ID: 1101391738

View in Genome Browser
Species Human (GRCh38)
Location 12:104307164-104307186
Sequence CTGCTTACCTTGAAGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101391737_1101391738 11 Left 1101391737 12:104307130-104307152 CCTCATCATTTTTGAAATTTTGA 0: 1
1: 0
2: 8
3: 63
4: 786
Right 1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG 0: 1
1: 0
2: 3
3: 32
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101391738 Original CRISPR CTGCTTACCTTGAAGAAAAA AGG Intronic
900230082 1:1552267-1552289 GTGGTTACCTTTGAGAAAAATGG - Intronic
901199807 1:7460296-7460318 TTGCTGACCTTGAATGAAAAGGG + Intronic
901363786 1:8727798-8727820 CTGCTGACCTTTAAGAATAGTGG - Intronic
906302818 1:44696011-44696033 CAGCCTAGCCTGAAGAAAAAGGG + Intronic
907745551 1:57209554-57209576 CCTCTTACCTTGAAAAACAAAGG - Intronic
908365519 1:63419355-63419377 CAGCTAACCTTTAAGAAAAAAGG - Exonic
908525908 1:64987138-64987160 CTGCCTACCTTGAGGAACTAAGG - Intergenic
909034179 1:70578698-70578720 CTTCTTTCCTTGAATGAAAATGG + Intergenic
909443169 1:75720341-75720363 CTGCTTACCTTGAAATAGATGGG + Intergenic
911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG + Intronic
914667870 1:149847083-149847105 CTGCTTGCTTTGAAGACAGAGGG - Intronic
916098578 1:161373627-161373649 CAGGTTACCTTAAACAAAAAAGG + Exonic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917502239 1:175596251-175596273 CTTCTTACCGTGCAGAAACACGG - Intronic
918036444 1:180877732-180877754 ATGCTTATCTTAAAAAAAAAAGG + Intronic
918497138 1:185153520-185153542 CTGGTGACCTTTAAGAAAACAGG + Intronic
919263473 1:195230220-195230242 CTGACTAGCTTGAAGAGAAAAGG + Intergenic
921482733 1:215681498-215681520 CTTCTTTCCTTGATGAACAAGGG + Intronic
923122956 1:231010547-231010569 CTTCTTCCCTTGGAGAAAAAAGG - Intergenic
923125839 1:231033669-231033691 ATGCTTACCTTTAAACAAAAGGG + Intronic
1064332999 10:14411285-14411307 CTGCTTTCTTGGAAGAAAAAAGG - Intronic
1064600623 10:16988654-16988676 GTTCTTACCTTGAAAAGAAATGG - Intronic
1064983816 10:21190023-21190045 CTTCTTGCCCTGAAGCAAAAAGG - Intergenic
1065176654 10:23082636-23082658 GTGGTTCCCTTGAGGAAAAAAGG + Intergenic
1065187483 10:23183091-23183113 GTGCTTTCATTGAAGAAATATGG + Intergenic
1066750571 10:38652168-38652190 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1066966479 10:42270944-42270966 CTGCTTTTGGTGAAGAAAAAAGG - Intergenic
1069312013 10:67049582-67049604 GTGTTTAACTTGAACAAAAAAGG + Intronic
1070930911 10:80259965-80259987 CTGGTTACCTTGATGAAGGAAGG - Intergenic
1070945825 10:80390819-80390841 CAGCTTTCTTTTAAGAAAAACGG - Intergenic
1071549329 10:86554356-86554378 CTGCTTAACTTAAGCAAAAATGG + Intergenic
1072571119 10:96658294-96658316 CTGGTTTCCTGGAAGAAAATTGG + Intronic
