ID: 1101390855

View in Genome Browser
Species Human (GRCh38)
Location 12:104298967-104298989
Sequence TTGGGTATACACAAGGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 2, 1: 2, 2: 9, 3: 53, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101390855_1101390865 29 Left 1101390855 12:104298967-104298989 CCAGGACCCTTGTGTATACCCAA 0: 2
1: 2
2: 9
3: 53
4: 209
Right 1101390865 12:104299019-104299041 CCCTGTGGAACCAGCATATATGG 0: 1
1: 0
2: 0
3: 10
4: 108
1101390855_1101390860 14 Left 1101390855 12:104298967-104298989 CCAGGACCCTTGTGTATACCCAA 0: 2
1: 2
2: 9
3: 53
4: 209
Right 1101390860 12:104299004-104299026 AAGTCCCAAAGTCCACCCTGTGG 0: 1
1: 0
2: 11
3: 26
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101390855 Original CRISPR TTGGGTATACACAAGGGTCC TGG (reversed) Intronic
901234364 1:7659818-7659840 TTGGGTATGCACAAAGTGCCAGG + Intronic
901425029 1:9177093-9177115 TTTGGTATTCACAGGGATCCTGG - Intergenic
902975775 1:20087309-20087331 TTTGGTATTCACAGGGGTCCTGG - Intronic
906235589 1:44206419-44206441 TTGGGTATACATGGGGGTCCTGG + Intergenic
907749454 1:57248037-57248059 TTTGGTATCCACAAGGGTCCTGG - Intronic
907923569 1:58935159-58935181 TTGGGTATCCACAAGAGTCCTGG - Intergenic
910224009 1:84917907-84917929 TTTGGTTTCCACAGGGGTCCTGG + Intergenic
910567331 1:88658964-88658986 TTGGGTACATGCATGGGTCCAGG + Intergenic
911428339 1:97750861-97750883 TTTGGTATATGCAAGGGTCCTGG + Intronic
916481369 1:165217561-165217583 TTGAGTATATGCAGGGGTCCTGG - Intronic
918260778 1:182793959-182793981 TTTGGTATACACGAAGGTCCTGG + Intronic
918594011 1:186271746-186271768 TTTGATATCCACAGGGGTCCTGG - Intergenic
918852099 1:189705655-189705677 TATGGTATCCACACGGGTCCTGG + Intergenic
919649098 1:200127829-200127851 TTGAGTATAGGCAGGGGTCCTGG + Intronic
919649119 1:200128117-200128139 TTTGGTATAAACAGGGGTGCTGG - Intronic
921134349 1:212246821-212246843 CTGGGTATACACCAGGGGCCTGG + Intergenic
921384380 1:214553771-214553793 TTGGGCAGACACAAGGGTTCCGG + Intergenic
923093522 1:230757174-230757196 TTTGGTATACACAGGGGTCCTGG + Intronic
924192528 1:241568902-241568924 TTTTGTATCCACAGGGGTCCTGG - Intronic
1064080890 10:12307172-12307194 TTGGGTATAGAAATGGATCCAGG + Intergenic
1065325202 10:24544715-24544737 TTGGGTAAACACGAGGCTGCTGG + Intronic
1065575914 10:27118052-27118074 TTTGGTATCCACATGGGTCCTGG + Intronic
1067917067 10:50411484-50411506 TTGTGTATTTACAAGGCTCCTGG - Intronic
1068064776 10:52115761-52115783 CTGGGTATACAGAAGGGTAAAGG - Intronic
1068451404 10:57194282-57194304 TTGGGTATATGCAGGAGTCCTGG + Intergenic
1068464474 10:57371140-57371162 TTTGGTATCCACAGGGATCCTGG + Intergenic
1069042087 10:63706255-63706277 TTTGGTATCCACAAAGGCCCTGG + Intergenic
1069327627 10:67250575-67250597 CTGGGTATACCTGAGGGTCCTGG + Intronic
1069958113 10:72063906-72063928 TTTGGGATACAGAAGGATCCTGG - Intronic
