ID: 1101377728

View in Genome Browser
Species Human (GRCh38)
Location 12:104185168-104185190
Sequence ACCTTGACACTATTAACATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 2, 1: 9, 2: 53, 3: 160, 4: 442}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101377728_1101377730 7 Left 1101377728 12:104185168-104185190 CCAAATGTTAATAGTGTCAAGGT 0: 2
1: 9
2: 53
3: 160
4: 442
Right 1101377730 12:104185198-104185220 CCCTGATGCAGATGAAGAAAAGG No data
1101377728_1101377734 18 Left 1101377728 12:104185168-104185190 CCAAATGTTAATAGTGTCAAGGT 0: 2
1: 9
2: 53
3: 160
4: 442
Right 1101377734 12:104185209-104185231 ATGAAGAAAAGGGGTGCTTAAGG No data
1101377728_1101377733 9 Left 1101377728 12:104185168-104185190 CCAAATGTTAATAGTGTCAAGGT 0: 2
1: 9
2: 53
3: 160
4: 442
Right 1101377733 12:104185200-104185222 CTGATGCAGATGAAGAAAAGGGG No data
1101377728_1101377732 8 Left 1101377728 12:104185168-104185190 CCAAATGTTAATAGTGTCAAGGT 0: 2
1: 9
2: 53
3: 160
4: 442
Right 1101377732 12:104185199-104185221 CCTGATGCAGATGAAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101377728 Original CRISPR ACCTTGACACTATTAACATT TGG (reversed) Intergenic
900095942 1:940166-940188 ATTTTTACATTATTAACATTTGG - Intronic
901254728 1:7812826-7812848 ATCTTGATTTTATTAACATTTGG + Intronic
901268603 1:7932845-7932867 ACCTCAGCACTATTGACATTTGG + Intronic
901487881 1:9577889-9577911 CCCTTGGCGCTATTCACATTTGG - Intronic
901869384 1:12128648-12128670 CCCTTGGCACCATTGACATTTGG + Intronic
902080036 1:13814522-13814544 ACATTGACACTGTCAGCATTTGG + Intronic
902158771 1:14512285-14512307 ACCTTAGCACTATTGATATTTGG + Intergenic
902178465 1:14669386-14669408 ACCTTGGCACTGTGGACATTTGG - Intronic
902261406 1:15227414-15227436 ACCTCCACACTAGTGACATTTGG - Intergenic
902365125 1:15968094-15968116 ACCTTGACACTTCTGACATTTGG - Intronic
902718569 1:18289623-18289645 ACCTGGGCACTGTTGACATTTGG + Intronic
902852878 1:19175136-19175158 ACCTTAACAATATTGACATCTGG + Intronic
902888229 1:19422328-19422350 GCCTTAACTCTATTAACGTTTGG - Intronic
903087073 1:20871292-20871314 ACCTCAACACTACTGACATTTGG + Intronic
903562001 1:24235177-24235199 ACCTTGGCACTATTGACATTTGG - Intergenic
905879630 1:41455129-41455151 ACCTTGGCACTATTGACATTGGG + Intergenic
908330222 1:63063655-63063677 GTCTTGACACTACTGACATTTGG - Intergenic
908456335 1:64308394-64308416 AGCTTGACACTATTGATATTTGG - Intergenic
908507519 1:64819781-64819803 ATCTTGGTACTATTAACGTTTGG + Intronic
909071941 1:71005184-71005206 ACCTTGGCACTATTGACACATGG - Intronic
910447844 1:87317134-87317156 ATCTAGGCACTTTTAACATTTGG + Intergenic
910694447 1:89996570-89996592 ACCTTTAAACTATGAATATTTGG + Intronic
910844383 1:91591535-91591557 ACATTGACACTGTTTACACTCGG + Intergenic
910879474 1:91909892-91909914 ACCTTGTTACTAATAACACTAGG + Intergenic
911775250 1:101802564-101802586 ACCTTGACAGTTTCAAGATTGGG + Exonic
912261482 1:108115085-108115107 ACCTTGGCACTACTGACTTTGGG - Intergenic
912701984 1:111884858-111884880 ATCTTGGCACTATTGACATTGGG + Intronic
913134509 1:115874844-115874866 ACTTCCACACTATTGACATTTGG - Intergenic
913575860 1:120174089-120174111 CCCTTGGCACTGTTGACATTTGG - Intronic
914322815 1:146581660-146581682 ACCCTGGCACTGTTGACATTTGG + Intergenic
914558174 1:148789660-148789682 CCCTTGGCACTGTTGACATTTGG - Intergenic
914614660 1:149340570-149340592 CCCTTGGCACTGTTGACATTTGG + Intergenic
915366551 1:155320166-155320188 ACCTTGGCACTATTGAAATTTGG - Intronic
915394444 1:155572119-155572141 ACCTCAACACTGTTGACATTTGG + Intergenic
917275919 1:173332053-173332075 ACCTTATCACTATTGGCATTTGG - Intergenic
917862510 1:179160757-179160779 ACCATGACACTATTGACATTTGG + Intronic
918874456 1:190021599-190021621 ATCATGACACTATTCACATTAGG + Intergenic
918910771 1:190565666-190565688 ACATTGGCACTTTTAACCTTTGG + Intergenic
919500696 1:198334637-198334659 ACCTCAACAATATTGACATTTGG - Intergenic
920708361 1:208271880-208271902 ACAGTGGCACTATTGACATTTGG - Intergenic
1062888860 10:1040407-1040429 AACTTGACACTGTTGACATTTGG - Exonic
1065274374 10:24070627-24070649 ACCCTGAGACTTTTAACTTTTGG - Intronic
1067971702 10:50978522-50978544 ACCTCAGCACTATTCACATTTGG - Intergenic
1069493297 10:68880020-68880042 ACTTTGGCACTTTTGACATTTGG - Intronic
1071142568 10:82527890-82527912 ACCTAGATGCTATTGACATTTGG + Intronic
1071386228 10:85124070-85124092 GGCTTGGCACTATCAACATTTGG + Intergenic
1071445515 10:85742892-85742914 AACCTGACACTATTGGCATTTGG + Intronic
1071842325 10:89485291-89485313 ACCTTGTCACTGTTGACATTTGG - Intronic
1074501179 10:114026306-114026328 ACCTCAGCACTATTGACATTTGG + Intergenic
1074614164 10:115049632-115049654 ACTTTGGCACTATTGATATTTGG - Intergenic
1074696754 10:116056742-116056764 ACCTTGGTACTATTGACACTCGG - Intergenic
1074788826 10:116865789-116865811 GCCTTGGCGCTATTGACATTTGG - Intronic
1075220209 10:120578079-120578101 ACCTGGGCAGTATTGACATTTGG - Intronic
1075475684 10:122731401-122731423 AACCTCACACTATTGACATTTGG - Intergenic
1075931572 10:126301177-126301199 GCGATGACACTGTTAACATTTGG - Intronic
1076030358 10:127152569-127152591 ACCTCAGCACTATTGACATTTGG + Intronic
1076095641 10:127733419-127733441 ACCTCAGCACTATTGACATTTGG - Intergenic
1076770733 10:132662808-132662830 CCCTTGACACAATTTACACTTGG - Intronic
1077276320 11:1711525-1711547 ATCTTGACATTATCAGCATTTGG - Intergenic
1079010347 11:16822882-16822904 ACCTGGAGAGTTTTAACATTTGG - Intronic
1079362511 11:19780831-19780853 AACTTGGCACTATTGACTTTTGG - Intronic
1080079056 11:28192812-28192834 ATCTTGGCACTACTGACATTTGG - Intronic
1080168681 11:29272133-29272155 ACCTCGGCACTATTGACATTTGG + Intergenic
1080405598 11:31976114-31976136 ACCTTGGCACTATTGACATTTGG + Intronic
1080430073 11:32189811-32189833 ACCTCGGCACTATTGGCATTTGG - Intergenic
1080773704 11:35366027-35366049 ACCTCAGCACTATTGACATTTGG - Intronic
1081383464 11:42443956-42443978 ACCTTGGCATTTTTGACATTTGG - Intergenic
1081531985 11:43968190-43968212 ACCTTGGCACTATTGACATTTGG - Intergenic
1081722480 11:45300521-45300543 ACCTTGGCACTACTGACATTTGG - Intergenic
