ID: 1101408918

View in Genome Browser
Species Human (GRCh38)
Location 12:104453332-104453354
Sequence CCTGGGAAAGAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1215
Summary {0: 1, 1: 0, 2: 10, 3: 130, 4: 1074}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101408918 Original CRISPR CCTGGGAAAGAGAAGGAGGA AGG (reversed) Intergenic
900149108 1:1170566-1170588 CCTGAGCAAAAGAAGGAGGGAGG - Intergenic
900708200 1:4093921-4093943 GCTGGAAAGAAGAAGGAGGAGGG - Intergenic
900735989 1:4299876-4299898 TCTGGAAGAGGGAAGGAGGAAGG - Intergenic
900758385 1:4454020-4454042 CCTGGGCAAGAGATGGAGGGTGG - Intergenic
900961399 1:5923370-5923392 GCTGGGAAACAGAAGAGGGAAGG + Intronic
901161859 1:7183638-7183660 ACTGTGAAAAAGAAAGAGGATGG + Intronic
901187430 1:7384082-7384104 CCTGGGAAAGAAAAGGTGGCAGG + Intronic
901721963 1:11206088-11206110 CCTCTGAATGAGAAGGAAGAGGG + Intronic
902191142 1:14764151-14764173 CCTGGGAAAGACCGGCAGGAGGG + Intronic
902292606 1:15445225-15445247 CCTGGGAAGGTGAGGAAGGAGGG - Intronic
902304646 1:15526843-15526865 CCTGGGGAGGGGAAAGAGGAGGG - Exonic
902892551 1:19454942-19454964 CTTGGTAAAGGGAAGGAAGAGGG + Intronic
903139145 1:21328248-21328270 CCTGGCAGAGAGCAGGAGCAGGG - Intronic
903243355 1:21998807-21998829 TCTGGGAAGGAGAGGGAGGGCGG - Intergenic
903305987 1:22413721-22413743 CCAGGGAAGAGGAAGGAGGAAGG - Intergenic
903382860 1:22909000-22909022 CCTGGGAGACAGAAAGAGGAGGG - Exonic
903765475 1:25731634-25731656 CCTGTGTTAGAGAGGGAGGAAGG - Intronic
904002688 1:27347846-27347868 GCTGTGAAAGAGAAGGAAGAGGG + Exonic
904478085 1:30777399-30777421 CCTGAGAAAGATTAGGGGGATGG - Intergenic
904810004 1:33157276-33157298 CCTGGGAAACAGAGGGAGACTGG + Intronic
905105960 1:35563745-35563767 CCTGGAAAAGAAAGGGGGGAAGG - Exonic
905456602 1:38092427-38092449 CCTGTCAAGGAGAAGGAAGAAGG - Intergenic
905506666 1:38485315-38485337 AGTGGGAAAGAAAAGGATGAGGG + Intergenic
905789178 1:40781357-40781379 GGTGGGAGAGGGAAGGAGGAGGG + Intergenic
905875218 1:41427881-41427903 GCGGGGAGAGAGAGGGAGGAGGG - Intergenic
905997278 1:42392233-42392255 CCAGGGAGAGCAAAGGAGGAGGG - Intronic
906025301 1:42668416-42668438 AATGGGAAAGAGAAGAAGAAAGG - Intronic
906279603 1:44544071-44544093 CCTGGGGATGAGGAGGAAGATGG - Intronic
906477357 1:46178621-46178643 CCTGAGGAAGAGGAGGAGCAGGG - Intronic
906635748 1:47409374-47409396 CCTGGAAATGAGAAGCAGGAAGG + Intergenic
906720084 1:47997734-47997756 CCTGGCGAAGGGAAGGAGGAGGG - Intergenic
906726526 1:48048455-48048477 CCTGGGAAAAGGAAGGTGGCTGG + Intergenic
906782722 1:48586782-48586804 CCTGGGAAAGATTTGGAGCATGG + Intronic
906810009 1:48817098-48817120 ACTGGGAAAAAAAATGAGGAGGG + Intronic
907165976 1:52411706-52411728 ACTAGGAAAGGGAAGCAGGATGG - Intronic
907414062 1:54301971-54301993 CCTGGGAAAGAGGAAGACGGAGG + Intronic
907489138 1:54797928-54797950 CCAGGAAAGGAGGAGGAGGAGGG - Intronic
907702728 1:56804991-56805013 CCAGGCAAAGAAAAGCAGGAAGG - Intronic
907901516 1:58745913-58745935 CCAGGGAGAGAGAAGGGAGAGGG - Intergenic
907999119 1:59663260-59663282 CCTGGGAGTGAGATGGAGAAAGG - Intronic
908106498 1:60848557-60848579 CCTGGGAAAAAACAGGAGGGTGG + Intergenic
908250275 1:62260277-62260299 TCAGAGAGAGAGAAGGAGGAAGG - Intronic
908267543 1:62394145-62394167 CCTGGGAAGCAGCAAGAGGAGGG - Intergenic
908909115 1:69052153-69052175 CCCGGGAAAGAGGAGAGGGAAGG + Intergenic
909026944 1:70493320-70493342 GGTGGGGAAGTGAAGGAGGAAGG - Intergenic
909131051 1:71738040-71738062 CCTAGGAAGGAGTGGGAGGAAGG - Intronic
909986002 1:82161187-82161209 ACTGGGGAAGGGAAGGAGGAAGG - Intergenic
910088694 1:83436151-83436173 CCAGGAAAAGGAAAGGAGGAAGG - Intergenic