1072869121 10:99098374-99098396 TTTGGTATCAATAAGGGTCCTGG + Intronic
1073496022 10:103891763-103891785 TTTGGTATACCTGAGGGTCCTGG - Intronic
1073640171 10:105244496-105244518 TTTTGTATACACAGCGGTCCTGG + Intronic
1077116175 11:885595-885617 TTGGCTATAGAGAAGGGCCCAGG - Intronic
1078563603 11:12394723-12394745 CTGGGTATACACAGGGGTCCTGG - Intronic
1078808486 11:14732675-14732697 TTGGATATACTCAAGAGTCCTGG - Intronic
1081178244 11:39955318-39955340 TTTGGTATCCACAGGGGTCTTGG + Intergenic
1081443944 11:43111328-43111350 TTGTGTATTCACAAGGACCCCGG - Intergenic
1081952441 11:47056080-47056102 TTTGGTATAAACAGGGGTCCTGG - Intronic
1084947766 11:72648027-72648049 GTGTGTGTACACAAGTGTCCAGG + Intronic
1085067939 11:73514899-73514921 TTTGATCTTCACAAGGGTCCAGG + Intronic
1085373727 11:76038555-76038577 TTTGGCATCCACAAGGGTCCTGG + Intronic
1087332368 11:96797101-96797123 TTGGGTATACTTAGGGGTCCTGG - Intergenic
1087853447 11:103060536-103060558 TTGGGTATACACAAGGGTCCTGG + Intergenic
1087997282 11:104825177-104825199 TTTGGTATTCACAGGGGTTCTGG + Intergenic
1089049308 11:115532771-115532793 TTGAGTATACCCAGGGGTCCTGG + Intergenic
1089945097 11:122462218-122462240 TTGGGCAAACACAAGGATCATGG - Intergenic
1091364426 11:135005707-135005729 TTTGGTATCCCCAGGGGTCCTGG - Intergenic
1091812787 12:3413941-3413963 TTTGGTATTCACAGGTGTCCTGG + Intronic
1092699000 12:11205845-11205867 TTTGGTATCCACAGGGGTCATGG + Intergenic
1094481149 12:30882508-30882530 TTTGGTATGCACAGGGGTCCTGG - Intergenic
1095235678 12:39792616-39792638 TTTGGTATCCACAGGGATCCTGG - Intronic
1097343061 12:58461512-58461534 TTTGGTATCCACAGAGGTCCTGG - Intergenic
1097569352 12:61312956-61312978 CTGTGTAGACACAAGAGTCCAGG + Intergenic
1098450870 12:70616893-70616915 TTGGTTATACATAAGGGTCCTGG - Intronic
1098938801 12:76510975-76510997 TTGGCTATACACTAAGTTCCTGG - Intronic
1100244300 12:92741644-92741666 TAGGGTATAAACAACTGTCCTGG - Intronic
1101390855 12:104298967-104298989 TTGGGTATACACAAGGGTCCTGG - Intronic
1103048806 12:117761328-117761350 GTGGGTGTACACAGGGGCCCCGG + Exonic
1109481511 13:62961548-62961570 TTTGGTATCCACAGGAGTCCTGG + Intergenic
1109548433 13:63860222-63860244 TTGTGCATAAACAAGGGACCTGG + Intergenic
1110123065 13:71907352-71907374 TTCGGTATCCCCAAGGATCCTGG + Intergenic
1111682683 13:91463079-91463101 TTGGGTATTCAAGGGGGTCCTGG - Intronic
1112269363 13:97954141-97954163 TTGTGCCTACACATGGGTCCTGG - Exonic
1112455995 13:99564538-99564560 TTTGGTAACCACAAGGGTTCTGG - Intergenic
1112539262 13:100291367-100291389 TTTAGTATTCACAGGGGTCCTGG + Intronic
1116884475 14:50206350-50206372 TTGGGTATCCACAGGTGTCCTGG - Intronic
1116976565 14:51123026-51123048 TTTGGTATTCACAAGGGTCCTGG + Intergenic
1117348731 14:54860020-54860042 TTGGGTATACACAGGGGTCCTGG - Intronic
1118049162 14:62007371-62007393 TTGGTTATGCAGAAGTGTCCAGG + Intronic
1119430045 14:74560930-74560952 TTTGGTATTCACAGGGGTCCTGG + Intronic