1082692037 11:56317914-56317936 ACCTTAGCACTATTGATATTTGG + Intergenic
1082699312 11:56408509-56408531 AACTTGACACATTTAACATACGG - Intergenic
1082866116 11:57901676-57901698 GCCTTGACACTACTGACATATGG - Intergenic
1083987615 11:66226542-66226564 ACCTTGGCACGATTGACATTTGG - Intronic
1084206429 11:67597172-67597194 ACCTTGACACTATGGCCATTTGG - Intergenic
1084622689 11:70283911-70283933 ACCTGGACACTTCCAACATTTGG - Intronic
1085567627 11:77528942-77528964 ACCTTTGCATTATTAACAGTGGG - Intronic
1085571227 11:77559582-77559604 ATCTTGGCACTAATAGCATTTGG + Intronic
1085578494 11:77628852-77628874 ACCTTGGCACTACTGACATTTGG + Intronic
1087157628 11:94920337-94920359 ACCTCAACACTGTTGACATTTGG - Intergenic
1087195754 11:95302841-95302863 ACTTTGACACTGTTGACATTTGG + Intergenic
1087240572 11:95771947-95771969 ACCTTTTCCCTATTAAAATTTGG - Intronic
1091656620 12:2351099-2351121 GCCTTGGCCCTATTGACATTTGG + Intronic
1092797662 12:12129305-12129327 GCCTAGACAATATTAACAATGGG - Intronic
1092856577 12:12679734-12679756 ACCTTAGCACTATTGGCATTTGG - Intronic
1095682604 12:44996487-44996509 ACCTTGACATTACTGAAATTTGG + Intergenic
1095734299 12:45539811-45539833 ACCTTGGCATTATTAACATTTGG + Intergenic
1095781038 12:46059775-46059797 TCCTTGATTCTCTTAACATTAGG - Intergenic
1096050127 12:48600207-48600229 ACCCTTACACTATTATCAGTAGG + Intergenic
1097355060 12:58591916-58591938 ACCTTGAGACTATTTTGATTTGG + Intronic
1097612284 12:61838951-61838973 ACCTTGGCACTATTGATATTTGG - Intronic
1097936794 12:65261676-65261698 GCCCTGGCACTAGTAACATTAGG - Intergenic
1098202666 12:68072952-68072974 ACCTTGGCTCTACTGACATTTGG + Intergenic
1098423807 12:70335985-70336007 ACCTCCACACTGTTGACATTTGG + Intronic
1099633439 12:85179868-85179890 ACCTTGAAAAGATTAACAGTTGG - Intronic
1099671321 12:85697233-85697255 ACCTAAGCACTATTGACATTTGG + Intergenic
1099950557 12:89297462-89297484 AACTTGAAACTATTAACAAAGGG + Intergenic
1100174009 12:92008881-92008903 ACTTTGACACCACTGACATTTGG + Intronic
1100960212 12:99954827-99954849 ACCTTGGTACTATTGACATTTGG - Intronic
1101012828 12:100468815-100468837 ACTTTGGCACTATTGACATTTGG + Intergenic
1101110025 12:101477437-101477459 ATCTTGACACTATGGGCATTTGG - Intronic
1101209667 12:102523414-102523436 ACCTTGGCACTATTGACATTTGG - Intergenic
1101209768 12:102524216-102524238 ACCTTGGCATTATTCACATTTGG + Intergenic
1101377728 12:104185168-104185190 ACCTTGACACTATTAACATTTGG - Intergenic
1101451948 12:104787776-104787798 CCCTTGAGAATATTAACAGTAGG - Intergenic
1101499887 12:105293647-105293669 ATCTTTACACTTTTAACTTTGGG - Intronic
1101633391 12:106517126-106517148 AGCTTGGCACTACTCACATTTGG + Intronic
1102214286 12:111149394-111149416 ACCTTGACACTTTTGACATTTGG + Intronic
1102624315 12:114222344-114222366 ACCTGGGCTCTATTGACATTGGG - Intergenic
1102637123 12:114334276-114334298 ACCTCAACACTATTGACATTTGG + Intergenic
1102791773 12:115652334-115652356 ACCTTGGCACTGTTGACATTTGG - Intergenic
1102819182 12:115893584-115893606 ACCTGGGCACTATTGACATTGGG - Intergenic
1102976319 12:117209377-117209399 ACCTTAGCACTATTGGCATTTGG - Exonic
1103009016 12:117443496-117443518 ACCTTGGCCCTGTTAACATTTGG + Intronic
1103013914 12:117479419-117479441 ACCTTGGCACTATTGACATTTGG + Intronic
1103025485 12:117570424-117570446 ACCTTGGCACTATTGGCATTTGG - Intronic
1103054677 12:117809275-117809297 ACTTTGACATTGTTAACTTTTGG + Intronic
1103057868 12:117835785-117835807 ACCTTGGCACTGTTGACATTTGG - Intronic
1103064972 12:117889908-117889930 ACCTTGGCACTACTGATATTCGG - Intronic
1103287760 12:119816973-119816995 GCCTTGGCACTGTTGACATTTGG - Intronic
1103673264 12:122635677-122635699 ACCTTGACACCATAAACAGGTGG + Intergenic
1105271621 13:18881445-18881467 ACCTGCACACTATTATTATTGGG + Intergenic
1107364019 13:39650886-39650908 ACTTTGGCACCATTGACATTTGG - Intergenic
1107866478 13:44708054-44708076 ACTTTGGCACTATGGACATTTGG - Intergenic
1108086563 13:46799303-46799325 ACCTCGGCACTGTTGACATTTGG + Intergenic
1108822783 13:54374357-54374379 ACCTTGGCACTATTGACATTTGG + Intergenic
1109064573 13:57670369-57670391 ATTTTGAAACTATTAAAATTAGG - Intronic
1109263405 13:60169606-60169628 ACCTTGGCACCATTGACATTTGG + Intergenic
1109645588 13:65250544-65250566 ACCTTGATACTATTGCCATTTGG + Intergenic
1110414119 13:75233950-75233972 ACCTTGGCGCCATTGACATTTGG + Intergenic
1110830719 13:80027449-80027471 ATTTTGACACTATTAACAGAAGG + Intergenic
1111205646 13:85006509-85006531 ACCTTAACACTATTGAGATTTGG + Intergenic
1112026854 13:95419254-95419276 ACCTTGGCACTATTGACATTTGG - Intergenic
1112352754 13:98650309-98650331 ACCTTGGCACTATTGACACTTGG - Intergenic
1112359580 13:98705342-98705364 TCCTTGGCACTGTGAACATTTGG + Intronic
1113018905 13:105859969-105859991 ACTCTGAGACTATTAACAGTAGG + Intergenic
1113031602 13:105999496-105999518 ACCTTGGCTGTATTGACATTTGG + Intergenic
1113127442 13:106995465-106995487 ACTTTGGCATTATTAACATTTGG - Intergenic
1114141646 14:19918200-19918222 ACTTTGGCATTATTGACATTTGG - Intergenic
1114645809 14:24255501-24255523 ACCTTGTCACTATTCACCTGTGG + Exonic
1114800193 14:25765433-25765455 ACTTTGACAATATAAAAATTAGG - Intergenic
1115417392 14:33152191-33152213 ACCTTGGTACTACTGACATTTGG - Intronic
1115898784 14:38121184-38121206 ATCTTGAAATTTTTAACATTGGG - Intergenic
1116182092 14:41547745-41547767 ACCTTGGCGCTATTAACATTTGG + Intergenic
1116837609 14:49786226-49786248 ACTTTGGCACTATTAACATTAGG - Exonic
1116892493 14:50282268-50282290 ATCCTGACACTATTGATATTGGG - Intronic
1117007877 14:51440919-51440941 ACCCTGGCACTATTAAGATTTGG + Intergenic
1117515128 14:56493096-56493118 ATATTGGCACTATTGACATTTGG - Intronic
1117675361 14:58150535-58150557 ACCTTTACAATATTATAATTTGG - Intronic
1118343510 14:64916068-64916090 ACCTCCACACTATTGACATTGGG - Intronic
1118575642 14:67239458-67239480 TCCTTGGCACTATTGACATTTGG - Intergenic
1120870203 14:89329901-89329923 GCCTTGGTACTATTGACATTTGG - Intronic
1121002280 14:90460474-90460496 ACCTTGACACTCCTCGCATTGGG - Intergenic
1121080570 14:91104490-91104512 ACTGTGACACTACTGACATTTGG - Intronic