910188436 1:84570891-84570913 GCTGGGAAAGAGGGGAAGGATGG + Intronic
910837425 1:91529839-91529861 CCAGGGAAAGAAAGGAAGGAGGG - Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911696580 1:100896046-100896068 CCTGGGACAGGAAAGGAGGGAGG - Intergenic
912041104 1:105391831-105391853 CCTGAGAAAGAGAAAGAGCTGGG + Intergenic
912091350 1:106080711-106080733 CCAGGAAGGGAGAAGGAGGACGG + Intergenic
912355332 1:109050120-109050142 TCTGGAAAAAAGAAGGTGGAAGG + Intergenic
912614638 1:111085749-111085771 CCTGGTAAAGAGTAGGAAGTGGG + Intergenic
912935874 1:114003241-114003263 TCTGGGGCAGGGAAGGAGGAGGG + Intergenic
913054543 1:115145410-115145432 TCTGGGAAAGAGAAAGTTGAAGG + Intergenic
913088161 1:115458140-115458162 CCTGGGACAGAGAGCAAGGAGGG - Intergenic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
914217430 1:145644913-145644935 CCTGGGACAGAGAAGGAAACAGG - Intronic
914384478 1:147154629-147154651 ACAGAGAAAGAGAAGTAGGAAGG + Intergenic
914434964 1:147651751-147651773 CCTGGGAAAGATGAGTAGGGGGG - Intronic
914456798 1:147843947-147843969 TCTGGAACAAAGAAGGAGGAAGG + Intergenic
914469999 1:147967598-147967620 CCTGGGACAGAGAAGGAAACAGG - Intronic
914737138 1:150428553-150428575 ACAGGGAAAGGGAGGGAGGAAGG - Intronic
914859261 1:151372747-151372769 GGTGGGGCAGAGAAGGAGGAGGG + Intergenic
915165542 1:153946150-153946172 CCTGGGGAAGTGAAAGTGGAGGG - Intronic
915911934 1:159920698-159920720 CCTGGGAAAGAGAATGATTTGGG + Intronic
915976668 1:160395496-160395518 CCAGGCAGAAAGAAGGAGGAAGG + Intergenic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916059081 1:161086628-161086650 CCAGGGCAAGAGATGGGGGAGGG + Intronic
916247959 1:162707245-162707267 CTTAGGAAAAAGAAGCAGGATGG - Intronic
916314794 1:163437228-163437250 CTTGGGAAAGTGGTGGAGGAAGG - Intergenic
916738719 1:167630221-167630243 CCTGCGCGAGAGAACGAGGAAGG - Exonic
916890319 1:169106836-169106858 CGCGGGAAAGCCAAGGAGGAGGG + Exonic
917016135 1:170532635-170532657 TCAGGGTAAGGGAAGGAGGAGGG + Intronic
917223810 1:172760475-172760497 GCTGTGAACAAGAAGGAGGATGG + Intergenic
917501119 1:175586196-175586218 CCTGGGAAAGAGATGGATGCTGG + Intronic
917923543 1:179770615-179770637 CCTGGAAATGAGAAAGAGCATGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918248170 1:182679044-182679066 CATGGGAAAGAATAGGTGGAAGG - Intronic
918796451 1:188904013-188904035 CAAGGGAAAGAAAAGAAGGAAGG + Intergenic
919263213 1:195225598-195225620 CCTGAGAAAGGAAAGGAAGAAGG - Intergenic
919857468 1:201715540-201715562 CCTGGGTTAGAGAATGAGGCTGG + Intronic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920070028 1:203296129-203296151 CCTGGGAGTGAGGATGAGGAGGG + Intergenic
920116852 1:203627589-203627611 CTTGGGAATGAGACGCAGGATGG + Intronic
920388541 1:205584592-205584614 CCTGACCAAGAGAATGAGGAAGG + Intronic
920420150 1:205827696-205827718 CAAGGGAAAGTGGAGGAGGAGGG - Intergenic
920523742 1:206649675-206649697 CATGGGAGAGGAAAGGAGGAGGG - Intronic
920547963 1:206834452-206834474 CCTGCGGCAGTGAAGGAGGAGGG - Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920805039 1:209224968-209224990 AAAGGGAAAGAGAAGGAGAATGG - Intergenic
920849340 1:209618048-209618070 CCTGGGTGAGAGAAGCAGCAGGG + Exonic
920891642 1:209992949-209992971 CCTGGGAAAGAGGTGAATGAAGG + Intronic
921086522 1:211798932-211798954 CCTAGAAAAGAGAGGGAGGGAGG + Intronic
921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG + Intergenic
921283813 1:213591411-213591433 GGTGGGAAACAGAAGGAGAATGG - Intergenic
921417428 1:214906412-214906434 CCTAAGAAAGAGAAGAAGTAAGG - Intergenic
921761145 1:218916581-218916603 CCTGGGTAACAGAATGAGGCAGG + Intergenic
921808146 1:219479412-219479434 GCTGGGCAAGAGGAGGAGGATGG - Intergenic