1073498029 10:103911853-103911875 CTGTTTCCCTTGTAGACAAAGGG + Intronic
1075125540 10:119696158-119696180 CTGATTAATTTGAAGAAAGATGG - Intergenic
1075189249 10:120291280-120291302 CTGGTGACCTTAAAGAAAAATGG + Intergenic
1075353178 10:121744741-121744763 CTGTGTACCCTGAAGAAAACCGG - Intronic
1077376766 11:2208931-2208953 CTCCCTACCAGGAAGAAAAAGGG - Intergenic
1078951294 11:16137618-16137640 CTGCTTACCTTAAGGAATCAAGG + Intronic
1079711508 11:23688905-23688927 CTGCTTGCCTTGAAGAAAGAAGG - Intergenic
1079779789 11:24587067-24587089 CTACTTTCCTTGCAGAAAATTGG + Intronic
1080459733 11:32443475-32443497 CTGCTTATTTTGAAGAACATGGG - Intergenic
1081238843 11:40679264-40679286 CTGTTTCCCTTTAAAAAAAAAGG - Intronic
1084470897 11:69358460-69358482 GTTCTTTCCTTGAAGAAAATGGG + Intronic
1085826119 11:79849495-79849517 ATGTTTACCTTAAAGAAAAAAGG + Intergenic
1087351254 11:97035644-97035666 GAGCTTACCATGAAGAACAAGGG + Intergenic
1089645846 11:119878236-119878258 GTACATACTTTGAAGAAAAATGG + Intergenic
1091326034 11:134688648-134688670 CTGTATACCTTGGAGCAAAATGG + Intergenic
1092190639 12:6517485-6517507 CTACTTACCTTGCAGGAGAAAGG - Exonic
1092319008 12:7451539-7451561 CTGTTTACTTTGAGGAAACAAGG - Intronic
1092649050 12:10613327-10613349 CTGCTTCCCTCGAAGGAAATAGG - Intronic
1093888301 12:24488994-24489016 TTGCTTGCCTAGAAGACAAATGG - Intergenic
1094290677 12:28845598-28845620 CTACTGAGCTTGAAGAAATATGG - Intergenic
1095425895 12:42074494-42074516 CTGCTTGGTTTGAAGAGAAAGGG + Intergenic
1095913000 12:47447907-47447929 CTTATTATTTTGAAGAAAAAGGG - Intergenic
1096922808 12:55107071-55107093 GTTCCTACCTTGAAAAAAAAAGG + Intergenic
1098389689 12:69956479-69956501 CTACTTTCCATGAAGATAAATGG + Intronic
1099481136 12:83168064-83168086 GTGCTTACCCTGAAGGAATAAGG - Intergenic
1100530388 12:95456540-95456562 CTGCAAACCTTGAAAAAGAAGGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101432556 12:104638653-104638675 CTGCTAACTTTGCAGAAGAATGG + Intronic
1105465868 13:20639475-20639497 CTGCCAACCTTGAAGAATAGGGG + Intronic
1105986121 13:25569275-25569297 CTTCTTATCATGAAGAGAAAAGG - Intronic
1107072877 13:36290949-36290971 CTGCATACCTTGACCAAAAAAGG + Intronic
1107140667 13:36995426-36995448 CTTCATACAATGAAGAAAAACGG - Exonic
1107992022 13:45827011-45827033 CTGTTAGCCATGAAGAAAAAAGG - Intronic
1108065850 13:46577029-46577051 CTGCTGGCCTGAAAGAAAAAAGG - Intronic
1108215971 13:48184866-48184888 TTCCTTCCCTTGAAGAAAAGGGG + Intergenic
1108404197 13:50083224-50083246 CTGTCTACCTTCAAAAAAAATGG + Intronic
1110308947 13:74023879-74023901 CTGGTGATCTTGAAGAAAAGGGG + Intronic
1111646687 13:91040371-91040393 CTGCTCATCTTGAAGAGAATGGG - Intergenic
1113325497 13:109277592-109277614 CCCCTTACTTTAAAGAAAAATGG - Intergenic
1115836653 14:37413404-37413426 TTGCTCACCTTGAAGATGAAAGG - Intronic
