ID: 1101379412

View in Genome Browser
Species Human (GRCh38)
Location 12:104201539-104201561
Sequence CAGGAGCATGATGCTGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101379412_1101379415 16 Left 1101379412 12:104201539-104201561 CCTCCTACAGCATCATGCTCCTG No data
Right 1101379415 12:104201578-104201600 CAGTATCTGCTTTGTCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101379412 Original CRISPR CAGGAGCATGATGCTGTAGG AGG (reversed) Intergenic
No off target data available for this crispr