1119957813 14:78819538-78819560 TTTGGTATTCACAAGGGTCCTGG + Intronic
1120041172 14:79754429-79754451 TTTTGTATCCACAGGGGTCCTGG + Intronic
1120165627 14:81195789-81195811 CGGGGTATTCACAAGGGTCAGGG - Intronic
1122943051 14:104991630-104991652 TTGGGTTGACACAGGGCTCCTGG + Intronic
1123096982 14:105771480-105771502 TTGTCTATCCACGAGGGTCCAGG + Intergenic
1123879538 15:24663956-24663978 TTTGGTATTCACAGGGGTTCTGG - Intergenic
1124031285 15:26014640-26014662 TTCGGTATGCGCTAGGGTCCTGG + Intergenic
1124225621 15:27891461-27891483 TTTGGTATCCACAGAGGTCCTGG - Intronic
1125742545 15:41976344-41976366 TTTGGTATTCCCAGGGGTCCTGG + Intergenic
1126701658 15:51373252-51373274 TTTGGTATTCACAGGTGTCCTGG - Intronic
1129329186 15:74818159-74818181 TTGGATTTACAGAAGGGGCCAGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132281225 15:100617567-100617589 CTGGATATATACAAGGATCCCGG - Intronic
1134467715 16:14494157-14494179 TTTGGTATACTCAGGGGTCCTGG + Intronic
1135577226 16:23595390-23595412 TTGGGTATAGTCGGGGGTCCTGG - Intronic
1136634749 16:31513466-31513488 TTGCGTATACTCCAGGGTCCTGG - Intergenic
1137476982 16:48817663-48817685 CTGGGTGAGCACAAGGGTCCAGG - Intergenic
1137707651 16:50546926-50546948 TTGGGTATCCTCTAGGATCCTGG - Intergenic
1139075279 16:63439178-63439200 TTTGGTATCCACAGAGGTCCTGG + Intergenic
1139363734 16:66419775-66419797 TTGGGTATCTACTAGGGGCCAGG + Intergenic
1145357290 17:22171207-22171229 TTTGGTATCCACAGGGGTCCTGG - Intergenic
1146776966 17:35628236-35628258 TTTGGTATCCACAGGGGCCCAGG + Intronic
1149275613 17:55031696-55031718 TTGGGTATATGCAGGGGTCCGGG - Intronic
1149739009 17:59025563-59025585 TTTAGTATACGCAGGGGTCCTGG - Intronic
1150535411 17:66034072-66034094 TTTGATATACACAGAGGTCCTGG + Intronic
1151295961 17:73186385-73186407 TTGGAGATATACAGGGGTCCTGG + Intergenic
1151636583 17:75353237-75353259 TTGGGTATATGCAGGGGTCCTGG - Intronic
1152047193 17:77944976-77944998 TTCTGTATACACAAGGGTGAAGG - Intergenic
1153720499 18:7896673-7896695 TTAGATATACTGAAGGGTCCTGG + Intronic
1153773135 18:8431367-8431389 TTTGGTATCCTCAGGGGTCCTGG - Intergenic
1157157048 18:45278627-45278649 TTTGGTATACTTAGGGGTCCTGG - Intronic
1157672668 18:49543388-49543410 TTTGGTATACACAGGGGGTCTGG + Intergenic
1158657633 18:59353790-59353812 TTTGGTATCCACAGGGGTCCTGG - Intronic
1158696568 18:59709079-59709101 TAGGGTATACAAAAGGTTCTGGG + Intergenic
1158884888 18:61817611-61817633 TTTGGTATACATGGGGGTCCTGG + Intronic
1160320026 18:77881925-77881947 GTGGGCATACACAAGGCTCAAGG + Intergenic
1167289093 19:48614855-48614877 CTGTGTTTACACAAGGGGCCGGG - Intergenic
1168101847 19:54145493-54145515 TTGGGTCTCCACAGGGGTCAGGG + Intronic
925187399 2:1858585-1858607 TTTGGTATCCTCAGGGGTCCTGG + Intronic
926240061 2:11078583-11078605 TTGGGTATAGATAATGGTCATGG + Intergenic
926266325 2:11325291-11325313 TTTGGTATCCACAGGGGTCTTGG + Intronic