1117550106 14:56826485-56826507 TTGTTAACCTTGAAGAAGAATGG + Intergenic
1122384278 14:101333430-101333452 CTGGTGACCCAGAAGAAAAAGGG + Intergenic
1124608760 15:31193277-31193299 CTGCTTTCCCTCAGGAAAAATGG + Intergenic
1124829825 15:33137402-33137424 CTGCCTACCTTGAATGAGAAGGG + Intronic
1125305357 15:38306177-38306199 ATGATTACCTTTGAGAAAAAAGG - Intronic
1126431880 15:48594474-48594496 CTGCTCCCCTTCAGGAAAAAGGG - Intronic
1126652184 15:50935708-50935730 CTGCGGACCTTTAAGAACAATGG + Intronic
1126683629 15:51227771-51227793 CTGCTTACCTTTCATAAAGAAGG + Exonic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1127401621 15:58592574-58592596 CTGGTTCCCTTGAAGAAAAATGG + Exonic
1130351597 15:83097234-83097256 CTGTTTACGTTGATGAATAAAGG + Intergenic
1130372021 15:83293101-83293123 CTACTATCCTTAAAGAAAAATGG - Intergenic
1131019533 15:89086936-89086958 CATGTTACCTTGAAAAAAAAAGG - Intergenic
1131338811 15:91576437-91576459 CTACTTACCTTGCAGAAATTAGG - Intergenic
1131366038 15:91841340-91841362 CTACCTAACTTTAAGAAAAAGGG - Intergenic
1131383881 15:91986468-91986490 CTGCATACTTTAAAAAAAAATGG - Intronic
1131588615 15:93722856-93722878 CTGCTCAGTTTAAAGAAAAAAGG - Intergenic
1131684020 15:94751910-94751932 GTTCTTACCTTCCAGAAAAATGG - Intergenic
1131768458 15:95706877-95706899 CTGATTACCTTAGAGAATAATGG + Intergenic
1131936828 15:97515511-97515533 CTCCTTCTTTTGAAGAAAAAGGG + Intergenic
1133044606 16:3080731-3080753 CTTATTATTTTGAAGAAAAAGGG - Intronic
1135153124 16:20027478-20027500 CTACATACCTTGAAGACAACTGG + Intergenic
1137719221 16:50618168-50618190 CTGCTCATTTGGAAGAAAAAAGG - Intronic
1138120767 16:54399383-54399405 CTCCTTACCTTGAAGAGCAAAGG + Intergenic
1138166784 16:54809469-54809491 CTGCCTTCCTTGAAGCTAAATGG + Intergenic
1139633403 16:68244319-68244341 CTGCTTACCAAGAAGAAGGAAGG + Intergenic
1140111176 16:72006478-72006500 CTGCTGACCTTGAAGAAACTGGG - Intergenic
1140397028 16:74636338-74636360 CTCTTTACCTGGAAGAAAAGAGG + Exonic
1141804205 16:86332020-86332042 CTGCTGACTTTGAAGATTAAGGG - Intergenic
1141862979 16:86730559-86730581 CTGCTGAGCTTGTACAAAAAAGG + Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143763784 17:9124153-9124175 CTGCTGATTTTTAAGAAAAATGG - Intronic
1144092264 17:11868751-11868773 CTGCTTGAGTTGGAGAAAAATGG - Intronic
1153898954 18:9598090-9598112 TGTGTTACCTTGAAGAAAAAGGG + Intronic
1156565648 18:38186509-38186531 CTGCTGAACTTAAAGAAATATGG - Intergenic
1159823429 18:73175467-73175489 ATGCTTAACTTGAAGGAGAATGG - Intronic
1159938688 18:74388992-74389014 CTGCTTTCCTGGCAGAGAAATGG - Intergenic
1160556037 18:79725894-79725916 CAGCTTACCTACAGGAAAAACGG - Intronic
1164744004 19:30598121-30598143 CTTCTTGACTTGAAGAATAAAGG + Intronic
925241997 2:2339453-2339475 ATGCTCACCTTGTAGACAAAAGG + Intergenic
