 9:41219643-41219665 CCTTGGCACTGTTAGCATTCTGG - Intergenic
1054093413 9:60876913-60876935 CCATGTCACTATCAGCATTTTGG - Intergenic
1054114896 9:61152833-61152855 CCATGTCACTATCAGCATTTTGG - Intergenic
1054125286 9:61300809-61300831 CCATGTCACTATCAACATTTTGG + Intergenic
1054338472 9:63830872-63830894 CCTTGGCACTGTTAGCATTCTGG + Intergenic
1054479374 9:65645728-65645750 CCTTGGCACTGTTAGCATTCTGG + Intergenic
1054592860 9:67029701-67029723 CCATGTCACTATCAGCATTTTGG + Intergenic
1054744687 9:68842787-68842809 CTTTGGCACTATTGACATTTTGG - Intronic
1054745515 9:68850356-68850378 CCTCAGCACTATTGACATTTGGG + Intronic
1054849838 9:69836299-69836321 CCTTGGTACTATGGACATTTTGG + Intronic
1054931585 9:70640802-70640824 ACTTGGTATTATTAACATTTTGG + Intronic
1054973073 9:71111583-71111605 CCTCAACACTACTGACATTTGGG - Intronic
1055059408 9:72053263-72053285 CTTTTGCACTATTGACATTTTGG - Intronic
1055178896 9:73358210-73358232 CCTCGACAATATTGACGTTTTGG + Intergenic
1055335249 9:75227052-75227074 CCATATCACTATCAACATTTTGG + Intergenic
1055381528 9:75712640-75712662 CCTGGACACTATAAACCTCTTGG + Intergenic
1055460949 9:76519763-76519785 CCTGGGCACTATTGACATTTTGG + Intergenic
1055482859 9:76727047-76727069 CCTTGGCACTACTGACATTTGGG + Intronic
1055587161 9:77767211-77767233 CCTCGACACTACTGACATTTGGG + Intronic
1055675482 9:78655095-78655117 CCTTGGCATTATGAACATTAGGG - Intergenic
1055774537 9:79753222-79753244 CCATATCACTATTAGCATTTCGG + Intergenic
1055779197 9:79800932-79800954 CCTTGGCACTCTTGACATTTTGG + Intergenic
1055936678 9:81610616-81610638 CCTCAGCACTATTGACATTTGGG + Intronic
1055939996 9:81640149-81640171 CCTTAGCACTGTTGACATTTTGG - Intronic
1056144343 9:83714773-83714795 CCTTGATACTGTTGACATTTGGG + Intergenic
1056251201 9:84750096-84750118 CCTTGGCACTATTGGCGTTTGGG + Intronic
1056706286 9:88954984-88955006 CCTTGGCACTATTGACATTTTGG - Intergenic
1056926014 9:90835109-90835131 CCTTGGCACTCTTGACATTTGGG - Intronic
1057520156 9:95753578-95753600 TCTCGCCACTATTGACATTTTGG - Intergenic
1057529107 9:95828404-95828426 CTTTGACATTATCAGCATTTTGG - Intergenic
1057563789 9:96150441-96150463 GGTTGGCACTATTGACATTTTGG + Intergenic
1058221833 9:102313041-102313063 CCATATCACTATTAGCATTTTGG - Intergenic
1058736350 9:107897739-107897761 TTTTGGTACTATTAACATTTAGG + Intergenic
1058746622 9:107997792-107997814 CTTTGGCACCATTGACATTTGGG + Intergenic
1058872281 9:109212922-109212944 CTTTGGCACTAGCAACATTTTGG - Intronic
1059069589 9:111121128-111121150 CCATGTCACTATCAGCATTTTGG + Intergenic
1059194539 9:112358437-112358459 CCGTGGCACTATTGACATTTTGG - Intergenic
1059241069 9:112806058-112806080 TCTTGGCAGTATTAACCTTTTGG + Intronic
1059427416 9:114229855-114229877 CCTTGGCACTACTGACATTTGGG + Intronic
1059508620 9:114823080-114823102 CCTTGACACCATTGACATTTTGG + Intergenic
1059628223 9:116091039-116091061 CCATATCACTATCAACATTTTGG - Intergenic
1059636123 9:116172380-116172402 CCTCACCACTATTAACATTTTGG + Intronic
1059778392 9:117500441-117500463 CCTTAACAATGTTCACATTTTGG + Intergenic
1059832878 9:118118148-118118170 ACTAGTCACTAGTAACATTTTGG + Intergenic
1059917844 9:119123640-119123662 CCACGGCACTATTGACATTTAGG + Intergenic
