ID: 1101377895

View in Genome Browser
Species Human (GRCh38)
Location 12:104186784-104186806
Sequence GTAGCTAGAAAGAATGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101377892_1101377895 27 Left 1101377892 12:104186734-104186756 CCATTTCAAAAAAAAAAGAAAAG 0: 11
1: 659
2: 11405
3: 105115
4: 86300
Right 1101377895 12:104186784-104186806 GTAGCTAGAAAGAATGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101377895 Original CRISPR GTAGCTAGAAAGAATGAATC TGG Intergenic
No off target data available for this crispr