925265239 2:2562352-2562374 CTGCTTAATTTGGAGCAAAATGG - Intergenic
927020372 2:19010476-19010498 CTGCTTAGAATGAAGAAAAGAGG + Intergenic
927375214 2:22405424-22405446 CTGCTGACCATTAAGGAAAAGGG + Intergenic
929718022 2:44333273-44333295 GTTCTTAACTTTAAGAAAAAAGG + Intronic
929846222 2:45531128-45531150 CTGCTTTCCTTGAAAAGAAAAGG + Intronic
929966051 2:46537513-46537535 CTTCTTTCCTGGAAGCAAAATGG - Intronic
931942425 2:67267342-67267364 TTGCTTAACTGGCAGAAAAATGG + Intergenic
934313571 2:91894325-91894347 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
935359966 2:102238656-102238678 CTGGTTTCCTTGAAGAACAGAGG + Intronic
935384883 2:102489490-102489512 CTTCTGAACTTGAAGAAAGATGG - Intronic
936691095 2:114889804-114889826 CTGCAAAACATGAAGAAAAAGGG - Intronic
939218009 2:139265074-139265096 CTAGTTTCCTTGTAGAAAAATGG + Intergenic
939543904 2:143528810-143528832 ATGCCTACCTTCAAGACAAAAGG - Intronic
940047523 2:149425062-149425084 CAGCTTATCTGGAAGAAAAAAGG - Intronic
940395186 2:153182008-153182030 CTGCTTATTATTAAGAAAAATGG - Intergenic
941613155 2:167685922-167685944 CTGCTTTACTTAAATAAAAAAGG + Intergenic
942438766 2:176009434-176009456 TTGCTGACTTTGAAAAAAAATGG + Intergenic
942701172 2:178712476-178712498 TCGGTTACCTGGAAGAAAAATGG - Exonic
942855709 2:180544721-180544743 ATGGTTACATTGAACAAAAAAGG - Intergenic
943599994 2:189905533-189905555 CTGCAGACCTTGAAGACAAAAGG - Intronic
943679954 2:190758026-190758048 CTTCTTAACTGTAAGAAAAATGG - Intergenic
944756001 2:202762286-202762308 CTGTTTACCTGAAAGAAAATAGG + Intronic
946808058 2:223492067-223492089 TTGCTCACCTTGAAGATAGAGGG - Intergenic
946851812 2:223914835-223914857 CTGCTTTAGCTGAAGAAAAATGG - Intronic
947288809 2:228547990-228548012 CTGTTTACTTAGAAGAATAAAGG + Intergenic
948156279 2:235785218-235785240 CTTCTCACTTTTAAGAAAAATGG - Intronic
1169103991 20:2978573-2978595 CTTCTTTCCTTGAAAACAAAGGG - Intronic
1169271213 20:4200739-4200761 CTGCCTACATTGAAGAACACAGG - Intergenic
1169407952 20:5340457-5340479 GTGCTTACATTAAAGAAACAAGG + Intergenic
1169744372 20:8928579-8928601 CTGGTTACTTGGAAGAAAGAGGG - Intronic
1171539832 20:25940159-25940181 ATGCTTACCTTGAAAGAAAGAGG - Intergenic
1171801227 20:29620179-29620201 ATGCTTACCTTGAAAGAAAGAGG + Intergenic
1171842751 20:30235378-30235400 ATGCTTACCTTGAAAGAAAGAGG - Intergenic
1172695174 20:36817450-36817472 CAGCATTCCTTGAAGAAAAGAGG - Exonic
1172922486 20:38496968-38496990 CTGCTCACATTGAAGCAGAATGG - Intronic
1177868712 21:26544627-26544649 CTGGTGACCCTGAAGAAACACGG + Intronic
1178134657 21:29613959-29613981 CTGCTTGCCCTGAAAAAAATAGG + Intronic
1179033855 21:37743163-37743185 TTGCTTACCTTGAAGATTGAGGG - Intronic
