ID: 1101405103

View in Genome Browser
Species Human (GRCh38)
Location 12:104421635-104421657
Sequence CTCGAGATGGTGCATGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101405098_1101405103 22 Left 1101405098 12:104421590-104421612 CCATAGTGGGTTGTGAGGATTAA No data
Right 1101405103 12:104421635-104421657 CTCGAGATGGTGCATGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101405103 Original CRISPR CTCGAGATGGTGCATGTGCC TGG Intergenic
No off target data available for this crispr