927004177 2:18830515-18830537 TTTGGTATCCACAAGAATCCTGG - Intergenic
927101695 2:19792481-19792503 TTGGGTATACTCCAGGGTCCTGG + Intergenic
927537264 2:23873394-23873416 TTTGGTATTCGCAAGGGTCCTGG - Intronic
928011630 2:27613558-27613580 TTGGGTATTCACAGAGGTCCTGG - Intronic
928716562 2:34067881-34067903 TTTGGTATCCATAGGGGTCCTGG + Intergenic
929098668 2:38287685-38287707 TTTGGTATCCACAGGGATCCTGG - Intergenic
929214232 2:39393744-39393766 TTTGGTACACTCAAGGGTCCTGG - Intronic
929849010 2:45564886-45564908 TTGGGTATATGCAGGGATCCTGG + Intronic
931492170 2:62760012-62760034 TTCAGTATACACAGGGGTCCTGG - Intronic
931498179 2:62834883-62834905 TTTGGTATAGACAGGGTTCCTGG + Intronic
931824810 2:65989375-65989397 TTTGGTATCCAAGAGGGTCCTGG + Intergenic
933127679 2:78630998-78631020 TTTGGCATCCACAGGGGTCCTGG + Intergenic
933421326 2:82049134-82049156 TTTGATATACACAGGGGTCCTGG + Intergenic
933457502 2:82535179-82535201 TTTGGTATTCATGAGGGTCCTGG + Intergenic
933917686 2:87012911-87012933 TTTGGTAGCCACAGGGGTCCTGG + Exonic
934005310 2:87757006-87757028 TTTGGTAGCCACAGGGGTCCTGG - Exonic
935265277 2:101387995-101388017 TTTGGTATCCACGGGGGTCCTGG - Intergenic
935316996 2:101844773-101844795 TTGGGTATACTCAAGAGTAGGGG + Intronic
935759295 2:106304350-106304372 TTTGGTATCCCCAAGGGTCTTGG - Intergenic
935768269 2:106391093-106391115 TTTGGTAGCCACAGGGGTCCTGG - Intergenic
936880629 2:117245951-117245973 TTTGGTATCTGCAAGGGTCCTGG + Intergenic
937089538 2:119196753-119196775 TTGGAAAGACACAGGGGTCCTGG - Intergenic
938752585 2:134347739-134347761 TTTGGTGTCCACAGGGGTCCTGG + Intronic
939061372 2:137425607-137425629 TTTGGTATACACAAGGATGATGG + Intronic
939574758 2:143882852-143882874 TTGAGTATACATGGGGGTCCTGG - Intergenic
941730235 2:168909203-168909225 ATGTATATACACACGGGTCCAGG + Intronic
946078219 2:217093497-217093519 TTTGGTATCCACAGGGGTCCTGG - Intergenic
947164227 2:227245494-227245516 TTTGGTATTCATAGGGGTCCTGG + Intronic
947265802 2:228279030-228279052 TTTGATATACACAGGGGTCCTGG + Intergenic
1172107159 20:32523691-32523713 TTGGGCAGGGACAAGGGTCCTGG - Intronic
1172580401 20:36042909-36042931 TTGGGTATACCCAGGGATTCTGG + Intergenic
1175301060 20:57943098-57943120 TTAGGAATACCCAGGGGTCCCGG + Intergenic
1177165101 21:17592261-17592283 TTTGGTATCCAGGAGGGTCCTGG - Intronic
1179013073 21:37571496-37571518 TTTGGTATCCCCAGGGGTCCTGG - Intergenic
1179570251 21:42274359-42274381 TTGGGGCCACAGAAGGGTCCAGG + Intronic
1182913875 22:34010172-34010194 TGTGGTATACACAGGGATCCTGG + Intergenic
1184317860 22:43711509-43711531 TTTGGTATACAAAAGTGTCGAGG + Exonic
1184386222 22:44176180-44176202 TTTGGTATCCTCCAGGGTCCCGG - Intronic
1184630309 22:45772825-45772847 TTTGGTAGCCACAGGGGTCCTGG - Intronic
949914239 3:8945161-8945183 TTTGGTATTCTCAGGGGTCCTGG + Intronic
950777547 3:15363645-15363667 TTTGGTGTACTCAGGGGTCCTGG - Intergenic