1180540311 22:16440229-16440251 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1184298799 22:43543007-43543029 CTGCTTACGATGTAGAAAAGTGG + Intronic
950912342 3:16607118-16607140 CTACTTACCTTGAATAAGAATGG + Intronic
951534354 3:23727889-23727911 CTGCCTACATTAAACAAAAAGGG - Intergenic
954576262 3:51678003-51678025 TTGCATACCTTGAAGAGGAATGG - Intronic
954637636 3:52079854-52079876 CTGCTGACCTTGGAGAAACCAGG + Intronic
956276434 3:67506686-67506708 TTGCTTTGCATGAAGAAAAATGG - Intronic
957665931 3:83226937-83226959 ATGCTTAGGTTGAAGAAAATTGG - Intergenic
958593802 3:96195283-96195305 CTGCTAGCCTTGAAGATGAATGG - Intergenic
958847673 3:99284852-99284874 CTGTTTATTTTGAAGGAAAAGGG + Intergenic
959143870 3:102520683-102520705 CTTCTTACCATTAAGTAAAATGG - Intergenic
962858195 3:139369537-139369559 TTGCATACCTGGGAGAAAAAAGG + Exonic
963398200 3:144760101-144760123 CTTCTTACTATGAAAAAAAAAGG - Intergenic
963927367 3:150965259-150965281 CTGTTTCTCTTGAAGAAATATGG - Intronic
965316358 3:167195571-167195593 GTGCCTACCAGGAAGAAAAATGG - Intergenic
965482661 3:169239203-169239225 TTGATTACCTTTAAGAAAAAAGG - Intronic
966548260 3:181175670-181175692 ATGCATGCCTTGAAGGAAAATGG + Intergenic
966575160 3:181492883-181492905 CAGCTTCCCTTGAAGAATACAGG - Intergenic
969405664 4:6989803-6989825 CAGCTAAGGTTGAAGAAAAAAGG - Intronic
971512209 4:27440746-27440768 GTGCTCACCTAGAAGAAAAATGG - Intergenic
971941134 4:33217093-33217115 GTGCTTTCCTTGAAGACAAAGGG - Intergenic
972591925 4:40496077-40496099 CTGCTTTCCTCTGAGAAAAAAGG + Intronic
974178191 4:58351717-58351739 AAGCTTTCCTTGAAGAATAAAGG - Intergenic
974509908 4:62825625-62825647 CTGCCTACCATGAAGAAAAGAGG - Intergenic
974641562 4:64639456-64639478 CTGTTTTCCATTAAGAAAAAGGG + Intergenic
975887485 4:78982679-78982701 CTGCTGACCTTGAAGATGAAGGG + Intergenic
976346671 4:84011017-84011039 CTGCTTAAGTTGAATAAAAGGGG + Intergenic
977241395 4:94574534-94574556 CTGTTTAATTTTAAGAAAAAAGG - Intronic
977945773 4:102912376-102912398 CTGCTTTTGGTGAAGAAAAAAGG + Intronic
979012055 4:115384613-115384635 CTGGTTAGGTTGCAGAAAAAAGG - Intergenic
979094129 4:116522583-116522605 TGGCTTAGCTTGAATAAAAACGG + Intergenic
979101648 4:116624356-116624378 TTGCTTATCTTGTATAAAAATGG + Intergenic
979785315 4:124710446-124710468 CTGCTTCCCTTGCAGTAAACTGG + Exonic
979993170 4:127399999-127400021 CTTCTTACCATGGAGAAATATGG + Intergenic
980241907 4:130188826-130188848 CTTCTTACCGTGGAGAATAACGG - Intergenic
981512098 4:145568576-145568598 ATGCTAACCTTGAATATAAATGG + Intergenic
982041349 4:151399860-151399882 CTACTTTCCTTTAAAAAAAATGG + Intergenic
982234305 4:153238061-153238083 CCTCTTACCTCCAAGAAAAAGGG + Intronic
982465678 4:155727977-155727999 CTGCTTTCCAGGAAGGAAAATGG + Intronic
983098352 4:163593348-163593370 CTGCATACATTGAAGTAAAAAGG + Intronic