922214144 1:223507041-223507063 GCTGGGAAGAAGATGGAGGATGG + Intergenic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922355647 1:224772688-224772710 CCTTGGAAAGAAAGGGAGGAGGG - Intergenic
922544532 1:226446025-226446047 ACTTGGAGAGAGAGGGAGGAAGG - Intergenic
922608172 1:226904137-226904159 CCAAGGAATGAGCAGGAGGAGGG - Intronic
922672195 1:227518986-227519008 CCTGGGGAAGAGAAGTAGAGAGG + Intergenic
923063385 1:230497214-230497236 GCTGTAAAAGAGATGGAGGAGGG + Intergenic
923269986 1:232346817-232346839 CCTGGGAAAGAGGTAGTGGATGG + Intergenic
923494480 1:234512537-234512559 GCTGGCAAAGATAAGGAGAAAGG - Intergenic
923772657 1:236951067-236951089 ACAGAGAAAGGGAAGGAGGAAGG - Intergenic
923772680 1:236951224-236951246 ACAGAGAAAGGGAAGGAGGAAGG - Intergenic
923837487 1:237628880-237628902 CCTTGGAAAAAGAAGGGGTAGGG + Intronic
924170283 1:241332283-241332305 CCTGGAAAAGAGAAGGCTTAGGG + Intronic
1063182645 10:3619113-3619135 CCCTGGAAACAGGAGGAGGAGGG + Intergenic
1063194398 10:3727715-3727737 CCTCGGAAAGCGGAGGGGGACGG - Intergenic
1063647454 10:7899260-7899282 TCTGGGGAAGGGAAGGAGGCAGG - Intronic
1064145608 10:12823956-12823978 CCTGGGGAAGACAGAGAGGAGGG + Intronic
1064156590 10:12907887-12907909 CCTGGGTAAGTGCAGGAGAAGGG + Intronic
1064245012 10:13661347-13661369 GCAGGCAAAGAGGAGGAGGAAGG + Intronic
1064285161 10:13985338-13985360 CATGGGACAGGGAAGGAGGCTGG + Intronic
1064300342 10:14117650-14117672 TGTGGGAGAGAGAAGGTGGAAGG + Intronic
1064304309 10:14151727-14151749 CCTGGGGAAGGGAGGGAGGGAGG - Intronic
1064570839 10:16691530-16691552 CTTGGGAAGGAGAAGAAGGTTGG - Intronic
1064924442 10:20554739-20554761 TCTGAGAAGGAGAAGGATGAAGG - Intergenic
1064982045 10:21174460-21174482 GCTGGGGAAGAGAAGAGGGAGGG - Intergenic
1065500861 10:26381100-26381122 ACAGTGAAAGAGGAGGAGGAGGG - Intergenic
1066242375 10:33550839-33550861 CTTGGGAAGGAGGAGGGGGAAGG - Intergenic
1066302327 10:34107990-34108012 CCACAGAAAGAGAAGGTGGATGG + Intergenic
1067297537 10:44983497-44983519 CCTGGGGAAGAGAAGACAGATGG - Intronic
1067511287 10:46896988-46897010 GCTGGGAAACAGAAAGAAGAAGG + Intergenic
1068316281 10:55347187-55347209 CCTGGGAAATAGAGGGAGACTGG + Intronic
1068511217 10:57968281-57968303 CCTGGGGTAGAGATGAAGGATGG + Intergenic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1070319118 10:75341846-75341868 CCTGGGTGGGAGCAGGAGGAGGG - Intergenic
1070381700 10:75886026-75886048 CCTGGAAAAGAGAAGAAAGTAGG + Intronic
1070493078 10:76995578-76995600 CCTGAGATAGTGGAGGAGGATGG + Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071268262 10:83983614-83983636 GCTGGAATGGAGAAGGAGGAGGG - Intergenic
1071476594 10:86030904-86030926 GCTGGCAAAGAGAAGGAAGATGG - Intronic
1072388001 10:94951844-94951866 GATGGGAAAGAGTAGGTGGATGG + Intronic
1072439280 10:95439409-95439431 CAAGGGCCAGAGAAGGAGGAAGG - Intronic
1072573042 10:96675219-96675241 CCTGGGAAGGAAAATGGGGAGGG + Intronic
1072627806 10:97124740-97124762 CCTTGGACAGAGAAGCAGCATGG + Intronic
1072669171 10:97416725-97416747 GCTGCGTAAGGGAAGGAGGAAGG - Intronic
1072740484 10:97906149-97906171 CCTGGGGGAGAGAAGGAGCTGGG + Intronic
1072795739 10:98353158-98353180 CCTGGGAGAGGGAAGGGGTAAGG + Intergenic
1073030798 10:100524139-100524161 ACTGTGAGAGAGAAGGAGAAAGG + Exonic
1073062696 10:100741949-100741971 CCCGGGAAGTGGAAGGAGGAAGG + Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073479983 10:103780283-103780305 CTTGGGGAAGGGAAGGAGAAAGG - Intronic
1073582364 10:104680448-104680470 CCAGGGAAAGAGGAGAAGGTCGG - Intronic
1073768162 10:106706470-106706492 CTTGGGAAAGGGATGGAGGCTGG + Intronic
1073826714 10:107332222-107332244 CATGGGGAAGGGAAGGAGGAAGG - Intergenic
