ID: 1101399490

View in Genome Browser
Species Human (GRCh38)
Location 12:104375254-104375276
Sequence AGAGTGCCCCAGCACCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101399484_1101399490 4 Left 1101399484 12:104375227-104375249 CCCACCCAAGTAGGGCGCCAGGG No data
Right 1101399490 12:104375254-104375276 AGAGTGCCCCAGCACCACCAAGG No data
1101399486_1101399490 3 Left 1101399486 12:104375228-104375250 CCACCCAAGTAGGGCGCCAGGGA No data
Right 1101399490 12:104375254-104375276 AGAGTGCCCCAGCACCACCAAGG No data
1101399488_1101399490 -1 Left 1101399488 12:104375232-104375254 CCAAGTAGGGCGCCAGGGAGACA No data
Right 1101399490 12:104375254-104375276 AGAGTGCCCCAGCACCACCAAGG No data
1101399482_1101399490 5 Left 1101399482 12:104375226-104375248 CCCCACCCAAGTAGGGCGCCAGG No data
Right 1101399490 12:104375254-104375276 AGAGTGCCCCAGCACCACCAAGG No data
1101399479_1101399490 16 Left 1101399479 12:104375215-104375237 CCTGGGCTTGGCCCCACCCAAGT No data
Right 1101399490 12:104375254-104375276 AGAGTGCCCCAGCACCACCAAGG No data
1101399487_1101399490 0 Left 1101399487 12:104375231-104375253 CCCAAGTAGGGCGCCAGGGAGAC No data
Right 1101399490 12:104375254-104375276 AGAGTGCCCCAGCACCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101399490 Original CRISPR AGAGTGCCCCAGCACCACCA AGG Intergenic
No off target data available for this crispr