1121238944 14:92414147-92414169 ACCTGGACACTATTGGCATCGGG + Intronic
1121366842 14:93320436-93320458 ACCTTGGCACTCTTGACATTTGG - Intronic
1121603442 14:95223204-95223226 GCCTTGGCACTGTTGACATTTGG - Intronic
1121854752 14:97256941-97256963 AGCTCAACACTATTGACATTTGG - Intergenic
1121979657 14:98443749-98443771 ACCTCAGCACTATTGACATTTGG + Intergenic
1122045700 14:99021648-99021670 GCCTTGACACTGTTGACGTTTGG + Intergenic
1125222991 15:37361287-37361309 ACATTCACATTATAAACATTTGG + Intergenic
1125464950 15:39941671-39941693 ACCTTGGCACTACTGACATGTGG + Intronic
1125467093 15:39964560-39964582 ACCTTGACACTATGACATTTTGG - Intronic
1126253928 15:46602344-46602366 ACTTTAACATTATTAACATGTGG + Intergenic
1127692547 15:61412382-61412404 GCCTTAGCACTATTGACATTTGG + Intergenic
1128673896 15:69594983-69595005 ACCTTGGCATTGTTAACAATTGG + Intergenic
1128739332 15:70072829-70072851 ACCTTGACACTGTTGAAATTTGG - Intronic
1129911295 15:79228934-79228956 ACCTTGACACTATTGACATTTGG - Intergenic
1129929838 15:79401601-79401623 ATCTTGGCACTATTGACATTTGG - Intronic
1130534982 15:84777995-84778017 GCCTAGATACTTTTAACATTTGG + Intronic
1131018982 15:89081982-89082004 ACCTCAGCACTATTGACATTTGG + Intergenic
1131870422 15:96758037-96758059 ACCAAGAGACCATTAACATTTGG - Intergenic
1132277423 15:100581225-100581247 ACTTTGGCACTATTAATATTTGG + Intronic
1132308415 15:100835992-100836014 ACCTTGAAGCTATTCAAATTAGG + Intergenic
1133151106 16:3831455-3831477 ACTTTTCCAATATTAACATTTGG - Intronic
1133478442 16:6146392-6146414 ACCTCAACACTATTGACATTTGG + Intronic
1133594701 16:7280338-7280360 ACCCTAAGACTATTAACAGTAGG + Intronic
1133619574 16:7513494-7513516 ACCTTGGCACTATTAACATTTGG + Intronic
1133711661 16:8407436-8407458 ACCTTGGCACTATTGAAATTTGG - Intergenic
1133850594 16:9499724-9499746 ATCTTGGCACTATTGACACTTGG - Intergenic
1133934452 16:10257274-10257296 ACCTTGGAACTGTTGACATTTGG + Intergenic
1133954270 16:10426754-10426776 AACTTGACTATATTAAAATTAGG + Intronic
1134124574 16:11607756-11607778 ACCTTGGCACTATTAGTATTTGG + Intronic
1134389082 16:13802084-13802106 GACTTGACCCTATTGACATTTGG - Intergenic
1134395735 16:13861207-13861229 ATCTTGGCACTATTGACATCTGG - Intergenic
1134779358 16:16881828-16881850 ATCTTGGCATTATCAACATTTGG + Intergenic
1134788418 16:16965615-16965637 ACGTCCACACTATTGACATTTGG - Intergenic
1134872154 16:17661713-17661735 ACCTTGGCACTTTTGACATTTGG - Intergenic
1135294943 16:21271082-21271104 ACCTCGGTACTACTAACATTTGG + Intronic
1135336837 16:21608749-21608771 GCCTTCACACTACTGACATTTGG - Intronic
1135392745 16:22107405-22107427 ACTTTGGCACTATTGACATTTGG - Intronic
1135484500 16:22852213-22852235 ACCTCAGCACTATTGACATTTGG - Intronic
1135597845 16:23756840-23756862 ATCTTGGCACTGTTGACATTTGG - Intronic
1135615372 16:23907055-23907077 ACCTTGGCATTATTGACATTGGG + Intronic
1135742240 16:24985757-24985779 GCCTTGGCACTGTTGACATTTGG - Intronic
1135783104 16:25323550-25323572 ACCTTGATGCTATGGACATTCGG - Intergenic
1135855416 16:26005803-26005825 ACTCTGGCACTATTACCATTTGG + Intronic
1136014033 16:27383522-27383544 ACCTTGATAGTGTTGACATTTGG - Intergenic
1136107358 16:28039474-28039496 ACTTTGGCCCTGTTAACATTTGG - Intronic
1136134192 16:28244727-28244749 ACTTTGTCACTGTTGACATTTGG - Intergenic
1137712488 16:50575987-50576009 ACCTTGGCACTGTTTACATTTGG - Intronic
1137783807 16:51120904-51120926 ACCTCGGCACTATTGACCTTTGG + Intergenic
1139187498 16:64823916-64823938 ACCTTCACAATATTATCATGTGG + Intergenic
1139283988 16:65794409-65794431 ACCTTGGCAGTTTTAACATTTGG - Intergenic
1140010746 16:71129190-71129212 ACCCTGGCACTGTTGACATTTGG - Intronic
1140053178 16:71501227-71501249 ACCTTGGCTCTATAGACATTTGG - Intronic
1140401298 16:74674071-74674093 GCCCTTACACTATTGACATTGGG + Intronic
1140632570 16:76871849-76871871 ACCTTGGCACTGTTGACCTTTGG + Intergenic
1140932425 16:79640192-79640214 ATCTTGGCATTATTGACATTTGG - Intergenic
1140953314 16:79839611-79839633 ACCTTGGCACTCTTGACATTTGG + Intergenic
1140971196 16:80014449-80014471 ACCTCAGCACTATTGACATTTGG + Intergenic
1140999763 16:80297390-80297412 ACCTTGGCACTATTGACATTTGG + Intergenic
1141022483 16:80510430-80510452 ACCTCAACACTACTGACATTTGG + Intergenic
1141057792 16:80834610-80834632 ACCTTGGCACTATTGGCATTTGG + Intergenic
1141150088 16:81558564-81558586 ACCTGGGCACTGTTGACATTTGG - Intronic
1141218928 16:82050832-82050854 ATCTTGGCACTATTGACATTTGG + Intronic
1141229414 16:82150745-82150767 CCCTTGGCAGTGTTAACATTTGG - Intronic
1141365205 16:83436123-83436145 ACCTTGCCACTGGTGACATTTGG - Intronic
1141586945 16:85040343-85040365 ACAATGACACTGTTAATATTTGG - Intronic
1141664939 16:85461172-85461194 ACCTTGGGACTGTTGACATTTGG + Intergenic
1142401193 16:89859605-89859627 ACCTAGACATAATTAACTTTGGG + Intronic
1142671682 17:1490644-1490666 ACCTTCACTCTATGAACATGAGG - Intronic
1144423741 17:15121703-15121725 ACCTTGATCCCATTAACATTGGG + Intergenic
1144477309 17:15599420-15599442 ACCTTGGCACTATTGCCATCTGG - Intronic
1144920930 17:18763949-18763971 ACCTTGGCACTATTGCCATCTGG + Intronic
1145772459 17:27503383-27503405 AACCTTGCACTATTAACATTTGG - Intronic
1146331592 17:31932184-31932206 AACTTGACACTAATAACCTGGGG - Intergenic
1146451069 17:32974479-32974501 ACCTTGCCACGACTGACATTTGG + Intronic
1146702244 17:34971266-34971288 CCCTCTACACTATTGACATTTGG + Intronic
1147248914 17:39140798-39140820 ACCTCGGTACTATTGACATTTGG + Intronic
1147640669 17:41997019-41997041 ACCTTGACACTACTGACATTTGG - Intronic
1147753493 17:42752443-42752465 AACATGACACTAGTAACATATGG - Intergenic
1148208733 17:45795401-45795423 ACCTCAGCACTATTGACATTTGG + Intronic
1149200790 17:54183611-54183633 ACTTCAGCACTATTAACATTTGG + Intergenic
1149246144 17:54710822-54710844 ACCTAGGCAATATTATCATTCGG + Intergenic
1149266973 17:54937530-54937552 ACCTACACACTATTATCATTGGG + Intronic
1149329158 17:55563868-55563890 AACTTAACAATATTAAGATTAGG + Intergenic
1149347462 17:55752472-55752494 ACCTTGGCAATATTACAATTTGG - Intronic
1149497635 17:57129862-57129884 ATCTTGAGACTACTAACATAGGG + Intergenic