1074093416 10:110285299-110285321 ACTAGAAAAGAGAAAGAGGATGG - Exonic
1074235015 10:111576434-111576456 CCATGGGACGAGAAGGAGGAGGG - Intergenic
1074407010 10:113188371-113188393 CCTGGGACAAATAAGGAGGCTGG - Intergenic
1074567649 10:114595811-114595833 CCTGGGAAAGAGCAAAAGGCAGG - Intronic
1075010719 10:118867551-118867573 CCTGGGAAGGCGAAGGGGAAGGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075101587 10:119510081-119510103 GTTGGGCAAGAGAAGGCGGATGG - Intronic
1075546188 10:123356621-123356643 CCGGTGACAGAGAGGGAGGATGG + Intergenic
1075596506 10:123734117-123734139 AAAGGGAAAGAGATGGAGGAAGG - Intronic
1075710332 10:124527294-124527316 CCTGGAAAAGTGAAGAAGGAAGG + Intronic
1075802342 10:125160925-125160947 CCGGGGAAGGAGAAGGAAAACGG + Intronic
1076338698 10:129728113-129728135 GCTGGGTGAGAGAGGGAGGAGGG + Intronic
1076902054 10:133344430-133344452 CCAGGGAAAGTGAAAAAGGAAGG + Intronic
1077097792 11:806466-806488 GCTGGGAAATGGAAGGAAGAAGG - Intronic
1077439054 11:2559842-2559864 CCAGAGACAGAGAGGGAGGAAGG - Intronic
1077546026 11:3170397-3170419 CCTGGCCAAGAGGAGGAGCAGGG + Intergenic
1077866943 11:6230208-6230230 CCTGGGAGAGGCAAAGAGGAGGG + Intronic
1077994106 11:7438524-7438546 CCTGGGAGAGAGGAGGCAGATGG - Intronic
1078076512 11:8166874-8166896 CCAGGGAAAGGGAAAGAGAAAGG + Intronic
1078646886 11:13148802-13148824 CCTGGAAAAGAAAGGGAGGCTGG + Intergenic
1078757769 11:14227505-14227527 CCTGACAGAGAGCAGGAGGAGGG - Intronic
1078837856 11:15048943-15048965 AGTGGGAAAGAAAGGGAGGAAGG + Intronic
1078853615 11:15188009-15188031 TCTGAGAAAGAAAAGGAGGAAGG + Intronic
1079035335 11:17014901-17014923 ACAGGGGAAGAGAAGGAGGCTGG - Intergenic
1079117279 11:17647826-17647848 TGTGGGAAGGAGAAGGAGGGGGG + Intergenic
1079140510 11:17806269-17806291 GCAAGGAAAGAGAAGGAGGAAGG + Intronic
1079187073 11:18247311-18247333 ACTAGGAAATCGAAGGAGGAAGG + Intronic
1079189731 11:18267566-18267588 ACTAGGAAATCGAAGGAGGAAGG - Intronic
1079492990 11:21010379-21010401 ACTTGGAAAGAGAAGGAGACAGG - Intronic
1079529480 11:21433011-21433033 GCTGGGAAAGGGAAGAGGGAGGG - Intronic
1079651226 11:22932691-22932713 GCAGGGAAAGAGAGGGAGGAAGG - Intergenic
1079991106 11:27248175-27248197 GATGGGAGAGAGAAGAAGGAAGG + Intergenic
1080478364 11:32619857-32619879 GAAGGGAAGGAGAAGGAGGAGGG + Intronic
1080798663 11:35589287-35589309 CCTGGGAAAGGGAAGGCAAAGGG + Intergenic
1080822237 11:35818632-35818654 CCTGGAAAAGAGAACCAGGAGGG - Intergenic
1080926838 11:36766382-36766404 CCTAAGAAAGAAAAGGAGGATGG - Intergenic
1081072809 11:38631385-38631407 ACTGGGAGAGAGAAGCAGGGTGG - Intergenic
1081418107 11:42840044-42840066 GCTAGGGAAGAGTAGGAGGATGG - Intergenic
1081714066 11:45236110-45236132 GCTGGGGAAAAGAGGGAGGAAGG - Intergenic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1082097040 11:48139386-48139408 CCTGGGGATGAGAAGGTGGGTGG - Intronic
1082175467 11:49053745-49053767 AGAGGGGAAGAGAAGGAGGAAGG + Exonic
1082189494 11:49225589-49225611 TCTGGGAAAGAGAACGTGCACGG + Intergenic
1082216986 11:49583380-49583402 GGAAGGAAAGAGAAGGAGGATGG - Intergenic
1082217733 11:49595192-49595214 CATGGGAAGGAGAACAAGGAGGG + Intergenic
1083013201 11:59423943-59423965 CCTGGGCAAGAAAAGCAGCAGGG + Intergenic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083060539 11:59865867-59865889 CCTGGGAAAGAGTTGAAGGAAGG + Intronic
1083333761 11:61911367-61911389 CCTGGAAATGAGGAGGAAGAGGG - Intronic
1083717144 11:64583978-64584000 ACTGGGACAGTGCAGGAGGAGGG - Intergenic
1083998666 11:66284387-66284409 GCTGGGAAAGAGAAGATGGAAGG - Intronic
1084212888 11:67631967-67631989 CTTGGGAAGGAGGAGCAGGAAGG - Intronic
1084273380 11:68040388-68040410 CCTGGGAAAGGAGAGAAGGAGGG - Intronic
