ID: 1101407377

View in Genome Browser
Species Human (GRCh38)
Location 12:104440702-104440724
Sequence TGTCACCTGCTGAGTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101407369_1101407377 19 Left 1101407369 12:104440660-104440682 CCTGATGAGGGGGAGACCAATTC No data
Right 1101407377 12:104440702-104440724 TGTCACCTGCTGAGTGGGGAGGG No data
1101407370_1101407377 3 Left 1101407370 12:104440676-104440698 CCAATTCTTTCGTGAACAGATTG No data
Right 1101407377 12:104440702-104440724 TGTCACCTGCTGAGTGGGGAGGG No data
1101407366_1101407377 30 Left 1101407366 12:104440649-104440671 CCAGGAACTGGCCTGATGAGGGG No data
Right 1101407377 12:104440702-104440724 TGTCACCTGCTGAGTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101407377 Original CRISPR TGTCACCTGCTGAGTGGGGA GGG Intergenic
No off target data available for this crispr