ID: 1101377734

View in Genome Browser
Species Human (GRCh38)
Location 12:104185209-104185231
Sequence ATGAAGAAAAGGGGTGCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101377726_1101377734 19 Left 1101377726 12:104185167-104185189 CCCAAATGTTAATAGTGTCAAGG 0: 4
1: 22
2: 154
3: 481
4: 1306
Right 1101377734 12:104185209-104185231 ATGAAGAAAAGGGGTGCTTAAGG No data
1101377725_1101377734 25 Left 1101377725 12:104185161-104185183 CCTGATCCCAAATGTTAATAGTG No data
Right 1101377734 12:104185209-104185231 ATGAAGAAAAGGGGTGCTTAAGG No data
1101377728_1101377734 18 Left 1101377728 12:104185168-104185190 CCAAATGTTAATAGTGTCAAGGT 0: 2
1: 9
2: 53
3: 160
4: 442
Right 1101377734 12:104185209-104185231 ATGAAGAAAAGGGGTGCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101377734 Original CRISPR ATGAAGAAAAGGGGTGCTTA AGG Intergenic
No off target data available for this crispr