ID: 1101382153

View in Genome Browser
Species Human (GRCh38)
Location 12:104223531-104223553
Sequence AACACTGGACTACCATTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101382147_1101382153 8 Left 1101382147 12:104223500-104223522 CCCACTCCCAAGTCAAGTTTGTT 0: 1
1: 0
2: 1
3: 12
4: 133
Right 1101382153 12:104223531-104223553 AACACTGGACTACCATTGTTGGG 0: 1
1: 0
2: 1
3: 3
4: 88
1101382146_1101382153 9 Left 1101382146 12:104223499-104223521 CCCCACTCCCAAGTCAAGTTTGT 0: 1
1: 0
2: 3
3: 13
4: 160
Right 1101382153 12:104223531-104223553 AACACTGGACTACCATTGTTGGG 0: 1
1: 0
2: 1
3: 3
4: 88
1101382150_1101382153 1 Left 1101382150 12:104223507-104223529 CCAAGTCAAGTTTGTTAGAAATG 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1101382153 12:104223531-104223553 AACACTGGACTACCATTGTTGGG 0: 1
1: 0
2: 1
3: 3
4: 88
1101382148_1101382153 7 Left 1101382148 12:104223501-104223523 CCACTCCCAAGTCAAGTTTGTTA 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1101382153 12:104223531-104223553 AACACTGGACTACCATTGTTGGG 0: 1
1: 0
2: 1
3: 3
4: 88
1101382149_1101382153 2 Left 1101382149 12:104223506-104223528 CCCAAGTCAAGTTTGTTAGAAAT 0: 1
1: 0
2: 3
3: 18
4: 238
Right 1101382153 12:104223531-104223553 AACACTGGACTACCATTGTTGGG 0: 1
1: 0
2: 1
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101382153 Original CRISPR AACACTGGACTACCATTGTT GGG Intronic
902321241 1:15668205-15668227 AATACAGGTCTACCATTTTTAGG - Exonic
906897550 1:49793051-49793073 AGTAATGGACTTCCATTGTTTGG - Intronic
908790930 1:67780570-67780592 AACACTGGAATAGCATTGAAAGG + Intronic
909420405 1:75458256-75458278 AACACTGAACTACTTATGTTTGG - Intronic
911132379 1:94402584-94402606 AAAACTGGAATACTATTGGTAGG - Intergenic
919134167 1:193488005-193488027 AAAACTGGACTGCAATTGTCGGG + Intergenic
924126888 1:240864136-240864158 GACACTGGACTACGAGTTTTAGG + Intronic
1064456228 10:15489989-15490011 AACAATGGACTACCAGTTTGGGG - Intergenic
1072962889 10:99945678-99945700 AACACTGGACAAACATTACTGGG - Intronic
1074243766 10:111667198-111667220 GACAGTGGAATACCATTGTGGGG + Intergenic
1075991953 10:126845605-126845627 AACACTGGACTCACAGTGCTTGG - Intergenic
1077586042 11:3453990-3454012 AAAAATGGACAACCATTGTCGGG - Intergenic
1078634994 11:13041024-13041046 AACACTGGAGCTCCAGTGTTAGG - Intergenic
1081650258 11:44818947-44818969 AACCCTGGACTACCAGGGTTGGG - Intronic
1097810717 12:64015775-64015797 CTCACTGGACTATCAGTGTTAGG - Intronic
1101382153 12:104223531-104223553 AACACTGGACTACCATTGTTGGG + Intronic
1102971844 12:117174434-117174456 AACACTTGATTAATATTGTTAGG - Intronic
1104921467 12:132292812-132292834 AAGTCTGGACCACCGTTGTTCGG + Intronic
1115054465 14:29105948-29105970 AACACTGGATTATCATTCATAGG - Intergenic
1115622781 14:35156922-35156944 AAAAATGAACTACCATTATTAGG - Intronic
1116487046 14:45462369-45462391 AACACTGTACCATCATTTTTGGG - Intergenic
1119371244 14:74145871-74145893 TCCACTGGACTACCAATATTTGG + Intronic
1119993875 14:79230294-79230316 AACACTCTCCTATCATTGTTGGG + Intronic
1124048077 15:26169428-26169450 AAAACTGGACTAACATGGTATGG - Intergenic
1125468114 15:39975079-39975101 AACACAGGGCTATCATTTTTTGG + Intronic
1129060398 15:72856327-72856349 AACACAGACCTACCATGGTTTGG - Intergenic
1131727528 15:95243125-95243147 AATACTGTACTACCACTGTATGG - Intergenic
1137633487 16:49965292-49965314 AAGAGTGGATTACCATTGTAAGG - Intergenic
1138404574 16:56779454-56779476 AACAATGGACTACCAAATTTAGG + Intronic
1138908936 16:61372981-61373003 AATACTGGACAAACATTTTTAGG + Intergenic
1146077606 17:29745915-29745937 AACACTGCACTATTACTGTTAGG + Intronic
1146381734 17:32334930-32334952 CACACTGGACAACAATTGATGGG + Intronic
1151026798 17:70686360-70686382 AACTCAAGACTACTATTGTTAGG + Intergenic
1155370556 18:25095930-25095952 GACACTGGACCCCCATTGCTAGG - Intronic
1157887917 18:51386304-51386326 AACACTGGACTAGGATTTATAGG + Intergenic
1163524195 19:17810545-17810567 AACACTGGACTTCCCTCCTTGGG - Intronic