1084347671 11:68566313-68566335 AGGAGGAAAGAGAAGGAGGAAGG - Intronic
1084448941 11:69221112-69221134 ACAGGGGAAGAGAAGGAGGGAGG - Intergenic
1084532121 11:69733465-69733487 CCTAGGAAAGAAAAGGAAGAAGG + Intergenic
1084601129 11:70146473-70146495 TCTGGGAAAGAGGAGGAGCTGGG + Intronic
1084683546 11:70680727-70680749 CCAGGGAAAGAGAGAGAGGCTGG - Intronic
1084774936 11:71368947-71368969 CTTGTGAAAGAGGAGTAGGAGGG + Intergenic
1085203250 11:74714451-74714473 CCAGGGAGAGGGCAGGAGGAAGG - Intronic
1085309207 11:75506303-75506325 CCAGGGAGGAAGAAGGAGGAGGG + Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086371126 11:86156680-86156702 TCTGGGTAACAAAAGGAGGAGGG + Intergenic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1086534402 11:87826882-87826904 GCTGGGTAAGTGAAGGAAGAGGG + Intergenic
1086632568 11:89040786-89040808 GGAAGGAAAGAGAAGGAGGATGG + Intronic
1086677032 11:89620915-89620937 TCTGGGAAAGAGAACGTGCAGGG - Intergenic
1086698363 11:89870652-89870674 AGAGGGGAAGAGAAGGAGGAAGG + Exonic
1086707800 11:89973836-89973858 AGAGGGGAAGAGAAGGAGGAAGG - Exonic
1087175619 11:95092434-95092456 CCTGGGTGAGATAATGAGGAAGG + Intronic
1087689188 11:101299457-101299479 TCTGGGAAGGAGAGGGAGGTGGG - Intergenic
1088137391 11:106574371-106574393 CCTGGGGAAGAGAGTGAGAAGGG + Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088788142 11:113201049-113201071 GATGGAAAAGGGAAGGAGGAGGG - Intronic
1088867386 11:113861647-113861669 CCTGGGAAATAGAACTAGGTCGG - Intronic
1088943376 11:114483797-114483819 TCAGGGAAAGAGAAGAAGGAAGG - Intergenic
1088961380 11:114669319-114669341 GCTTGGAAAGAGAAGATGGAAGG - Intergenic
1089335739 11:117722367-117722389 GCTGGGAAAGATAAGGGGGAGGG + Intronic
1089361023 11:117886650-117886672 CCCGTGAAGGAGGAGGAGGAGGG + Intergenic
1089418979 11:118316704-118316726 GCTGGGGAAGTGAAGGAGGGAGG + Intergenic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090098749 11:123771572-123771594 CATGGGAATGAGAAGGAGAAAGG - Intergenic
1090284082 11:125483998-125484020 AATGTGAAAGAGAATGAGGATGG - Intronic
1090408629 11:126492537-126492559 AGTGGGAAGGAGGAGGAGGAGGG + Intronic
1091238394 11:134036750-134036772 CCTGGGAAAGAGGAAGGGAAAGG + Intergenic
1091770474 12:3148085-3148107 CCTTTGAAAGAAAGGGAGGAAGG + Intronic
1091956566 12:4648965-4648987 GCTGGGAAAGTGAAGGAGAGGGG - Exonic
1092063100 12:5566557-5566579 CCTGGGCCAGAGAAAGAGGTGGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092505237 12:9092107-9092129 ACTGGGAAGCAGAAGGAGCAGGG + Intronic
1092532203 12:9353920-9353942 ACTCAGAAAGAGAAGGAGGAAGG - Intergenic
1092658224 12:10710089-10710111 GCTGGGGAGGAGGAGGAGGAAGG - Exonic
1093171056 12:15861033-15861055 CCTGTGAATGATGAGGAGGAAGG - Intronic
1094347526 12:29487068-29487090 CATGAGAAAGCGATGGAGGATGG + Intronic
1094459531 12:30679545-30679567 GCAGGGAAAGAGAAGAGGGAAGG - Intronic
1094724629 12:33101203-33101225 GCAGGGAAAGTGAAGGAGAAAGG + Intergenic
1095294648 12:40514368-40514390 CCTGAGAAAGAAAAGAAAGAAGG - Intronic
1095779967 12:46048655-46048677 CCTGAGATAGAGATGGAGCAGGG + Intergenic
1096628065 12:52907315-52907337 CCTGGGACAGGGAAGGCGGAAGG + Intronic
1096680396 12:53252031-53252053 CCCGGGTAAGGGAAGGAGGGCGG + Exonic
1096837194 12:54358436-54358458 AATGGGAAAGACCAGGAGGAAGG - Intergenic
1097032877 12:56102124-56102146 CCTGGGAGAGAGAGGGAATAGGG - Exonic
1097069363 12:56343589-56343611 GCAGGGAAAGGGAGGGAGGATGG + Intronic
1097145195 12:56935093-56935115 CCTGGGCAAGATGATGAGGAGGG + Intergenic
1097185715 12:57195288-57195310 CCAGGGCAGGAGAAGGAGGAGGG - Exonic
1097284003 12:57863870-57863892 CCTGGGGATGTGAAGGAGGAGGG + Intergenic
