ID: 1101377892

View in Genome Browser
Species Human (GRCh38)
Location 12:104186734-104186756
Sequence CTTTTCTTTTTTTTTTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203490
Summary {0: 11, 1: 659, 2: 11405, 3: 105115, 4: 86300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101377892_1101377895 27 Left 1101377892 12:104186734-104186756 CCATTTCAAAAAAAAAAGAAAAG 0: 11
1: 659
2: 11405
3: 105115
4: 86300
Right 1101377895 12:104186784-104186806 GTAGCTAGAAAGAATGAATCTGG No data
1101377892_1101377893 -1 Left 1101377892 12:104186734-104186756 CCATTTCAAAAAAAAAAGAAAAG 0: 11
1: 659
2: 11405
3: 105115
4: 86300
Right 1101377893 12:104186756-104186778 GAAAAAAAAAGAAAATGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101377892 Original CRISPR CTTTTCTTTTTTTTTTGAAA TGG (reversed) Intergenic
Too many off-targets to display for this crispr