1164453710 19:28389096-28389118 AACACTGACATACCATTGGTGGG - Intergenic
926882132 2:17557617-17557639 AACACTCGTTTACCATTGCTGGG + Intronic
928775189 2:34752568-34752590 AACACTGAACTTCAATTTTTAGG - Intergenic
932668463 2:73717053-73717075 AACACTGGGCCACCTTTGATTGG - Intergenic
934164266 2:89280149-89280171 CACACTGCACCACCATTGCTTGG + Intergenic
934203008 2:89902375-89902397 CACACTGCACCACCATTGCTTGG - Intergenic
936144273 2:109969149-109969171 AACCCTGGACTTCCATTCCTGGG + Intergenic
936180955 2:110267109-110267131 AACCCTGGACTTCCATTCCTGGG + Intergenic
936200416 2:110402320-110402342 AACCCTGGACTTCCATTCCTGGG - Intergenic
937951671 2:127392837-127392859 GACAATGGACTACCTTTGATAGG - Intergenic
945436943 2:209830015-209830037 CACACTGGACTGCCAGTCTTTGG - Intronic
1169627874 20:7592838-7592860 AAAAATGAATTACCATTGTTAGG - Intergenic
1173097309 20:40047578-40047600 AAGGCAGGGCTACCATTGTTTGG + Intergenic
1175711346 20:61223742-61223764 AACTCTGGACTCACATTTTTCGG - Intergenic
1176141435 20:63546759-63546781 AACACTGGACTCCCTGTGTGAGG + Intronic
1182198979 22:28549988-28550010 CTCACTGGACTAAAATTGTTGGG - Intronic
949987112 3:9550167-9550189 ACCACTGGACTACGAGTCTTGGG - Intronic
950355945 3:12409316-12409338 AAAACTAAACTACAATTGTTTGG + Intronic
950764104 3:15260565-15260587 GACACAGGACTGCCATTGGTGGG + Intronic
957069287 3:75553321-75553343 AAAAATGGACAACCATTGTCGGG + Intergenic
960620070 3:119628808-119628830 AAGACCGGACTACCATTATTGGG + Exonic
962237543 3:133719342-133719364 TACTATGGACAACCATTGTTTGG - Intergenic
964408514 3:156375026-156375048 ACCACTGCACTGACATTGTTTGG + Intronic
966077486 3:175955653-175955675 AACACCTAAGTACCATTGTTTGG + Intergenic
969001232 4:3983945-3983967 AAAAATGGACAGCCATTGTTGGG - Intergenic
969752781 4:9124757-9124779 AAAAATGGACAACCATTGTCGGG + Intergenic
970616835 4:17775568-17775590 AAAACTGGAATACAAATGTTGGG - Intronic
971028768 4:22614013-22614035 AGCACTGGACCAGCATTATTTGG + Intergenic
973199554 4:47484985-47485007 AACACTGGACAATTATTTTTTGG - Intergenic
975762037 4:77630146-77630168 AACACTTAAAGACCATTGTTCGG + Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
979031211 4:115650245-115650267 AACACTAGATTACTATTGCTAGG + Intergenic
980104454 4:128574540-128574562 AAGACAGGTCAACCATTGTTTGG + Intergenic
990194304 5:53295962-53295984 AGCACTTGACAACCATTATTGGG - Intergenic
996167764 5:120246437-120246459 AACACTGGATTAACATTGTTTGG + Intergenic
996490603 5:124090546-124090568 AACACTGAACTCCAATTATTTGG + Intergenic
1000057230 5:157618101-157618123 AATATTGGTCTATCATTGTTGGG + Intergenic
1010074167 6:71781729-71781751 AAAACTGGACTACTATTTTCAGG + Intergenic
1021021413 7:15602927-15602949 AACACTAGACTACCATTGCCTGG - Intergenic
1022061860 7:26804866-26804888 AACAGTGAAATACCATTATTGGG + Intronic
1025984670 7:66438795-66438817 AACTCTGTGCAACCATTGTTAGG - Intergenic
1026030047 7:66784159-66784181 AACTCTGTGCAACCATTGTTAGG + Intronic
1027207874 7:76117382-76117404 AACTCTGTGCAACCATTGTTAGG - Intergenic
1033992004 7:147299384-147299406 AACAATGAAGTGCCATTGTTGGG + Intronic
1036375995 8:8200088-8200110 AAAAATGGACAACCATTGTCGGG + Intergenic
1036853534 8:12223050-12223072 AAAAATGGACAACCATTGTCGGG - Intergenic
1041003513 8:53476600-53476622 AGCACTGGACCAGCATTATTCGG - Intergenic
1042721782 8:71834034-71834056 CACACTGCACTTCAATTGTTGGG + Intronic
1056710475 9:88988876-88988898 AAAACTGGACTACCAGAGTGTGG - Intergenic
1057670568 9:97083936-97083958 AACTTTGGATTAGCATTGTTAGG + Intergenic
1059040208 9:110806570-110806592 AATAATGGAATACCATTATTTGG - Intergenic
1186271910 X:7897820-7897842 AACACTGATCTTCCATAGTTAGG + Intergenic
1186322600 X:8445909-8445931 AACTCTGGACTTCCGTGGTTTGG - Intergenic
1196781552 X:119388143-119388165 AACTCTGGACTCCCATTGAGAGG - Intergenic
1196785693 X:119419722-119419744 AACTCTGGAATAACAGTGTTAGG - Intronic
1199889437 X:152060881-152060903 TACACAGGACTAGAATTGTTTGG - Intergenic
1200303147 X:154998755-154998777 CTAACTGCACTACCATTGTTAGG - Intronic