1097320398 12:58219512-58219534 CCTGTGAAAGAGAATGAAAATGG - Intergenic
1097536288 12:60873898-60873920 ACGCGGAAAGAGAAGTAGGATGG - Intergenic
1097607577 12:61774663-61774685 CGGGGGAAAGAGTGGGAGGATGG + Intronic
1097736389 12:63186263-63186285 ACTGGAAAGGAGATGGAGGATGG + Intergenic
1097938366 12:65278437-65278459 CCTGGGGCAGAGGAGGACGAGGG + Intergenic
1098198262 12:68025468-68025490 TCAGGGAAGGAGAATGAGGAGGG + Intergenic
1098302520 12:69068823-69068845 CCTGGGAGAGAGATGGTGGAGGG + Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1099973104 12:89520447-89520469 CCTGGGCAAGAGAAGTGGGTGGG + Exonic
1100650640 12:96584977-96584999 CCTGGGAAAGAGAATGTGATTGG + Intronic
1100722513 12:97373860-97373882 CCGGGCAAAGAGACTGAGGAGGG + Intergenic
1100892093 12:99137009-99137031 CTTGGAAACGAGAATGAGGAAGG - Intronic
1101020175 12:100545919-100545941 CCTGTGAAAGTGGAGCAGGAAGG + Intronic
1101124481 12:101617204-101617226 CCAAGTAAAGAGAAGGAGGCCGG + Exonic
1101240597 12:102834456-102834478 CTTGGGAAAGCCAAGGAGGCAGG - Intergenic
1101320284 12:103667526-103667548 CCAGGGAAAGAGAAGGAAGAGGG + Intronic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101449996 12:104767382-104767404 CCTGGGGCTGAGATGGAGGAGGG - Intergenic
1101808504 12:108087011-108087033 GATGAGACAGAGAAGGAGGAAGG - Intergenic
1101812866 12:108122822-108122844 CCTGGGAAGGGAGAGGAGGAAGG - Intergenic
1102325724 12:111981682-111981704 CCTGGGAAAGAGGCTGGGGAAGG + Intronic
1102641951 12:114374584-114374606 TCTGGTGAAGAGAAGGAGGCAGG + Intronic
1102796766 12:115695624-115695646 CCTGGAAAAGAAAAGCAAGATGG + Intergenic
1103176563 12:118868942-118868964 CCAGGGAAAAGGAAGGAGGGAGG - Intergenic
1103420161 12:120774272-120774294 CATGGGAAAGAGTAAGAGGGAGG - Intronic
1103486844 12:121288753-121288775 CCTGGAAAAGAGAGGGATGGTGG - Intronic
1103842583 12:123877123-123877145 CCTGGGAATGAGAGGTGGGATGG - Intronic
1103865299 12:124046790-124046812 CCTGGGAAAGAGATGTAGTAGGG - Intronic
1104239266 12:126971712-126971734 GGGGAGAAAGAGAAGGAGGAAGG - Intergenic
1104483499 12:129129136-129129158 ACTAGGGAGGAGAAGGAGGAAGG - Intronic
1104894214 12:132153899-132153921 CCTGGGACACAGCAAGAGGACGG - Intergenic
1105518746 13:21113113-21113135 CCTGCAAAAGAGCAGGAGAAGGG - Intergenic
1106254359 13:28009393-28009415 CCTGGGAAAAACAAGGACAAGGG - Intronic
1106459869 13:29959350-29959372 CCTGGAAAACAGTAGGAAGAAGG + Intergenic
1106548265 13:30749327-30749349 CATGAGAAAGAGAAGGAAGCAGG + Intronic
1106563186 13:30863996-30864018 CCTGGCAAAGGAAAGGAGGGAGG - Intergenic
1106674282 13:31941383-31941405 CCTGCCAAAGAGAGGGAGGGAGG + Intergenic
1106780781 13:33057081-33057103 CCCAGTAAAGAGGAGGAGGAAGG - Intronic
1106913889 13:34490864-34490886 CCAGGTAAAGAGAAAGAGGAAGG - Intergenic
1107328749 13:39274072-39274094 CCTGGTAATGAAAATGAGGAAGG + Intergenic
1107340282 13:39398136-39398158 TCAAGGAAAGAGAAGAAGGAAGG + Intronic
1107750786 13:43563947-43563969 TCTGGAAAAAAAAAGGAGGAAGG + Intronic
1107859526 13:44647677-44647699 CCTGGGCATGAGATTGAGGAGGG - Intergenic
1108346432 13:49551153-49551175 GCAGGGAGGGAGAAGGAGGAAGG + Intronic
1108454528 13:50599575-50599597 TCTGCAAGAGAGAAGGAGGAAGG - Intronic
1108914273 13:55588607-55588629 GCTGGGGGAGAGAAGGAGGATGG + Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109014393 13:56991226-56991248 GCTAGGATAGAGAAGGAGAAAGG + Intergenic
1109140029 13:58703668-58703690 CTTGGGCAAGGGAAAGAGGAAGG + Intergenic
1109185962 13:59268778-59268800 CCTCTGATAGAGAAGGAGAAAGG + Intergenic
1109310947 13:60692702-60692724 CCTGGGGAAGAGTAGGTAGAAGG - Intergenic
1109316509 13:60755611-60755633 CCTGGGAGAGATTAGGAGGTAGG - Intergenic