1059919075 9:119137560-119137582 CCTTGACACTATTGAATTTGAGG + Intergenic
1060651777 9:125333842-125333864 CCTTAACACCATTGACATTTTGG + Intronic
1060955318 9:127634717-127634739 TGTTGGCACTATTGACATTTTGG + Intronic
1061527329 9:131176995-131177017 CCCTGGCACTACTGACATTTTGG - Intronic
1061598389 9:131647838-131647860 CCTTGGCACTACTGACATTTTGG + Intronic
1061701356 9:132418359-132418381 CCTTGGCACTATTGACATTTGGG - Intronic
1202784046 9_KI270718v1_random:30414-30436 CCTTGGCACTGTTAGCATTCTGG - Intergenic
1203447825 Un_GL000219v1:76379-76401 CCTTGGCACTGTTAGCATTCTGG + Intergenic
1185825976 X:3250008-3250030 CTTTGGCACTGTTGACATTTGGG - Intergenic
1185860376 X:3573059-3573081 CATTCGCACTATTGACATTTGGG + Intergenic
1185925077 X:4136864-4136886 CCATGACACTATTAACAACTGGG - Intergenic
1185936753 X:4265111-4265133 CCTTGGCACTATTGAATTTTGGG + Intergenic
1185986688 X:4842726-4842748 CCTGGATACTACTGACATTTGGG + Intergenic
1186049641 X:5577096-5577118 CCTTGACACTATTGGTATTTGGG - Intergenic
1186157389 X:6739615-6739637 CCTTGACACTATTGACATCAGGG - Intergenic
1186173548 X:6902329-6902351 CCTTGGCACTATTAACACTTTGG + Intergenic
1186204608 X:7188273-7188295 CCTTGGCACTGTTGACACTTGGG + Intergenic
1186210724 X:7247837-7247859 CCTCTGCACTATTGACATTTGGG - Intronic
1186250856 X:7664623-7664645 TCTTGGCACTACTAACATTTGGG - Intergenic
1186256963 X:7732488-7732510 CCTTGGTACTGTTGACATTTGGG + Intergenic
1186323387 X:8453307-8453329 CCTTGACACAGTTGACATTTGGG + Intergenic
1186330743 X:8529917-8529939 CCTCAACACTATTGACTTTTGGG - Exonic
1186358736 X:8815716-8815738 CTTTGGCACTATTGACATTGGGG - Intergenic
1186401865 X:9267742-9267764 ACTTAGCACTATTGACATTTGGG + Intergenic
1186414277 X:9369910-9369932 CCGCAACACTATTGACATTTGGG - Intergenic
1186476309 X:9860226-9860248 CCTCAGCACTATTGACATTTGGG - Intronic
1186514941 X:10159978-10160000 CCTTGGCACTACTGGCATTTGGG + Intronic
1186523776 X:10229045-10229067 CCTTGGCACTAGTGACATTTAGG - Intronic
1186536682 X:10357156-10357178 CCTCAGCACTATTGACATTTTGG - Intergenic
1186560507 X:10607457-10607479 CTTTGGCACTATTGACATTTGGG - Intronic
1186578162 X:10788770-10788792 CCTTGGCACTACTGGCATTTGGG - Intronic
1186588418 X:10901838-10901860 ACTTGCTACTATGAACATTTAGG + Intergenic
1186595066 X:10972363-10972385 CCTTACCACTATTGACTTTTAGG + Intergenic
1186601307 X:11040678-11040700 CCTTGGCACTATTGACATTTTGG - Intergenic
1186624668 X:11280117-11280139 CCTTGGAACTGTTGACATTTAGG - Intronic
1186638902 X:11434189-11434211 CCTTGGCACTCTAGACATTTGGG - Intronic
1186639037 X:11435196-11435218 CCTTGGTACTATTGACATTTGGG - Intronic
1186648951 X:11538777-11538799 CCTTGGCACTATTGACATTTGGG + Intronic
1186681317 X:11877019-11877041 CCTTGACGTTATTGACTTTTTGG - Intergenic
1186711660 X:12204268-12204290 CTGTGGCACTATTGACATTTTGG - Intronic
1186817216 X:13249739-13249761 CCTTGGCACTATTGACATTTGGG - Intergenic
1186842067 X:13494343-13494365 CCTCGGCACTATTGACATTTGGG + Intergenic
1186842180 X:13495208-13495230 CCTTGGCACTATTGCAATTTGGG - Intergenic
1186852774 X:13596867-13596889 CCTTGGCACTACTGACATTTGGG - Intronic
1186862957 X:13691178-13691200 CCGTGGCACTAGTGACATTTTGG - Intronic
1186887567 X:13929801-13929823 CCTCAGCACTATTGACATTTTGG - Intronic