950974441 3:17225994-17226016 TTTGGTATCCGCAGGGGTCCTGG + Intronic
951104452 3:18726752-18726774 TTTGGTATACATGGGGGTCCTGG - Intergenic
953662790 3:44903239-44903261 TTGGGTATACTCAGGGGTCCTGG + Intronic
953824913 3:46243067-46243089 TTTGGTATCTGCAAGGGTCCTGG - Intronic
955504943 3:59622789-59622811 TTTGGTATACAAGAGAGTCCTGG - Intergenic
955966498 3:64394312-64394334 TTTGGTATCCCCAGGGGTCCTGG + Intronic
956828175 3:73018339-73018361 TTTGGTATACACAGGAGTCTTGG + Intronic
956895764 3:73658212-73658234 TTGGGGATACACAAAAGTCTAGG - Intergenic
957899031 3:86463922-86463944 GTGTGTGTACACCAGGGTCCTGG + Intergenic
958121278 3:89292432-89292454 TTTGGCATCCACAGGGGTCCTGG + Intronic
958123569 3:89326176-89326198 TTTGGTATCCTCAGGGGTCCTGG - Intronic
960576351 3:119233549-119233571 TTGGGTAGATGCAGGGGTCCTGG + Intronic
965099075 3:164273834-164273856 CTGGTTATACACATGGGTGCTGG - Intergenic
966545858 3:181147174-181147196 TTTGGTATCCACAGGGGTCCTGG + Intergenic
967701793 3:192601704-192601726 TTTGGTATCCACAGGGGTTCTGG - Intronic
968322705 3:197785260-197785282 TTGGGTATATACAAGGGTCCTGG - Exonic
971291763 4:25348705-25348727 TTTGGTATATGCAGGGGTCCTGG + Intronic
972268805 4:37489055-37489077 TTTGGTATACGCAGAGGTCCTGG + Intronic
973237965 4:47926483-47926505 TTGGGTATACATGGGGATCCTGG + Intronic
974318653 4:60315007-60315029 TTGGGTATACATGGGGCTCCTGG - Intergenic
974809269 4:66924657-66924679 TTTGGTAATCACTAGGGTCCTGG + Intergenic
975777611 4:77805109-77805131 TTAGGCATACACAAGGGTCATGG + Intronic
977052952 4:92152801-92152823 TTTGGTATATACAAGGGTCTGGG - Intergenic
978285165 4:107068986-107069008 TTTAGTATACGCAAGGGTACTGG - Intronic
979643221 4:123034247-123034269 TTTGGTATTCACAGTGGTCCTGG + Intronic
979964418 4:127060902-127060924 TTTGGTATATTCAGGGGTCCTGG + Intergenic
982200170 4:152952710-152952732 TTTGGTATCCCCAGGGGTCCTGG + Intronic
982381499 4:154753929-154753951 TTGGGTGTACATGGGGGTCCTGG + Intergenic
982411908 4:155087066-155087088 TTGAGTATGTACAAGGGTCCTGG + Intergenic
983153799 4:164319337-164319359 TTTGGTATCCACAGGGGTCCTGG + Intronic
984591312 4:181620337-181620359 TTGGGTATACGCGGGTGTCCTGG - Intergenic
984784646 4:183556283-183556305 TTTGGTATTCTCGAGGGTCCTGG - Intergenic
984843813 4:184093167-184093189 CTGGGTATACACAGTGTTCCAGG - Intronic
985030959 4:185788952-185788974 TTCGGTAACCACAAGGGTGCTGG + Intronic
985192000 4:187384484-187384506 TTTGGTATACACAGGGCTCCTGG - Intergenic
987478178 5:18418309-18418331 TTTGGTATCCACAAGAGTTCTGG - Intergenic
989114576 5:37940049-37940071 TTGGATATCCACAAGGATCTTGG - Intergenic
991724188 5:69519749-69519771 TTGGGTATACATGGGGGTCCCGG - Intronic
992063338 5:73079831-73079853 TAGTATATACACAGGGGTCCTGG + Intronic
992186569 5:74250251-74250273 ATGGGGAGACACAAGGGTGCTGG + Intergenic
992210282 5:74472740-74472762 TTTGGTATCCATGAGGGTCCTGG + Intergenic
