ID: 1101401123

View in Genome Browser
Species Human (GRCh38)
Location 12:104387997-104388019
Sequence TTACCTTACCATTTGATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101401121_1101401123 -1 Left 1101401121 12:104387975-104387997 CCTGATACAGGTTAGTGGTTCTT No data
Right 1101401123 12:104387997-104388019 TTACCTTACCATTTGATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101401123 Original CRISPR TTACCTTACCATTTGATGAA GGG Intergenic
No off target data available for this crispr