1149502299 17:57162972-57162994 ACCTTGACCATTTTAACATTTGG + Intergenic
1149879073 17:60269599-60269621 AACATGTCATTATTAACATTAGG - Intronic
1149999594 17:61425484-61425506 AACTCGACACTACTGACATTTGG - Intergenic
1150723899 17:67636317-67636339 GCCTTGGCACTATGGACATTTGG - Intronic
1151124720 17:71832389-71832411 ACCTTGGCACCATTGACATTTGG - Intergenic
1152187790 17:78869012-78869034 ATCTCAGCACTATTAACATTTGG - Intronic
1154007887 18:10548730-10548752 ATCTCAACACTGTTAACATTTGG + Intronic
1156362231 18:36393340-36393362 ACCTTGACACAATTGACATTTGG + Intronic
1156452029 18:37272210-37272232 ACTTTGACACTATTACCATCTGG + Intronic
1157601570 18:48896404-48896426 GCCTAGACATTATTGACATTTGG - Intergenic
1157735967 18:50049578-50049600 GCCTTGTCACTGTTAACATCTGG + Intronic
1157882227 18:51331427-51331449 ACCTTGGCACTATTGGCATTTGG + Intergenic
1158163180 18:54508742-54508764 ACTTTACCACTATTGACATTTGG + Intergenic
1158501428 18:58005601-58005623 TCCTTGGCACTACTGACATTTGG - Intergenic
1158902233 18:61974584-61974606 GCCTTGGCACTATTGCCATTGGG - Intergenic
1159655466 18:71026923-71026945 ACTTTGCGACTATTACCATTAGG + Intergenic
1159722100 18:71903794-71903816 ACCTTAGCGCTATTAACTTTTGG - Intergenic
1159952353 18:74494481-74494503 ACCTTGAGCCTATTAAATTTTGG + Intergenic
1161143551 19:2663834-2663856 ATCTTGACACTATTAAACTGGGG + Intronic
1161525884 19:4754937-4754959 ATCTCGGCACTAATAACATTTGG + Intergenic
1161751419 19:6100004-6100026 ACCCTGGCACTATTGACATTTGG - Intronic
1161894536 19:7070139-7070161 ACCTGGGCACTAATGACATTTGG - Intronic
1162059799 19:8087527-8087549 CGCTTGACACTATGAACATTTGG + Intronic
1162190538 19:8942356-8942378 ACTTTGACACTATTGTCATTTGG - Intronic
1162780461 19:13004196-13004218 ACCTTGGCACTACTGACATTTGG - Intronic
1162891048 19:13733329-13733351 ACCTTGGCACTACTGGCATTCGG + Intronic
1163382790 19:16979763-16979785 ACCTTGGCACTATCAACATTTGG - Intronic
1163857691 19:19717805-19717827 ACCTTACCACTATTGTCATTAGG + Intronic
1164474496 19:28564784-28564806 ACCGTGACACTTTCAGCATTTGG + Intergenic
1166736035 19:45085531-45085553 GTCTGGACACTATTGACATTTGG - Intronic
1167534975 19:50044214-50044236 AACTTGGCACTATTTTCATTTGG - Intronic
1167582524 19:50354387-50354409 ACCTTGACACTATTGACATTTGG - Intronic
1168522308 19:57062149-57062171 ACCTCGGAACTATTGACATTTGG + Intergenic
926864664 2:17343934-17343956 ACCTGGACACTCTTATCCTTCGG + Intergenic
927366456 2:22302603-22302625 CCCTCAACACTATTGACATTTGG + Intergenic
928227498 2:29464819-29464841 ACTTTGTCACTATTAACACTTGG - Intronic
928281134 2:29947348-29947370 ACCTTGACACTATTAAGGGAGGG + Intergenic
928592143 2:32828005-32828027 ACCATGACACTGTTGGCATTTGG + Intergenic
928811155 2:35228234-35228256 ACCATGCCACTATTGACATTTGG + Intergenic
928855084 2:35793361-35793383 TTCTTGACACTCTTAAAATTAGG + Intergenic
931000402 2:57773866-57773888 ACCTTGGCACTATTAAAATTTGG - Intergenic
932083533 2:68737390-68737412 ACCTAGATACCATTGACATTTGG + Intronic
932985078 2:76716267-76716289 ACCTTGGCACTGTTGACATTTGG - Intergenic
933225556 2:79744887-79744909 ACATTGACTCTATAAACGTTAGG - Intronic
933774321 2:85762750-85762772 TCCTTGGCACTATCGACATTTGG + Intronic
933842575 2:86299277-86299299 GCCTTGGCACTACTGACATTTGG + Intronic
935036248 2:99377378-99377400 GCCTTGGCACTATTAAAATTTGG + Intronic
935283666 2:101544300-101544322 GCATTGACCCTATTATCATTAGG + Intergenic
935827019 2:106962208-106962230 ACCTTGGCACTATAGACGTTTGG - Intergenic
936690108 2:114876785-114876807 ATCTTGGAACTATTGACATTTGG + Intronic
937278564 2:120702135-120702157 ACCTTGGCACTGTTGGCATTGGG + Intergenic
938925629 2:136038984-136039006 ACCTTGGCACTATTGATATTTGG + Intergenic
939258211 2:139772583-139772605 ACGTTAACACTGTTAACAATTGG - Intergenic
941213226 2:162669766-162669788 ACCTCAGCACTATTGACATTTGG - Intronic
941766474 2:169302590-169302612 ACCTTCACACTAATGACATTTGG - Intronic
942721698 2:178960150-178960172 ACCTTGGCACTATTGGCATTTGG - Intronic
943467964 2:188253938-188253960 ACCTTGGCACTATTGACATTTGG + Intergenic
944521887 2:200578918-200578940 ACCTTGGCACTGTTGACCTTTGG + Intronic
945661413 2:212689933-212689955 AGATTACCACTATTAACATTTGG + Intergenic
946453461 2:219800838-219800860 ACCTTGACATTCATGACATTTGG - Intergenic
946697146 2:222371418-222371440 GCCTTGGCAATATTGACATTTGG + Intergenic
947239633 2:227979747-227979769 AACTTGGCACTATTGACATTTGG - Intergenic
947831169 2:233142836-233142858 ACCTCGACACTGGTGACATTTGG + Intronic
948421844 2:237864714-237864736 ACCCTGGCACTATGGACATTTGG - Intronic
1169675047 20:8143865-8143887 ACCCTGGCACCATTGACATTTGG + Intronic
1169977578 20:11347476-11347498 ACCTTGCCACTATTGACACTTGG + Intergenic
1170371400 20:15652572-15652594 CAGTGGACACTATTAACATTTGG + Intronic
1172041658 20:32050951-32050973 AATTTGGCACTATTGACATTTGG - Intergenic
1172608901 20:36234769-36234791 ACCTTGGCACTATTGACATTTGG - Intergenic
1173625749 20:44471714-44471736 ACATTAGCACTATTGACATTTGG - Intergenic
1173708329 20:45131510-45131532 ACCTTGGCACTATTGACATTGGG - Intergenic
1173865718 20:46311529-46311551 ACTTTGGCCCTATTGACATTTGG + Intergenic
1173941005 20:46911197-46911219 ACTTTGGCACTATTAAGATTTGG + Intronic
1174176464 20:48648483-48648505 CCCTTGACACTGGTGACATTTGG - Intronic
1174204725 20:48829935-48829957 ACCTTGGGACTATTGACATTTGG + Intergenic
1174275822 20:49403418-49403440 ACCGTGGTACTATTAGCATTGGG - Intronic
1174288647 20:49490721-49490743 ATCTTGCCACTATTGACATTTGG - Intergenic
1174498751 20:50968626-50968648 ACCTCGACACAATTGACGTTGGG - Intergenic
1174510316 20:51046310-51046332 GCCTTGGCACTCTTGACATTTGG - Intergenic
1174565001 20:51458207-51458229 ACCTTGACACTATTGCCATTTGG + Intronic
1174588866 20:51629460-51629482 ACCTCGTCACTGTGAACATTTGG + Intronic
1174590408 20:51640445-51640467 ACCTCAGCACTATTGACATTTGG - Intronic
1174607789 20:51773491-51773513 ACCTTGGCACTATTGACATTTGG + Intergenic
1174672143 20:52318366-52318388 ACCTTGACACTGTTGACTTTTGG + Intergenic
1174750291 20:53105288-53105310 ACCTTGGCACTGCTGACATTAGG + Intronic