984240067 4:177207595-177207617 CTGCTTACATTTAAGAATGAGGG + Intergenic
984361320 4:178737172-178737194 ATCCTTATCTTCAAGAAAAAAGG + Intergenic
984488204 4:180399415-180399437 GTGGTTGCCTTGAAGAAAATTGG + Intergenic
984489896 4:180420005-180420027 TTGCTTTCCTTTAACAAAAATGG - Intergenic
984631880 4:182069850-182069872 GTCCTTACCTTGAAGAAGAGGGG - Intergenic
984734062 4:183094474-183094496 CTGATCTCCTTGAAGAAACAAGG + Intergenic
985037276 4:185853135-185853157 ATCCTTAACTTGAAGAAAAAGGG + Intronic
985215826 4:187652558-187652580 CTTGATACTTTGAAGAAAAACGG - Intergenic
985426894 4:189839985-189840007 CTGCTTCCCTGAAAGAAATACGG + Intergenic
987499554 5:18690654-18690676 CTCCTCATATTGAAGAAAAAAGG - Intergenic
987574064 5:19703515-19703537 CTCATTATTTTGAAGAAAAAGGG + Intronic
988054252 5:26072899-26072921 TTGCTTCCCATGAAGAAAACAGG - Intergenic
988419744 5:30990980-30991002 CAGCTTACTTTGGAGAAACATGG + Intergenic
989403894 5:41039135-41039157 CTGCTTTCCCTGAAGGAAAGGGG - Intronic
991895478 5:71393126-71393148 GTGTTTACCTTGTAGACAAATGG + Intergenic
991933391 5:71778420-71778442 ATGCTTAGCTTAAACAAAAACGG + Intergenic
992270464 5:75057528-75057550 CTGATTATCTTAAAGAAATAGGG + Intergenic
992299228 5:75360915-75360937 TTTCTTCCCTTGAAGAAAACAGG - Exonic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
995215020 5:109585216-109585238 CTGCTTCCTTTGAAGAAATGTGG + Intergenic
995967553 5:117927302-117927324 CTGCTTTCATTGCATAAAAAAGG - Intergenic
998086136 5:139325218-139325240 CTGCTTTACTTGAAGGGAAACGG - Intronic
999611912 5:153378893-153378915 TTGCTTAAGTTGTAGAAAAAGGG - Intergenic
1000753133 5:165121985-165122007 CTGCTTTCCTTTAAAAACAAAGG - Intergenic
1000962364 5:167614863-167614885 CTGCTTGCCTTGTGGAAGAATGG - Intronic
1003396095 6:5753220-5753242 CTGCAAACTTTGAAGAAAGATGG + Intronic
1007729075 6:43934934-43934956 CTGCTTTCCTTTAAGAATAGGGG - Intergenic
1007837126 6:44682370-44682392 CTGGTTTCCTAGAAAAAAAAGGG + Intergenic
1009033019 6:58082861-58082883 ATACTTACCTTGAACATAAATGG + Intergenic
1009208636 6:60834629-60834651 ATACTTACCTTGAACATAAATGG + Intergenic
1011368677 6:86609001-86609023 ACGCTTACCTTGAATAAGAAAGG + Intergenic
1011646756 6:89466326-89466348 TTACTTTCCTTGAAGAGAAATGG + Intronic
1011855326 6:91682709-91682731 CTGCAGACCATGTAGAAAAAAGG - Intergenic
1012429860 6:99153055-99153077 CTGCTGGCCTTGAAGAAACAAGG + Intergenic
1014668035 6:124263992-124264014 CTGTTTTCCTTGTAGGAAAAAGG + Intronic
1015155328 6:130088580-130088602 CAGATGACATTGAAGAAAAATGG + Intronic
1015363197 6:132365332-132365354 CTGCCTCCCTTGAAGTTAAAAGG - Intronic
1016525557 6:144998149-144998171 CTTCTGAGCTTAAAGAAAAAAGG + Intergenic
1016732531 6:147442309-147442331 GTGCTTAGCTTGAACAAAACAGG + Intergenic