1186888954 X:13941213-13941235 CCTCGGCACTATTGACATCTGGG - Intergenic
1186898825 X:14031939-14031961 CCTTGGCACTATTCACATTTGGG + Intergenic
1186945140 X:14557830-14557852 CCTTGGGACTATTGGCATTTTGG - Intronic
1186955511 X:14677639-14677661 TTATAACACTATTAACATTTGGG + Intronic
1186963859 X:14766107-14766129 CCTTGGCACTGATGACATTTGGG - Intergenic
1186973165 X:14872447-14872469 CCTTGACACTATTGACATTTTGG + Intronic
1186976883 X:14917163-14917185 CCTCGACACTATGGGCATTTGGG - Intronic
1187015023 X:15318167-15318189 CCTCAGCACTATTGACATTTTGG + Intergenic
1187067907 X:15858542-15858564 CCTTGGCACTAGTGACATTTGGG - Intergenic
1187084212 X:16024927-16024949 CCTTAGCACTACTGACATTTAGG + Intergenic
1187124875 X:16445641-16445663 CTGTGGCACTATTGACATTTTGG - Intergenic
1187203385 X:17157661-17157683 TCTTAGCACTATTGACATTTTGG - Intergenic
1187354579 X:18555108-18555130 CCTTAGCACTTTTGACATTTGGG + Intronic
1187418544 X:19114530-19114552 CCTTGGCACTATTAATGCTTGGG + Intronic
1187452946 X:19414705-19414727 CTTTGGCACTAGTGACATTTTGG + Intronic
1187529572 X:20084226-20084248 CCTTGGCACTACTCACTTTTGGG - Intronic
1187694144 X:21901451-21901473 CCCTGGCACTATTGACATTTTGG - Intergenic
1187698989 X:21946756-21946778 CCTGGGCACTATGGACATTTTGG - Intronic
1187721390 X:22154620-22154642 CCTTGGCACTATTGACATTTGGG - Intronic
1187737188 X:22316958-22316980 CCTTGGCACTACTGACATTCTGG + Intergenic
1187737763 X:22322113-22322135 CCCGGACACTATTGACATATTGG - Intergenic
1187826851 X:23340104-23340126 CCTTGGCACTATTAACATTTGGG - Intronic
1187993028 X:24896293-24896315 CCTTGACATTATTGACTTTGGGG - Intronic
1188036778 X:25327201-25327223 CCTTGCCACTATTGACATTTGGG - Intergenic
1188041607 X:25375881-25375903 CCTTATCACTATCAGCATTTTGG - Intergenic
1188221586 X:27547235-27547257 CCATAACACTATCAGCATTTTGG + Intergenic
1188251001 X:27894162-27894184 CTTTGGCACTATTAACATTTGGG + Intergenic
1188415361 X:29926642-29926664 TCTTGTCACTACTGACATTTTGG + Intronic
1188425944 X:30046839-30046861 CTTTGGCACTATTGACATATTGG - Intergenic
1188427064 X:30061035-30061057 CCTTGGCACCATTGACACTTTGG - Intergenic
1188465622 X:30476845-30476867 CCTTGGCACTATTGATATTTTGG + Intergenic
1188548506 X:31336553-31336575 CCTGGGCACTATTGGCATTTGGG - Intronic
1189017182 X:37296456-37296478 CCTTATCACTATCAGCATTTGGG + Intergenic
1189026144 X:37396804-37396826 CTTTGACACTATTGACATTTTGG + Intronic
1189082278 X:37987371-37987393 CTTTAGCACTATTGACATTTTGG - Intronic
1189112056 X:38301780-38301802 CCTTGGCATTATTGACATTTGGG + Intronic
1189134868 X:38538102-38538124 CCTTGGCACTATTGATGTTTTGG + Intronic
1189142244 X:38619123-38619145 CCTGGACACTCTTATCACTTAGG - Intronic
1189560021 X:42182918-42182940 CCTTGACACTCTTAACCTCATGG + Intergenic
1189603011 X:42647741-42647763 CCATATCACTATCAACATTTTGG - Intergenic
1189841163 X:45079977-45079999 CTTCGATACTATTGACATTTTGG + Intronic
1189876395 X:45440916-45440938 ACTTGGCACTATTGACATTTGGG + Intergenic
1189884168 X:45523290-45523312 CCTTGGCACTATTGACATTATGG - Intergenic
1189993233 X:46614045-46614067 CCTCAACACTATTGACATTTAGG + Intronic
1190039128 X:47055000-47055022 ACTTGGCACTGTTGACATTTTGG + Intronic