992710700 5:79452030-79452052 TTTAGTATACATAGGGGTCCCGG - Intronic
994628265 5:102249313-102249335 TTGGGTATATGCAGGGGTCCGGG + Intronic
995346768 5:111130195-111130217 TTTGGTATCCACAGGGGTCCTGG - Exonic
995396014 5:111687916-111687938 TTTGGTATTCACAGGGGTCCTGG + Intronic
995764158 5:115597714-115597736 TTTGGTATATGCAGGGGTCCTGG - Intronic
996090854 5:119350413-119350435 TTTGGTATCCTCAAGGGTCTTGG + Intronic
996362453 5:122665003-122665025 TTTGGTATCCAGCAGGGTCCTGG + Intergenic
997352556 5:133241439-133241461 CTGGGTATACACAGAGGCCCAGG + Intronic
999526988 5:152417477-152417499 TTTGGTATCCACTAGGGTCCTGG - Intronic
1001006326 5:168053735-168053757 TTTGGTATCCACAGGGGTCCTGG + Intronic
1003363344 6:5449928-5449950 TTTGGTATACTCAGGAGTCCTGG - Intronic
1004083678 6:12422279-12422301 TTTGGTATATGCAGGGGTCCTGG + Intergenic
1005524156 6:26629139-26629161 TTTGGTATACCACAGGGTCCTGG + Intergenic
1006015166 6:31075053-31075075 TTTGGTATACACAGGAGTCTTGG + Intergenic
1006775545 6:36589701-36589723 TTTGGTATCCTCAGGGGTCCTGG - Intergenic
1007741722 6:44014005-44014027 TTTGGTATCCGCAGGGGTCCTGG - Intergenic
1008777167 6:55054115-55054137 TTTGGTATCCACAAGAGTCCTGG - Intergenic
1010407866 6:75525772-75525794 TTTGGTATACTCAACAGTCCTGG - Intergenic
1010740339 6:79495388-79495410 TTTGGTATCCACAGGAGTCCTGG - Intronic
1010979785 6:82358755-82358777 TTTGGTATCCGCAAGGATCCTGG - Intergenic
1011742852 6:90380416-90380438 TTTGGTATCCAGAGGGGTCCTGG - Intergenic
1013063046 6:106656203-106656225 TTTGGTATCCACAGGGGTCTTGG + Intronic
1015372730 6:132473318-132473340 TTTGGTATCCACAGGGGTCCTGG - Intronic
1015794665 6:136998945-136998967 TTTGGTATCCTCAGGGGTCCTGG - Intergenic
1018129110 6:160711264-160711286 TTTGGTAGCCACAGGGGTCCTGG - Intronic
1019844539 7:3484418-3484440 TTCGGTAAACATGAGGGTCCTGG + Intronic
1023901222 7:44481199-44481221 TTTGGTATCCACGAGGGACCAGG + Intronic
1024789866 7:52953263-52953285 TTTGCTATATACCAGGGTCCTGG + Intergenic
1024874076 7:54000865-54000887 TTTGGTATCCACAGGGGTCTTGG + Intergenic
1026051863 7:66953517-66953539 TTCGATATCCACCAGGGTCCTGG - Intronic
1026073017 7:67139519-67139541 TTTGGTATCCACGGGGGTCCTGG - Intronic
1026818786 7:73532670-73532692 TTTGGTATCCACCAGGGTCCTGG + Intergenic
1027877031 7:83784063-83784085 TTTGGTATCCACAAGGGTACTGG - Intergenic
1028106427 7:86884570-86884592 TTTGGTATACTCAGGGGCCCTGG + Intronic
1028291504 7:89070955-89070977 TTTGGTATCCACAGGGGTCCTGG - Intronic
1030087290 7:105827646-105827668 TTTGGTATACCCAGGGGTCCTGG + Intronic
1031280952 7:119798331-119798353 TTTGGTATCCACAGGGGTTCTGG + Intergenic
1031919705 7:127591597-127591619 TTGGGTGTACTCTAGGGGCCAGG + Exonic
1032305405 7:130729408-130729430 TTTGGTATACACAGGGATCCTGG - Intergenic
1032774066 7:135091323-135091345 TTTGGTATACATGGGGGTCCTGG - Intronic
1038801261 8:30751066-30751088 TTTGGTATACTCAGGAGTCCTGG + Intronic