1017522899 6:155217573-155217595 CTGCTTACCTTGTAGAAAATGGG - Intronic
1017540748 6:155399977-155399999 CTGCTGACTTTGATGAGAAAAGG + Intronic
1017917622 6:158844275-158844297 TTCCTTACCTTTTAGAAAAAGGG - Intergenic
1018432710 6:163735510-163735532 ATGCCTACTTTGAAGAGAAAGGG + Intergenic
1019884687 7:3893529-3893551 TTGCTTACCCTGAAGAAATACGG - Intronic
1020567545 7:9817197-9817219 CCTCTTACCTTTAAGAAAACAGG - Intergenic
1020656539 7:10935183-10935205 CTGCTTAGTTTTAAGAAAATTGG - Intronic
1020740067 7:12004748-12004770 CTTCCTCCCTAGAAGAAAAAGGG - Intergenic
1020975034 7:14995508-14995530 GTGATAACCTTAAAGAAAAAGGG - Intergenic
1021615457 7:22498858-22498880 CTCCTTACCATGCAGACAAATGG - Intronic
1024448595 7:49512360-49512382 CTGCTGGCCTTGAAGAAATAAGG - Intergenic
1024710442 7:52009423-52009445 CTGCTTGCCAAGTAGAAAAAGGG + Intergenic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1024878540 7:54056539-54056561 CTGTTTTCCTTTGAGAAAAATGG - Intergenic
1025291211 7:57726092-57726114 ATGCTTACCTTGAAAGAAAGAGG - Intergenic
1026734969 7:72943471-72943493 CTGCTCACGTTGAAGGCAAACGG - Exonic
1027355772 7:77353509-77353531 CTGCTTTCCCTCAAGCAAAAAGG + Intronic
1027435257 7:78157862-78157884 CAGCTTTTCATGAAGAAAAAGGG + Intronic
1027610225 7:80351413-80351435 CTGTTTACCTAGAGGAGAAAAGG - Intergenic
1027736763 7:81942222-81942244 CTGGTTATATTGAAAAAAAAAGG - Intergenic
1028377042 7:90155772-90155794 CTCCTTACCATGCAGACAAATGG + Intronic
1028546919 7:92012251-92012273 CTACTTTCCTTGAAAAAGAAAGG + Intronic
1028879451 7:95863645-95863667 CTAGTTACCTTGAAAAATAAAGG - Intronic
1030522468 7:110615210-110615232 CTGCTCAGCATGCAGAAAAAGGG - Intergenic
1030685931 7:112487162-112487184 ATGCTTACATTGAAAAAAGAAGG + Intronic
1031162787 7:118188654-118188676 CTACTTAACTAGTAGAAAAATGG - Intronic
1031279590 7:119780914-119780936 ATGCTTAGCTTGAAATAAAAGGG + Intergenic
1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG + Intronic
1034115811 7:148582844-148582866 CTGCTGACCTTGAACACAAGAGG - Intergenic
1034686334 7:152974524-152974546 CTATTTACCTTGAAGATACAAGG - Intergenic
1035329602 7:158087727-158087749 CTTCTTCCCTTGATGAAAGAGGG + Intronic
1037161468 8:15778590-15778612 CTGCCTACTTGGAAGAGAAAGGG - Intergenic
1040395097 8:46991159-46991181 CTGCTTTCTTTGAAAAAACAAGG - Intergenic
1041348388 8:56924571-56924593 CTGCTCACCTTAAAGAAGGAAGG + Intergenic
1041503826 8:58571435-58571457 CTCTGAACCTTGAAGAAAAAGGG - Intronic
1043095088 8:75958333-75958355 CTGCATACCTTTAACAAAATAGG - Intergenic
1043473714 8:80585785-80585807 CTCCTTAAGTTGAAAAAAAAAGG - Intergenic
1043608606 8:82033824-82033846 CTACTTACCTAGAAGCAAACTGG - Intergenic
1045274794 8:100693714-100693736 ATGCATACCCTGAAGAAAAATGG + Intronic
1048490792 8:134891759-134891781 CTGTTTTCCTTTAAGTAAAAAGG - Intergenic