1190116538 X:47629359-47629381 CCTTGTTACTATTGACATTTGGG - Intronic
1190252022 X:48734098-48734120 CCTTGGGACTGTTGACATTTTGG - Intergenic
1190562534 X:51699903-51699925 CGTTGATGCTATTGACATTTTGG + Intergenic
1190730054 X:53219991-53220013 CCTCGGCACTATTAACATTTTGG - Intronic
1190772364 X:53526088-53526110 CCATATCACTATTAGCATTTTGG - Intergenic
1191734652 X:64376349-64376371 CCATATCACTATCAACATTTTGG - Intronic
1191745492 X:64482461-64482483 CCTTGACAGTCTTTACAATTTGG + Intergenic
1191904392 X:66073629-66073651 CCTTGAAACTTTAAAAATTTAGG - Intergenic
1192139536 X:68635879-68635901 CCTCAGCACTATTGACATTTGGG - Intergenic
1192579834 X:72271784-72271806 CTTTGATACTGTTAACATTTGGG - Intronic
1192732133 X:73810962-73810984 CCTCAACAGTATTCACATTTTGG + Intergenic
1192955406 X:76064641-76064663 CCATGTCACTATCATCATTTTGG + Intergenic
1193027158 X:76856659-76856681 CCATATCACTATTAGCATTTTGG + Intergenic
1193335338 X:80281272-80281294 CCTCGATACTATTGACATTTTGG - Intergenic
1193422276 X:81295797-81295819 CCATGTCACTATCAGCATTTCGG + Intronic
1193678303 X:84483993-84484015 CCATATCACTATCAACATTTTGG + Intronic
1193988337 X:88274811-88274833 CATTATCACTATTAGCATTTTGG - Intergenic
1194019563 X:88669983-88670005 CCATATCACTATTATCATTTTGG + Intergenic
1194107878 X:89793645-89793667 CCTTATCACTATCAGCATTTGGG + Intergenic
1194212414 X:91084221-91084243 CCATATCACTATTAGCATTTTGG + Intergenic
1194219727 X:91176003-91176025 CCATATCACTATTAGCATTTTGG - Intergenic
1194226127 X:91260280-91260302 CCTAGACATTATTAACTATTAGG - Intergenic
1194274191 X:91858797-91858819 CCATTTCACTATCAACATTTTGG + Intronic
1194590713 X:95797077-95797099 CCTTATCACTATCAGCATTTTGG - Intergenic
1194745051 X:97619035-97619057 CATTGACACTATTCATAGTTGGG - Intergenic
1194971079 X:100344752-100344774 CCTTGGCAATATTGACATTTGGG + Intronic
1195142602 X:101978033-101978055 GATAGGCACTATTAACATTTTGG - Intergenic
1195210179 X:102646822-102646844 CCATATCACTATCAACATTTTGG + Intergenic
1195222663 X:102761481-102761503 CCTCAGCACTATTGACATTTTGG - Intergenic
1195401000 X:104461015-104461037 CCATGAAACTATTGACACTTGGG - Intergenic
1195574279 X:106432372-106432394 ACTTAGCACTATTAACATTTTGG + Intergenic
1195630112 X:107046794-107046816 CCTTGTCACTTTTGACTTTTGGG - Intergenic
1195765953 X:108297380-108297402 CCTTGGCACTACTGACATGTTGG + Intronic
1195853120 X:109304803-109304825 ACTTGGCACTATTGATATTTTGG + Intergenic
1196055674 X:111352225-111352247 CCCTGGCACTATTGACATTCTGG - Intronic
1196057394 X:111370509-111370531 CCTTGGCACTACTGACATTTGGG + Intronic
1196093978 X:111778348-111778370 TCTTGGCACTATTGACATGTTGG + Intronic
1196175570 X:112635999-112636021 CCTTGGCGCTATTGACATTTTGG + Intronic
1196216491 X:113058287-113058309 CCTTAACACTATTGACATTTGGG + Intergenic
1196348201 X:114693520-114693542 CCTTGGCACTATTGACATTTTGG + Intronic
1196380501 X:115084541-115084563 CCTTGATGGTCTTAACATTTTGG + Intergenic
1196562191 X:117163164-117163186 TGTTGGCACTATTGACATTTTGG - Intergenic
1197042122 X:121949639-121949661 CCATGTCACTGTTAGCATTTTGG + Intergenic
1197093723 X:122570412-122570434 AGTAGCCACTATTAACATTTTGG + Intergenic
1197128169 X:122972343-122972365 CCATATCACTATTAACATTTTGG - Intergenic