1041078501 8:54190892-54190914 CTGGGTATCCAAGAGGGTCCTGG + Intergenic
1045346397 8:101297683-101297705 TTGGGTATGCCCAATGATCCAGG - Intergenic
1045999783 8:108405919-108405941 TTTGGTATATGCAGGGGTCCTGG - Intronic
1046002176 8:108434292-108434314 TGGGGAATACAAAAGGGTACAGG + Intronic
1046397061 8:113654584-113654606 TTTGGGATCTACAAGGGTCCTGG - Intergenic
1046992366 8:120473003-120473025 TTTGTTATCCACAGGGGTCCTGG - Intronic
1050647878 9:7741473-7741495 TTTGGTATCCACGAGAGTCCTGG + Intergenic
1051607652 9:18930963-18930985 GTGTGTATACCCAAGGCTCCTGG - Intronic
1051688350 9:19682341-19682363 TTGGGCTTACAGAAGGGCCCAGG - Intronic
1051831709 9:21286400-21286422 TTGGGTATACTTGAGGGTCGGGG - Intergenic
1052315549 9:27112912-27112934 TTGGGGATACACAAAAGTCATGG + Intronic
1054727483 9:68666839-68666861 TTTGGTATCCACAGGGATCCTGG + Intergenic
1054843807 9:69771271-69771293 TTTGGTATCCACAGGGATCCTGG - Intergenic
1056297817 9:85210299-85210321 TTTGGTATCCACTGGGGTCCTGG - Intergenic
1056372880 9:85975419-85975441 TTTGGTATTCACAGGGGTCCTGG - Intronic
1056904069 9:90629601-90629623 TTTGGTATTCACAGGTGTCCTGG - Intronic
1061496325 9:130976754-130976776 TTTGGTATCCACAGGGGTCCTGG - Intergenic
1185948906 X:4408458-4408480 TTTGGTATCCATAGGGGTCCTGG - Intergenic
1186181812 X:6980894-6980916 TTTGGTATCCACAGGGTTCCTGG + Intergenic
1186446113 X:9630399-9630421 TTTGGTATATACAGGGGTCCTGG - Intronic
1186555239 X:10551001-10551023 TTTGGTATTCATAGGGGTCCTGG - Intronic
1188074957 X:25763983-25764005 TTTGGTATACATGAGGGTCCTGG + Intergenic
1188197727 X:27259002-27259024 TTTGGTATCCACATGGGGCCTGG + Intergenic
1189033686 X:37474807-37474829 TTTGGTACAGAGAAGGGTCCTGG - Intronic
1189454295 X:41170939-41170961 TTGGGTATATGCAGAGGTCCTGG - Intronic
1190250419 X:48719783-48719805 TTTAGTATCCACAGGGGTCCTGG + Intergenic
1190378763 X:49817466-49817488 TTTGGTATCTACAAGGGTCCTGG + Intergenic
1190384880 X:49875361-49875383 TTTGGTATCCACAGGGGTCCTGG + Intergenic
1190911154 X:54773932-54773954 TTGGGCCTACCCTAGGGTCCTGG - Intronic
1193596747 X:83455545-83455567 TTGGGTACACACGGGGTTCCTGG - Intergenic
1194452277 X:94059188-94059210 TTTGGTATCCACTGGGGTCCTGG - Intergenic
1196160887 X:112481068-112481090 TTTGTTATCCACAGGGGTCCTGG - Intergenic
1196173458 X:112615545-112615567 TTTGGTATCCAAAGGGGTCCTGG + Intergenic
1196402019 X:115326826-115326848 TTTGGTATCCACTGGGGTCCTGG - Intergenic
1196776353 X:119341437-119341459 TTGAGTATAAACTAGAGTCCTGG - Intergenic
1197010514 X:121556562-121556584 TTGGGTATACACAAGGTAGTGGG - Intergenic
1197657696 X:129135250-129135272 TTTGGTATCCACGAGGGTTCTGG + Intergenic
1197741923 X:129901721-129901743 TTTGGTATCCATGAGGGTCCTGG - Intergenic
1199680440 X:150220787-150220809 CTTGGTATACACACGGATCCAGG + Intergenic
1200341718 X:155404025-155404047 TTGGGTATACATGGAGGTCCTGG - Intergenic
1200842793 Y:7800568-7800590 TGAAGTATACACAAGGGTTCAGG + Intergenic