ID: 1101400985

View in Genome Browser
Species Human (GRCh38)
Location 12:104386535-104386557
Sequence ATGTAGTTGCTCACTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101400984_1101400985 11 Left 1101400984 12:104386501-104386523 CCAGGTGGCAACTTTAGGACTCT No data
Right 1101400985 12:104386535-104386557 ATGTAGTTGCTCACTGAAGCTGG No data
1101400983_1101400985 12 Left 1101400983 12:104386500-104386522 CCCAGGTGGCAACTTTAGGACTC No data
Right 1101400985 12:104386535-104386557 ATGTAGTTGCTCACTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101400985 Original CRISPR ATGTAGTTGCTCACTGAAGC TGG Intergenic
No off target data available for this crispr