1197146343 X:123176677-123176699 CAGTGGCACTATTGACATTTGGG + Intergenic
1197153431 X:123244801-123244823 CCTTGGCAATATTGACATTTTGG - Intronic
1197155158 X:123262462-123262484 CCTTGGCACTGTTGACATCTTGG - Intronic
1197163854 X:123354143-123354165 CCTTAGCACTACTGACATTTTGG + Intronic
1197256721 X:124271486-124271508 CCCTGACACTATTGACATTTTGG + Intronic
1197330774 X:125151857-125151879 CATAGACACTATTGACATTTGGG - Intergenic
1197571945 X:128160745-128160767 CTTTGACCCTATGATCATTTGGG + Intergenic
1197581730 X:128292727-128292749 CATAGTCACTATTAACATTTTGG + Intergenic
1197815629 X:130495057-130495079 CTTTGGCACTATTAACATTTGGG - Intergenic
1198040529 X:132847244-132847266 CCTTGATGCTATTAACATTCTGG + Intronic
1198162099 X:134018124-134018146 CCTTGTCACTATTGACATTTTGG + Intergenic
1198318184 X:135490630-135490652 CCTTGGCTCTTTTGACATTTTGG - Intergenic
1198517295 X:137422476-137422498 CCTTGTCACTATGGACATTTTGG - Intergenic
1198556610 X:137799904-137799926 CCTTGGCACTATTGATATATGGG + Intergenic
1198941910 X:141965439-141965461 CCATGTCACTATCAGCATTTTGG - Intergenic
1198943626 X:141985606-141985628 CCATTTCACTATTATCATTTTGG - Intergenic
1198991637 X:142521188-142521210 CCATATCACTATTATCATTTTGG + Intergenic
1199271279 X:145885479-145885501 CCTTGGCACTATTGATATTTTGG + Intergenic
1199301809 X:146221784-146221806 CCCTATCACTATAAACATTTTGG + Intergenic
1199329636 X:146543707-146543729 CCATGTCACTATCAGCATTTTGG + Intergenic
1199349744 X:146786971-146786993 CCATAACACTATTGACATGTTGG - Intergenic
1199591804 X:149474808-149474830 CCTTGGAACTATTGCCATTTGGG + Intergenic
1199776200 X:151014002-151014024 CCTTATCACTATCAGCATTTTGG + Intergenic
1199799506 X:151235714-151235736 CCTTGGCACTATTGATGTTTTGG + Intergenic
1199923507 X:152436322-152436344 CCTCAACAATATTAACATTTTGG + Intronic
1200016621 X:153169425-153169447 CCATATCACTATCAACATTTTGG - Intergenic
1200183685 X:154167846-154167868 CCTTGGCACTGTCGACATTTTGG - Intergenic
1200189339 X:154204974-154204996 CCTTGGCACTGTCGACATTTTGG - Intergenic
1200195094 X:154242783-154242805 CCTTGGCACTGTCGACATTTTGG - Intergenic
1200200744 X:154279904-154279926 CCTTGGCACTGTCGACATTTTGG - Intronic
1200268804 X:154661939-154661961 CCATAATACTATCAACATTTTGG - Intergenic
1200283739 X:154801240-154801262 CCTGGGCACTGTTAACACTTTGG - Intronic
1200313347 X:155102898-155102920 CATTGGCACTATTGACATTTTGG + Intronic
1200459829 Y:3441430-3441452 CCTTATCACTATCAGCATTTGGG + Intergenic
1200556238 Y:4639767-4639789 CCATATCACTATTAGCATTTTGG - Intergenic
1200591427 Y:5080204-5080226 CCATTTCACTATCAACATTTTGG + Intronic
1200839696 Y:7768423-7768445 CCTTGGTACTATTGACATTTTGG - Intergenic
1201253027 Y:12079837-12079859 CTTTGGCACTGTTGACATTTGGG + Intergenic
1201320404 Y:12692440-12692462 CCTTGGCACTGTTACCATTTTGG - Intergenic
1201508883 Y:14735755-14735777 CCGTATCACTATTAGCATTTTGG - Intronic
1201577277 Y:15474686-15474708 CCTTGGCACTATTGACACTTGGG + Intergenic
1202248592 Y:22844714-22844736 GGTTGACACTTTTAACTTTTAGG - Intergenic
1202401580 Y:24478462-24478484 GGTTGACACTTTTAACTTTTAGG - Intergenic
1202469201 Y:25191621-25191643 GGTTGACACTTTTAACTTTTAGG + Intergenic