1050302987 9:4277625-4277647 CTGCTGTCCTTGGAGACAAAGGG - Intronic
1051522089 9:18000700-18000722 TTGGTTATCTTGAACAAAAAAGG + Intergenic
1052070444 9:24075157-24075179 CTGCTTACCTGGATGTAAAGAGG - Intergenic
1052206218 9:25844268-25844290 CTCATTATCTTGAAGAAAAAGGG + Intergenic
1054165230 9:61719288-61719310 ATGCTTACCTTGAAAGAAAGAGG + Intergenic
1055188126 9:73481453-73481475 ATGATCACCTTGAAGAAAAAAGG - Intergenic
1055549452 9:77418118-77418140 ATTCTAACCTTCAAGAAAAATGG - Exonic
1055550844 9:77431112-77431134 CTGTTACCCTTGGAGAAAAAGGG - Intronic
1057141786 9:92730894-92730916 CCGATTGCCTTGAAGAAAAGCGG - Intronic
1058121082 9:101139668-101139690 ATGCTTACCTGGAAGTAAAATGG - Intronic
1058354493 9:104067094-104067116 CTGAGGACTTTGAAGAAAAATGG - Intergenic
1059260450 9:112971049-112971071 CTGCTTTCCCAGAAGAAAAATGG - Intergenic
1059710527 9:116863726-116863748 CTTCTTCCCTTGGAGAGAAAGGG + Exonic
1059979371 9:119752939-119752961 GTAATTACCTTGAAGAAAACTGG + Intergenic
1060786179 9:126453167-126453189 CCGCTGAACTTGAAGAAATAGGG - Intronic
1186574318 X:10749437-10749459 GTACTCACCTTGAAGAAAGAGGG + Intronic
1186711783 X:12205417-12205439 CCTCTTACCTTGAAGGGAAATGG - Intronic
1186849736 X:13569008-13569030 CTGCCTACCATGAAGCCAAAGGG + Intergenic
1187750444 X:22458016-22458038 CTGATTACCTGGAATAAAACTGG + Intergenic
1188273268 X:28169977-28169999 CTTCTTGGCTTAAAGAAAAAAGG - Intergenic
1188711679 X:33408297-33408319 CTACTAACCTTGAATGAAAATGG - Intergenic
1190402699 X:50054619-50054641 CTGCTTACCTGGAGTAGAAATGG - Intronic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1191217245 X:57946246-57946268 ATACTAACCTTGAATAAAAATGG - Intergenic
1193019964 X:76781017-76781039 CAGCTTACCTTGACTAAAAAAGG + Intergenic
1194410160 X:93547594-93547616 CTGGTAACATTGAAGAGAAAAGG + Intergenic
1195500692 X:105595119-105595141 TTGATTACCTTGTAGAAGAAAGG + Intronic
1196029810 X:111084630-111084652 CTGCTTAACTAGAAAAAAAATGG - Intronic
1197011354 X:121568403-121568425 CAACTTAGCTTGAAGAAAAAGGG - Intergenic
1198634886 X:138686090-138686112 CTGCTAACTTTTAAGAAAAAAGG + Intronic
1198719454 X:139600158-139600180 CTGCTTAGATTGGGGAAAAAAGG + Intronic
1199168559 X:144707542-144707564 CAGCTGACCTTGAACAACAATGG + Intergenic
1199317562 X:146399003-146399025 GTCCTAACCTGGAAGAAAAAGGG - Intergenic
1201181486 Y:11351816-11351838 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1202038851 Y:20662256-20662278 TTGCTGAAGTTGAAGAAAAAGGG - Intergenic
1202282177 Y:23200667-23200689 CTACTTATCTTGAATAAGAATGG + Intergenic
1202283714 Y:23217852-23217874 CTACTTATCTTGAATAAGAATGG - Intergenic
1202433849 Y:24815052-24815074 CTACTTATCTTGAATAAGAATGG + Intergenic
1202435390 Y:24832238-24832260 CTACTTATCTTGAATAAGAATGG - Intergenic