1174763306 20:53228487-53228509 ACCTTGGCGCTATTGAGATTCGG + Intronic
1174784996 20:53424006-53424028 ACTTTGGCACTATTGACATTTGG - Intronic
1174840505 20:53896986-53897008 ATCATGGCACTATTGACATTTGG - Intergenic
1174912635 20:54623289-54623311 ACCTTGGCCCTATTGACATTTGG - Intronic
1175019151 20:55825996-55826018 GCCTTGGCACTATTGACTTTTGG - Intergenic
1175069633 20:56322366-56322388 ACCTGGGCACTATTGACATCTGG + Intergenic
1175270555 20:57730932-57730954 ACGTTGGCACTATTGGCATTTGG + Intergenic
1175373992 20:58512528-58512550 ACCTCGCCGCTATTGACATTTGG - Intronic
1175620112 20:60436514-60436536 GCCTTGATACTATTAATAATAGG + Intergenic
1177013338 21:15754428-15754450 ACTTTGAAATGATTAACATTTGG + Intronic
1178476305 21:32940223-32940245 ACCTTGGCACCACTGACATTTGG - Intergenic
1178761594 21:35408132-35408154 ACGCTGGCACTATTGACATTTGG + Intronic
1178819552 21:35962767-35962789 ACCTTGACACTATTGGCATTTGG + Intronic
1178822045 21:35984243-35984265 ACCTCAGCACTATTGACATTTGG + Intronic
1178902404 21:36607746-36607768 ACCTTGGCATTATTGACATTTGG - Intergenic
1178905882 21:36635615-36635637 ACCTTGGCACTATTGAGATTTGG - Intergenic
1179284313 21:39963566-39963588 ACCTTGGCACTGCTGACATTTGG - Intergenic
1179597448 21:42452332-42452354 GCCTTGGCACTATTGACATTTGG + Intergenic
1179966874 21:44812380-44812402 AACTTTTCACTTTTAACATTGGG + Intronic
1181741450 22:24924764-24924786 ACCTCGACATTACTGACATTTGG + Exonic
1181781630 22:25197947-25197969 ACCTTGACACTACTGCCATTTGG - Intergenic
1181850482 22:25746421-25746443 GCGTAGACACTATTGACATTTGG + Intronic
1181909010 22:26223011-26223033 ACCTAGGCGCTATTGACATTTGG - Intronic
1181952254 22:26563048-26563070 ACCTTGGCACTAGTGACATTTGG - Intronic
1182012346 22:27011418-27011440 ACCTTGGCACTATTGACATTTGG + Intergenic
1182381973 22:29898303-29898325 ACCTGCACACTATTATTATTGGG - Intronic
1182674602 22:32028776-32028798 AAATTGTCACTGTTAACATTTGG - Intergenic
1182919429 22:34065668-34065690 ACCTTGGCACTGTTGACATTGGG - Intergenic
1182966980 22:34531494-34531516 ACCTTGGCACTATTGACATTTGG + Intergenic
1183150154 22:36030472-36030494 ACCTCCGCACTATTGACATTTGG - Intergenic
1183258887 22:36781457-36781479 ACCTCGGCACTATTGACATTTGG + Intergenic
1183769599 22:39912625-39912647 ACCTTGTCACTATTGACATTTGG - Intronic
949176536 3:1069701-1069723 ACTTTGGCACCATTGACATTTGG - Intergenic
949269722 3:2200569-2200591 ACCTTGGCACTATTGACCTTTGG - Intronic
949368230 3:3306387-3306409 ACCTTGCCACTATTGACATTTGG - Intergenic
949390520 3:3557334-3557356 ACCTTTTCACTATTGACATTTGG + Intergenic
949402967 3:3684539-3684561 ACCTTGGCATTATTGAGATTTGG - Intergenic
949539147 3:5018712-5018734 ACCTTGGCACTACTGACATTTGG + Intergenic
949854711 3:8450961-8450983 ACTTTGACACTACTGACATTTGG - Intergenic
950711533 3:14816317-14816339 AGCTTCACACTGTCAACATTGGG - Intergenic
950924691 3:16728875-16728897 ACCTTGTTACTCTTGACATTTGG + Intergenic
951466578 3:23006469-23006491 ACGTTGACACTATTGATACTTGG - Intergenic
951580705 3:24159864-24159886 ACCTTGGCACTATTGACATTGGG - Intronic
951729421 3:25794598-25794620 ACCTTGGCACTATTAATATTTGG + Intergenic
951915809 3:27799627-27799649 TCTTGGACACTATTGACATTTGG + Intergenic
951936597 3:28029418-28029440 GCCTTGGCACTATTAACATCTGG - Intergenic
952339759 3:32435703-32435725 ACCTTGGCATTACTGACATTCGG - Intronic
952674811 3:36015267-36015289 ACCTTAACACTGTTGACATTTGG + Intergenic
952943212 3:38458851-38458873 ACCTTGACACTATTACATTTTGG + Intronic
953167653 3:40479689-40479711 ACCTTGGCATCATTTACATTTGG + Intronic
953608845 3:44430577-44430599 ATCTTGGCACTCTTGACATTTGG + Intergenic
953682151 3:45047673-45047695 ACCTCGCCACTATTGGCATTTGG + Intergenic
953847158 3:46436819-46436841 ACCTTGGCACTATTGACATTTGG + Intronic
954567861 3:51614028-51614050 ACCTTAGCACTACTAACATTTGG - Intronic
955354082 3:58216077-58216099 GCCTTGGCACGATTGACATTTGG + Intergenic
955671735 3:61409682-61409704 ACCTTGGCACTACTGCCATTTGG + Intergenic
955685569 3:61545276-61545298 CCCTTGGCACTATTGACATTTGG - Intergenic
955709661 3:61764989-61765011 ATCTTGGCACTATTGGCATTTGG - Intronic
955986875 3:64582740-64582762 ACCTTGGCACTATTCATATTTGG - Intronic
956090711 3:65663702-65663724 GCCTTGACACTACCGACATTTGG + Intronic
956118390 3:65941441-65941463 GCCTTGGTACTATTGACATTTGG + Intronic
956257847 3:67303714-67303736 ACCTTAGCACTATTGACATTTGG + Intergenic
956387506 3:68735830-68735852 ACCTTCATACTATTGACATTTGG + Intronic
956493754 3:69802293-69802315 GCCTTGGCACGATTGACATTTGG - Intronic
956517534 3:70065786-70065808 ACCTTGGCGCTATTAACATTTGG - Intergenic
956707902 3:72015181-72015203 GCCTCGGCACTATTGACATTTGG + Intergenic
956786950 3:72650711-72650733 ACCTTGGCACTATTGACATTTGG - Intergenic
956827966 3:73016453-73016475 ACCTTGACACTACTGACATTTGG - Intronic
956971738 3:74533982-74534004 ACCTTGACATGATTGTCATTTGG - Intergenic
957245004 3:77705318-77705340 ATCTTGAAAGTATTTACATTTGG + Intergenic
958711795 3:97725643-97725665 ACCTTAGCACTATTGACATTTGG + Intronic
958819863 3:98960924-98960946 ACCTAAGCACTATTGACATTTGG - Intergenic
959406039 3:105962629-105962651 ACCTCTGCACTATTGACATTTGG + Intergenic
959647532 3:108720642-108720664 GCCATGACCCTACTAACATTTGG - Intergenic
960176069 3:114518947-114518969 ACTTTGGCCCTATTAACCTTTGG - Intronic
960680891 3:120246520-120246542 ACCTTAGCACTGTTGACATTTGG - Intronic
960704818 3:120471920-120471942 ACCTTGACACTATTGACATTTGG + Intergenic
960975574 3:123170645-123170667 ACGTTGGCACTATGGACATTGGG + Intronic
961919449 3:130410646-130410668 ATCTTGACACTACTGAAATTTGG + Intronic
962024929 3:131537902-131537924 ATCTTGACACTATTGACATTTGG + Intronic
962036274 3:131654914-131654936 AAATTAACACTATTGACATTTGG - Intronic
962284140 3:134072788-134072810 GCCTTGGCATTATTACCATTGGG - Intronic
962399705 3:135047925-135047947 ACCTTGACACTATTGACATTTGG - Intronic
964054093 3:152431131-152431153 ACATTGACAGTATTGACTTTTGG + Intronic
964472285 3:157068273-157068295 ACGTTGGCACCATTGACATTTGG - Intergenic
969501830 4:7558240-7558262 ACTTTGGCACTGTTAATATTTGG + Intronic