1109799582 13:67358706-67358728 AGGGGGAAAGAGAAGAAGGAAGG - Intergenic
1110136448 13:72073366-72073388 CCTGGCAAAAATAAGGAAGAAGG + Intergenic
1110189149 13:72710791-72710813 CCTGGGAAAGAGTAGTAGTTAGG - Intronic
1110273096 13:73613533-73613555 CCTGGGTCAGAGATGAAGGAAGG + Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110324957 13:74202961-74202983 ACTGGTAAAGAACAGGAGGAAGG + Intergenic
1110418828 13:75281434-75281456 CTTGGGAAAGGGTAGGAGGAGGG - Intergenic
1110860228 13:80339631-80339653 ACTGGGAAAGAGAAGAGGGGCGG - Exonic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1112384862 13:98930284-98930306 CTTGGGTAAGTGAAGGAGGCAGG + Intronic
1112842894 13:103601407-103601429 CCCGGAAAAGAGCAGGAGCAAGG + Intergenic
1112995591 13:105571075-105571097 TCTGGGAGAGGGATGGAGGAGGG + Intergenic
1113147236 13:107220863-107220885 TATGAGAAAGAGAGGGAGGAAGG + Intronic
1113242213 13:108350548-108350570 GCTGAGAAAGAGGAGGACGATGG - Intergenic
1113403629 13:110018474-110018496 CATTGGAAGGAGGAGGAGGAGGG - Intergenic
1113505991 13:110816246-110816268 CCTTGGAAAGGCAGGGAGGAAGG + Intergenic
1113748420 13:112762183-112762205 GCTGGGGCAGAGGAGGAGGAGGG - Intronic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114149142 14:20015390-20015412 GCTGGGAAGGAGAAGGGTGAGGG + Intergenic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1114697624 14:24642530-24642552 GCTGGGAAAGGGATAGAGGAAGG - Intergenic
1114877546 14:26740029-26740051 CCTTGGAATGAGAACGAGGGAGG - Intergenic
1115427527 14:33277719-33277741 TCTGGGAAAGGCAAGGAGGTTGG + Intronic
1115453535 14:33575880-33575902 CCTGAGAAAGAGAAAATGGAAGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117253597 14:53956860-53956882 GCCGGGGAAGAGGAGGAGGAAGG - Intronic
1117983279 14:61363029-61363051 CGGGTGAGAGAGAAGGAGGAAGG + Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118674058 14:68163618-68163640 CTTGGGAAACAGAAGAAGGCAGG - Intronic
1119041893 14:71282027-71282049 CCTGGGGAAGAGAGGGAGGTAGG - Intergenic
1119059379 14:71459620-71459642 CATGGGAAAGAGATGTAGGCTGG + Intronic
1119078125 14:71664967-71664989 CCTAGAAATGGGAAGGAGGATGG + Intronic
1119416090 14:74470440-74470462 CCAGGGAAGGAGAAGGAGTGAGG - Intergenic
1119428675 14:74551879-74551901 CCTGGGTAATAGAGGGAGAATGG - Intronic
1119433905 14:74585707-74585729 CCAGGGAAAGCCAAGGAGGGTGG + Intronic
1119627452 14:76191587-76191609 CCTGGGGAAAAGAAGGAAGTTGG - Intronic
1119671765 14:76525403-76525425 GCTGGGAAGGAAAAGGAGGGGGG + Intergenic
1119769510 14:77211646-77211668 CCTGGGAGTGAGCAGTAGGATGG + Intronic
1119769676 14:77212699-77212721 CCTGGGAAAGCTGAGGAGGGTGG + Intronic
1119771466 14:77222668-77222690 CCTGGGAAAGGGCTGGTGGAGGG - Intronic
1119828803 14:77682437-77682459 CCTTGGAAAGAGAAATAGAATGG - Intronic
1119876684 14:78065804-78065826 TCTAGGAAAGAGTAGGAGAAAGG + Intergenic
1119934613 14:78580165-78580187 CCTGCCACAGAGAAGGAGCAAGG + Intronic
1120016053 14:79474823-79474845 AGAGGGAAAGAGGAGGAGGAAGG + Intronic
1120049263 14:79845947-79845969 ACAGGGAGAGAGATGGAGGAAGG + Intronic
1121078816 14:91090956-91090978 CCTCTGCAAGAGAGGGAGGAAGG + Intronic
1121308819 14:92923832-92923854 GCGGGGGAAGAGATGGAGGAAGG - Intronic
1121408119 14:93731622-93731644 AATGGGGAAGAGAAGGAGAAAGG - Intronic
1121586921 14:95068917-95068939 CCTGGGGAAGAGATGGCTGAAGG + Intergenic
1122180464 14:99950751-99950773 CCTGGGAAAGAAGTGCAGGAGGG - Intergenic
1122293733 14:100693606-100693628 CCATGGAGAGGGAAGGAGGAAGG - Intergenic
1122577843 14:102752877-102752899 TCTGGGAAAGACTAGGAGGAAGG - Intergenic
1122714950 14:103690590-103690612 CCTGGGAAAGCCAAGGACGGTGG - Intergenic
1122815350 14:104309479-104309501 CCTGGGAAAGACAGTAAGGAAGG - Intergenic