969808127 4:9626772-9626794 ACCTCAGCACTATTGACATTTGG + Intergenic
969855051 4:9992333-9992355 ACCTTGGCACTATTCACATTTGG + Intronic
970538887 4:17057705-17057727 ACCGTGGCACTATTGACATTGGG - Intergenic
970684994 4:18556991-18557013 AACATGACACTATTACCAGTTGG - Intergenic
970884421 4:20970684-20970706 ACCTTGGCACTATGAACACTTGG - Intronic
971631067 4:28994581-28994603 ACCTTGGCATTATTGATATTGGG + Intergenic
972471920 4:39413906-39413928 ACCTGGTCACTATTGACATTTGG + Intronic
972999849 4:44933012-44933034 ACATTGGCACTACTGACATTTGG - Intergenic
973071642 4:45867362-45867384 AGCCAGACACTATCAACATTTGG - Intergenic
973954108 4:56046578-56046600 ACCTTAGCACTATTGTCATTTGG + Intergenic
974034790 4:56808476-56808498 ACCTTAGCACTACTGACATTTGG + Intergenic
974882380 4:67775458-67775480 ACTTTAACACTATTGACATGTGG - Intergenic
975026751 4:69558571-69558593 TCCTTAGCACTATTAACAATGGG - Intergenic
975618915 4:76276101-76276123 ACTTTGGCACTATTGACATTTGG - Intronic
975814330 4:78202144-78202166 ACCATGACACTATTGACATTTGG - Intronic
976328111 4:83795812-83795834 ACCTCGGCACTATTGACACTTGG - Intergenic
976772305 4:88666069-88666091 ACCTTGGTACTATTGACTTTTGG - Intronic
977415745 4:96730640-96730662 ACCTTAGCACTATTGACATTTGG - Intergenic
977911367 4:102541043-102541065 AACTTGGCATTATTGACATTTGG + Intronic
978114849 4:105006659-105006681 ACCTGAGCACTATTAACTTTAGG - Intergenic
978996074 4:115154926-115154948 ACCTTAGCACTACTGACATTTGG + Intergenic
979311427 4:119208682-119208704 ACCTTGATCCTACTGACATTGGG + Intronic
979486736 4:121278878-121278900 AACTTCACACTATTAAAACTGGG - Intergenic
979601321 4:122589309-122589331 ACCTTGGCACTACTGACATTTGG - Intergenic
979749464 4:124260186-124260208 ACCTAGACACTATTGATGTTAGG + Intergenic
980250304 4:130306649-130306671 ACCCTGGCATTATTGACATTTGG + Intergenic
980493871 4:133566163-133566185 ACCTTGAGACCATTATCAGTCGG - Intergenic
982863690 4:160484269-160484291 ACCTTGACTCTATTATTATTTGG - Intergenic
983916352 4:173296246-173296268 ACCTTGACACAAGTAACACCTGG - Intronic
984362172 4:178748557-178748579 AATTAGACACTATAAACATTGGG + Intergenic
984608994 4:181817239-181817261 ACCTTAGCACTATTAACATTTGG + Intergenic
985439547 4:189970551-189970573 ACGTTGGCACTATTAGCATTCGG - Intergenic
985980929 5:3462504-3462526 ACATTGACAGTGTTGACATTGGG - Intergenic
986567440 5:9128813-9128835 ACATCGGCACTATTGACATTTGG + Intronic
986600033 5:9464000-9464022 ACCTCGACACTGTTGACATCTGG + Intronic
986637372 5:9836369-9836391 ACCTTGGCACTACTGACATTTGG + Intergenic
986648162 5:9938752-9938774 ACCTTAACACTATTGACATTTGG - Intergenic
986761260 5:10882141-10882163 CTCTTGGCACTATTCACATTTGG + Intergenic
987040330 5:14056085-14056107 ACCTTGGCACTACTGACACTGGG - Intergenic
987806464 5:22775568-22775590 AACTGGATAATATTAACATTGGG + Intronic
987829595 5:23077971-23077993 ACCTTGGCACTATTGACATTTGG - Intergenic
988159154 5:27496681-27496703 AACTTGACACTGTCGACATTTGG - Intergenic
988414729 5:30931683-30931705 ACTTTGGCACTACTGACATTTGG + Intergenic
988699566 5:33660080-33660102 CCCTCAGCACTATTAACATTTGG - Intronic
989154893 5:38335056-38335078 ACCTTGACACTATTGACATTTGG - Intronic
990153356 5:52845765-52845787 ACTTTGGAACTATTCACATTTGG - Intronic
990905287 5:60796367-60796389 ACCTCGACAGTATTGATATTTGG + Intronic
990941955 5:61211497-61211519 ACCTGAAAAGTATTAACATTAGG - Intergenic
991061844 5:62384415-62384437 ACCTTGACACTGTTAACATTTGG + Intronic
992276636 5:75127459-75127481 ACCTTGACATAAATGACATTTGG - Intronic
992735307 5:79713339-79713361 ACAGTGACACTATTGACATTAGG - Intronic
993896563 5:93542348-93542370 ACCTTGGCATTATTGATATTTGG + Intergenic
993997541 5:94740826-94740848 ATCCTGACTCTATTAACTTTGGG + Intronic
994563017 5:101401145-101401167 ACCTTGGCACTATTGACATTTGG + Intergenic
994930412 5:106175655-106175677 ACTTTGACAATATTTAAATTTGG + Intergenic
995733711 5:115274304-115274326 ACCTTGATACTATTGACATTTGG - Intronic
996038838 5:118788113-118788135 ACCTTGGCAATATTGACATTTGG + Intergenic
996298031 5:121947044-121947066 ACCTCAGCACTATTGACATTTGG + Intergenic
996541512 5:124634239-124634261 ACCTTGGCACTATTGACATATGG - Intergenic
996811451 5:127520080-127520102 ACTTTGGCACTATTGAAATTTGG + Intronic
997113413 5:131100268-131100290 ACCTTGGCACTATTAACATTTGG + Intergenic
997221897 5:132175301-132175323 ACCTGGGCACTACTGACATTTGG + Intergenic
999039052 5:148386322-148386344 ACCTTGACACTATTTAATCTTGG + Intronic
999436808 5:151569558-151569580 ACCATGGCACTATTGACATTGGG - Intergenic
999609179 5:153350914-153350936 ACATTGTTACTATTGACATTTGG + Intergenic
999613189 5:153393428-153393450 ATCTTGGTACTATTGACATTTGG + Intergenic
1000121826 5:158204835-158204857 ACCTGGACAACATTAATATTTGG - Intergenic
1000162885 5:158617397-158617419 ACCTTGGCACTATTGAGAATTGG + Intergenic
1000721645 5:164715292-164715314 ACCTTGGCAACATCAACATTTGG - Intergenic
1001272218 5:170322244-170322266 AACATGACACAACTAACATTAGG - Intergenic
1001740801 5:174051278-174051300 ACCTTGGCGCTGTTGACATTTGG - Intronic
1001929454 5:175662434-175662456 ACCTCGGCACTATTGACATTTGG - Intronic
1002346342 5:178550303-178550325 ACCTGGGCACTACTAACATTTGG + Intronic
1002549356 5:179975435-179975457 GCCTTGGCACTGTTGACATTTGG - Intronic
1003286699 6:4740484-4740506 ACCTCGGCACTATTGACATTTGG - Intronic
1003464724 6:6367988-6368010 GCCTTGTCACTATTGATATTTGG + Intergenic
1003902809 6:10670519-10670541 GCCTTGGCACTATTGCCATTTGG - Intergenic
1003973753 6:11323638-11323660 GCCTTGAAACCATGAACATTTGG - Intronic
1004310864 6:14543743-14543765 ATCTTGATACTACTGACATTTGG + Intergenic
1005324494 6:24685853-24685875 ACTTTAGCACTATGAACATTTGG - Intronic
1005393122 6:25354065-25354087 GCCTTGGCACTATCAACATTTGG - Intronic
1005427474 6:25717655-25717677 ACCCTGGCACTTTTAGCATTTGG + Intergenic
1007297066 6:40832432-40832454 ACCTTGATACTAGTAAGATGGGG + Intergenic
1007352534 6:41284318-41284340 AACATGGCACTATTGACATTTGG - Intronic
1007993242 6:46279378-46279400 ACCTTGGCACTATTGACATTTGG + Intronic
1008097029 6:47349458-47349480 ACCTTGGCACTATTCACGTTTGG - Intergenic
1008152706 6:47974476-47974498 ACCTTAACAATACTGACATTTGG + Intronic
1008459546 6:51752226-51752248 ACCTCAACACTATTGACATTTGG + Intronic
1009196637 6:60694654-60694676 ACCTTGACAATATTGATATTTGG - Intergenic
1010126733 6:72441202-72441224 ACCTTGGTACTATTGACATTTGG + Intergenic
1010179831 6:73073352-73073374 GCCTTGGCACTATTGACATTTGG + Intronic
1010231619 6:73540142-73540164 GCCTTGGCACTGTTGACATTTGG - Intergenic
1010462302 6:76127276-76127298 AGTTTGTCACTATTAACCTTGGG + Intergenic
1010686762 6:78862172-78862194 GCTTTGACACTATTAAAATTTGG + Intergenic
1011557268 6:88584196-88584218 ATATTGAAACTATTAACATGGGG - Intergenic
1012008446 6:93747507-93747529 TCATTGTTACTATTAACATTTGG + Intergenic
1012195738 6:96339854-96339876 ACCTTGACAATGTGAACATTTGG + Intergenic
1013603059 6:111722810-111722832 ACCTTGACACTATTAACATTTGG - Intronic
1013642350 6:112098109-112098131 ACCATGACACTATTCACAGCTGG - Intronic
1013852081 6:114528124-114528146 ACCATGACACTATTGACATCTGG - Intergenic
1014189884 6:118483085-118483107 ACCTCGGCACTATTGACATTTGG - Intronic
1014269855 6:119324825-119324847 ATCTTGACACTACTGAAATTCGG + Intronic
1015690050 6:135912043-135912065 ACTTTTACACTATTTACTTTTGG - Intronic
1015830329 6:137362045-137362067 ACCTCAGCACTATTGACATTTGG - Intergenic
1016039769 6:139421013-139421035 ACCTTGGCACTATTGACAGTTGG + Intergenic
1016323082 6:142869190-142869212 ACCTTGGCATTGTTGACATTTGG - Intronic
1016479347 6:144465100-144465122 ACTTTGGCACTAGTGACATTTGG - Intronic
1016696333 6:147000344-147000366 GCCTTGACACTATTGAGATTCGG - Intergenic
1018083877 6:160284477-160284499 ACCTTGGCACTGTTGACATTTGG - Intergenic
1021016897 7:15547067-15547089 ACCTTAACACTATTACAATTTGG + Intronic
1021273836 7:18625399-18625421 TACTTCGCACTATTAACATTTGG + Intronic
1021339406 7:19444857-19444879 ACCTAGTCACTATTGACATTTGG - Intergenic
1021476842 7:21071479-21071501 ATCTTGGCACTATTGACATTTGG - Intergenic
1021595263 7:22309069-22309091 ACCTTGGTAGTATTGACATTTGG - Intronic
1021603819 7:22391266-22391288 CCCTTGACACTTTGAACCTTTGG - Intergenic
1022828347 7:34039545-34039567 ACCTTCACACTCCTGACATTTGG - Intronic
1023085356 7:36564948-36564970 ACCTTGAAAGTATTAAAAATGGG + Intronic
1023125351 7:36949544-36949566 ACCTTGGCACTACTGACATTTGG + Intronic
1023323213 7:39023567-39023589 ACCATGACTCTGTTGACATTTGG - Intronic
1023599621 7:41868703-41868725 ATCTTGGAACTATTAATATTTGG + Intergenic
1023815105 7:43943544-43943566 ACCTTGGCACTATTGACACTTGG - Intronic
1029043242 7:97599493-97599515 ACCTTCACTCTATTCGCATTTGG - Intergenic
1029946674 7:104540491-104540513 ACCTTGGCACTATTGACATTTGG - Intronic
1030137962 7:106276138-106276160 ATCTTGACTCTTTTAAGATTAGG - Intronic
1030917712 7:115337525-115337547 ACCTTGACACTATTGCAATTTGG - Intergenic
1030991720 7:116309121-116309143 ACCTTGGCACTATGTACACTTGG - Intronic
1031095858 7:117419078-117419100 ACCATGGCACTACTGACATTTGG + Intronic
1031984832 7:128157369-128157391 GCCTGGGCACTATTGACATTTGG + Intergenic
1032612243 7:133427401-133427423 ACCTTGAAACTATTATCTTATGG + Intronic
1032998899 7:137481074-137481096 AGCTCTACACTATTGACATTTGG + Intronic
1034717989 7:153261420-153261442 ACCTTCACATTTTTAAAATTTGG + Intergenic
1034851555 7:154498714-154498736 ACCTCAGCACTATTGACATTCGG + Intronic
1036080499 8:5550091-5550113 AACTTGGCACTATTAAATTTTGG + Intergenic
1036216870 8:6887804-6887826 ACCTTGGCACAATTAACATTTGG - Intergenic
1038195671 8:25364971-25364993 TCCTTGTCGCTATAAACATTTGG + Intronic
1038784722 8:30601566-30601588 ACCTTGGCAGTGTTAACATTTGG - Intronic
1039195408 8:35025697-35025719 ACCTCTACATTATTGACATTTGG + Intergenic
1040436323 8:47394615-47394637 ACCTTGGCACTCTTGACATTTGG - Intronic
1040563952 8:48549424-48549446 ACCTTGGCACTGCTGACATTTGG + Intergenic
1042112182 8:65392309-65392331 ACCTCAGCACTATTGACATTTGG - Intergenic
1042372896 8:68012889-68012911 GTCTTGACATTATTGACATTTGG - Intronic
1042769385 8:72362825-72362847 ACCTCAACACTATTGATATTTGG - Intergenic
1043202913 8:77393940-77393962 CCCTTGTCATTATTAACATAAGG - Intergenic
1043552803 8:81393863-81393885 ACCTTGAGGGTATTTACATTTGG - Intergenic
1044294329 8:90510201-90510223 ACTTTGGCACTATTGACATTTGG - Intergenic
1044433468 8:92135476-92135498 ACTTTGCCACTATTGATATTTGG - Intergenic
1044477620 8:92646679-92646701 AACTTGGCCCTATTGACATTTGG - Intergenic
1044743433 8:95350499-95350521 ACCTTGGCACTCTTGCCATTTGG + Intergenic
1045427877 8:102085146-102085168 ACCTCAACACTATTAATATTTGG + Intronic
1045495094 8:102701324-102701346 ACCTTAATAAGATTAACATTAGG - Intergenic
1045496948 8:102717093-102717115 ACCTTGGCTTTATTGACATTTGG + Intergenic
1045759075 8:105582507-105582529 ACATTGGCACTATTAAGCTTTGG - Intronic
1046360712 8:113151137-113151159 ACTTTGAACCTATTAACATATGG - Intronic
1046684378 8:117208451-117208473 ATCTTGGTACTATTACCATTTGG - Intergenic
1046816830 8:118594268-118594290 ACCTTCACACTGAAAACATTTGG - Intronic
1046892388 8:119436967-119436989 ACCATGGCATTATTGACATTTGG - Intergenic
1047139639 8:122123537-122123559 ACCTTGGCACTACTCGCATTTGG + Intergenic
1047187700 8:122649191-122649213 GCTTTGGCACTATTGACATTTGG + Intergenic
1047376117 8:124298840-124298862 ATCTTGATACTAATGACATTTGG + Intergenic
1048637588 8:136314836-136314858 ACTTTGACACCAAGAACATTTGG - Intergenic
1050002979 9:1098376-1098398 AGCTTGACACTATTGACATTTGG - Intergenic
1050028071 9:1356483-1356505 ACCTTGGCTCTATTAATATTTGG - Intergenic
1050139805 9:2505705-2505727 GCCTCGACACTATTGACATTTGG + Intergenic
1050413084 9:5386525-5386547 ACCACAACACTATTGACATTTGG - Intronic
1050880877 9:10699320-10699342 ACCTTGGCACTACTGACATTTGG + Intergenic
1052325078 9:27208950-27208972 GCCTTGGCACTATTGACACTGGG - Intronic
1052385803 9:27822519-27822541 ACCTTGAGACTATTTTCCTTTGG - Intergenic
1053256665 9:36623039-36623061 ACATTAACACTATTGGCATTTGG + Intronic
1053909820 9:42886137-42886159 ACCTTGACTCTATAAAAAATTGG - Intergenic
1054745513 9:68850355-68850377 ACCTCAGCACTATTGACATTTGG + Intronic
1055171371 9:73262633-73262655 ACCTCAGCACTATTGACATTTGG - Intergenic
1055482857 9:76727046-76727068 ACCTTGGCACTACTGACATTTGG + Intronic
1055587159 9:77767210-77767232 ACCTCGACACTACTGACATTTGG + Intronic
1055675484 9:78655096-78655118 ACCTTGGCATTATGAACATTAGG - Intergenic
1055835915 9:80441662-80441684 AATTTGGCACTATTAAAATTCGG - Intergenic
1055936676 9:81610615-81610637 ACCTCAGCACTATTGACATTTGG + Intronic
1056144341 9:83714772-83714794 ACCTTGATACTGTTGACATTTGG + Intergenic
1056251199 9:84750095-84750117 ACCTTGGCACTATTGGCGTTTGG + Intronic
1056926016 9:90835110-90835132 ACCTTGGCACTCTTGACATTTGG - Intronic
1058746621 9:107997791-107997813 ACTTTGGCACCATTGACATTTGG + Intergenic
1059427414 9:114229854-114229876 ACCTTGGCACTACTGACATTTGG + Intronic
1061701358 9:132418360-132418382 GCCTTGGCACTATTGACATTTGG - Intronic
1061755839 9:132812068-132812090 CCCTTGAAACTATATACATTAGG + Intronic
1185825977 X:3250009-3250031 ACTTTGGCACTGTTGACATTTGG - Intergenic
1185860375 X:3573058-3573080 ACATTCGCACTATTGACATTTGG + Intergenic
1185925079 X:4136865-4136887 ACCATGACACTATTAACAACTGG - Intergenic
1185936751 X:4265110-4265132 ACCTTGGCACTATTGAATTTTGG + Intergenic
1186049643 X:5577097-5577119 ACCTTGACACTATTGGTATTTGG - Intergenic
1186157391 X:6739616-6739638 GCCTTGACACTATTGACATCAGG - Intergenic
1186204606 X:7188272-7188294 ACCTTGGCACTGTTGACACTTGG + Intergenic
1186210726 X:7247838-7247860 ACCTCTGCACTATTGACATTTGG - Intronic
1186250857 X:7664624-7664646 ATCTTGGCACTACTAACATTTGG - Intergenic
1186323385 X:8453306-8453328 GCCTTGACACAGTTGACATTTGG + Intergenic
1186330745 X:8529918-8529940 ACCTCAACACTATTGACTTTTGG - Exonic
1186358737 X:8815717-8815739 CCTTTGGCACTATTGACATTGGG - Intergenic
1186401864 X:9267741-9267763 AACTTAGCACTATTGACATTTGG + Intergenic
1186414279 X:9369911-9369933 ACCGCAACACTATTGACATTTGG - Intergenic
1186476311 X:9860227-9860249 ACCTCAGCACTATTGACATTTGG - Intronic
1186514939 X:10159977-10159999 ACCTTGGCACTACTGGCATTTGG + Intronic
1186515494 X:10163770-10163792 ACCTTGACACTGTGGACGTTAGG + Intronic
1186560508 X:10607458-10607480 ACTTTGGCACTATTGACATTTGG - Intronic
1186578164 X:10788771-10788793 ACCTTGGCACTACTGGCATTTGG - Intronic
1186584221 X:10854747-10854769 ACCTTGGCATTATTGACATTTGG + Intergenic
1186594803 X:10969233-10969255 AACTTGGCACTATTGTCATTTGG - Intergenic
1186608634 X:11116655-11116677 TCCGTGGCACTATTGACATTTGG - Intronic
1186639039 X:11435197-11435219 ACCTTGGTACTATTGACATTTGG - Intronic
1186642576 X:11472113-11472135 ACCTTGGCACTACTGACACTGGG + Intronic
1186648567 X:11534406-11534428 GCCTTGGCAATATTGACATTTGG + Intronic
1186648949 X:11538776-11538798 ACCTTGGCACTATTGACATTTGG + Intronic
1186817218 X:13249740-13249762 CCCTTGGCACTATTGACATTTGG - Intergenic
1186842065 X:13494342-13494364 GCCTCGGCACTATTGACATTTGG + Intergenic
1186852776 X:13596868-13596890 GCCTTGGCACTACTGACATTTGG - Intronic
1186888956 X:13941214-13941236 ACCTCGGCACTATTGACATCTGG - Intergenic
1186898823 X:14031938-14031960 ACCTTGGCACTATTCACATTTGG + Intergenic
1186924244 X:14314569-14314591 GCCTTGGCACTATTAATATATGG - Intergenic
1186958157 X:14705485-14705507 AACTTGACACTATCCATATTCGG - Intronic
1186963861 X:14766108-14766130 ACCTTGGCACTGATGACATTTGG - Intergenic
1186976885 X:14917164-14917186 ACCTCGACACTATGGGCATTTGG - Intronic
1186993696 X:15096645-15096667 ACATGGACACTATTGACATCTGG - Intergenic
1187067909 X:15858543-15858565 ACCTTGGCACTAGTGACATTTGG - Intergenic
1187077648 X:15951622-15951644 ACCTTGACACTCCTCCCATTGGG + Intergenic
1187295017 X:17990720-17990742 ACCTTGGCACTATTGACCTTTGG - Intergenic
1187418542 X:19114529-19114551 ACCTTGGCACTATTAATGCTTGG + Intronic
1187456943 X:19449629-19449651 ACCTTGGCACTATTGATATTTGG - Intronic
1187666877 X:21622916-21622938 AACATGACACTATAAAAATTAGG + Intronic
1187721392 X:22154621-22154643 ACCTTGGCACTATTGACATTTGG - Intronic
1187826853 X:23340105-23340127 ACCTTGGCACTATTAACATTTGG - Intronic
1187993030 X:24896294-24896316 ACCTTGACATTATTGACTTTGGG - Intronic
1188036780 X:25327202-25327224 ACCTTGCCACTATTGACATTTGG - Intergenic
1188251000 X:27894161-27894183 ACTTTGGCACTATTAACATTTGG + Intergenic
1188310131 X:28606243-28606265 ACCTTCACAATAGTAACACTAGG - Intronic
1188540452 X:31244238-31244260 ACCTTGACACCATACATATTTGG + Intronic
1188548508 X:31336554-31336576 ACCTGGGCACTATTGGCATTTGG - Intronic
1188592668 X:31857580-31857602 CCCTTGACACAATGAATATTTGG - Intronic
1189112054 X:38301779-38301801 ACCTTGGCATTATTGACATTTGG + Intronic
1189783856 X:44542394-44542416 ACCTTGACCCTACTAAGGTTTGG - Intronic
1189876394 X:45440915-45440937 AACTTGGCACTATTGACATTTGG + Intergenic
1190065984 X:47242063-47242085 ACCATGACACTATCAACAGGAGG + Exonic
1190116540 X:47629360-47629382 ACCTTGTTACTATTGACATTTGG - Intronic
1192489548 X:71563226-71563248 ACCTTGACAATTTTCACATCTGG - Exonic
1192579835 X:72271785-72271807 ACTTTGATACTGTTAACATTTGG - Intronic
1194971077 X:100344751-100344773 ACCTTGGCAATATTGACATTTGG + Intronic
1195401002 X:104461016-104461038 ACCATGAAACTATTGACACTTGG - Intergenic
1195630114 X:107046795-107046817 ACCTTGTCACTTTTGACTTTTGG - Intergenic
1196057392 X:111370508-111370530 ACCTTGGCACTACTGACATTTGG + Intronic
1196150539 X:112368666-112368688 GCCTTGGTACTATTGACATTTGG - Intergenic
1196216489 X:113058286-113058308 ACCTTAACACTATTGACATTTGG + Intergenic
1197146342 X:123176676-123176698 ACAGTGGCACTATTGACATTTGG + Intergenic
1197330775 X:125151858-125151880 ACATAGACACTATTGACATTTGG - Intergenic
1197571944 X:128160744-128160766 ACTTTGACCCTATGATCATTTGG + Intergenic
1197815630 X:130495058-130495080 ACTTTGGCACTATTAACATTTGG - Intergenic
1199023201 X:142906818-142906840 ACCTTCAAGCTATTAAAATTGGG - Intergenic
1199494137 X:148434263-148434285 ACGTTGACTTTATTAAAATTAGG + Intergenic
1199811933 X:151358363-151358385 GCCTTGACTCTAGTAATATTTGG + Intergenic
1200386807 X:155900445-155900467 ACCTAGACATTATTTACAATAGG - Intronic
1200390975 X:155946649-155946671 ACCTTGGCACTGTTGGCATTTGG + Intergenic
1201577275 Y:15474685-15474707 ACCTTGGCACTATTGACACTTGG + Intergenic