1122832059 14:104403188-104403210 CCATGGCCAGAGAAGGAGGAAGG - Intergenic
1202888265 14_KI270722v1_random:129375-129397 CCTGAGAAAGAGAATGGGAAAGG - Intergenic
1202889522 14_KI270722v1_random:142726-142748 CCTGAGAAAGAGAATGGGAAAGG - Intergenic
1124190147 15:27567647-27567669 CCGGGGAAAGGGCGGGAGGAGGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125321977 15:38498747-38498769 TCTTGGAAAGTGAAGTAGGAAGG - Intronic
1125665077 15:41423994-41424016 CCTGGGGAAGCCAAGGAGGGCGG - Intronic
1126167019 15:45662453-45662475 TCAGAAAAAGAGAAGGAGGAAGG - Intronic
1126268303 15:46781026-46781048 CCTGTGAGAGATAATGAGGAGGG - Intergenic
1126559245 15:50025444-50025466 CCTGTGGAGGGGAAGGAGGATGG - Intronic
1128148351 15:65345250-65345272 CCTAAGAAATAGAAGGATGATGG + Intronic
1128359253 15:66949331-66949353 CTTGAGAAAGAGAAGGAAGGGGG - Intergenic
1129084630 15:73075857-73075879 TCTGGAAAAGAGAGGAAGGAAGG - Intronic
1129210442 15:74065001-74065023 CCTGGAAAAGAGAGGCTGGAAGG - Intergenic
1129260514 15:74364816-74364838 CCTAGGAGAGAGGGGGAGGAAGG + Intronic
1129412593 15:75358344-75358366 CCTGGGAGTGGGAAGGAGGGTGG + Exonic
1129844113 15:78760391-78760413 CCTGGGGAGGAGGAGCAGGAAGG + Intronic
1129854719 15:78815033-78815055 CCTGGGACAGAGGAGGAAGCAGG - Intronic
1129892119 15:79078270-79078292 CCTGGGAAGGAGATGGAAAAGGG - Intronic
1129943402 15:79518323-79518345 CCTGGGACAGAGATACAGGAAGG + Intergenic
1130140419 15:81221581-81221603 CCTGGCATCGAGAGGGAGGAAGG - Intronic
1130155828 15:81349256-81349278 GCAGGGGAAGAGGAGGAGGAAGG - Intronic
1130185451 15:81677186-81677208 CCTGGGACAGAGAACAGGGAAGG + Intergenic
1130243647 15:82221928-82221950 CCTGGGGAAGAGAAGGAAGGTGG - Intronic
1130456828 15:84119353-84119375 CCTGGGGAAGAGAAGGAAGGTGG + Intergenic
1130642325 15:85689889-85689911 GCTGAGAAAGGGAAGGAGGGAGG - Intronic
1130682059 15:86005619-86005641 CCAGGGGAGGAGGAGGAGGAGGG + Intergenic
1130913845 15:88289781-88289803 CTTGGCAAAGAGAAGGGGGGGGG - Intergenic
1131080049 15:89527114-89527136 CCAGAGAAAGAGAAGGATGGTGG + Intergenic
1131100634 15:89686884-89686906 ACTGGGGAAGAGAAGGAATATGG - Intronic
1132252581 15:100345185-100345207 GCTGTGAAAGAGAAAGTGGAAGG - Intergenic
1132330695 15:101010428-101010450 CCTGCGATGGAGAAGAAGGAAGG - Exonic
1132397559 15:101485745-101485767 TCTGGGAAAGAAGAGGAGGAGGG - Intronic
1132672121 16:1106295-1106317 GCTGGGACACGGAAGGAGGAGGG - Intergenic
1133237307 16:4393216-4393238 CCTGAGAAAGTGAAGGGGGCCGG + Intronic
1133469258 16:6058341-6058363 TCTGAGAAGGAGAGGGAGGAAGG - Intronic
1133668264 16:7992421-7992443 GGAGAGAAAGAGAAGGAGGAAGG + Intergenic
1134049083 16:11124414-11124436 ACTGGGAAGGGGAAGGAGGAAGG - Intronic
1134278859 16:12800757-12800779 GATGGGAAAGGGAAGGATGAGGG - Intronic
1134286205 16:12864165-12864187 CTTGACAAAGAGCAGGAGGAGGG + Intergenic
1135274821 16:21103160-21103182 CCAGGGAAAGGGTAGGAGGGGGG + Intronic
1135349019 16:21713219-21713241 CCTCCCAAAGAGAAGGAGTAGGG + Intronic
1135499492 16:22981427-22981449 CCTGGGGCAGTGGAGGAGGAAGG - Intergenic
1135526907 16:23220212-23220234 CCTGGAGTAGGGAAGGAGGAAGG - Intergenic
1135646067 16:24163082-24163104 CCTGGGAAAGAGAATCTGGTTGG + Intronic
1135967069 16:27044645-27044667 CTTGAGGAAGAGGAGGAGGAAGG - Intergenic
1136033634 16:27521382-27521404 ACTGGGGAAGAGAAGCAGGCTGG - Intronic
1136127024 16:28191380-28191402 CCTGGGAAAGGGAAGCAGATGGG - Intronic
1136251504 16:29008524-29008546 CCTGAGAAAGACAGGGAGGGAGG + Intergenic
1136273735 16:29165522-29165544 CTTCAGAAAGTGAAGGAGGAGGG - Intergenic
1136376407 16:29868067-29868089 TCTGGGGTAGAGAAGCAGGACGG + Intergenic
1136412168 16:30083825-30083847 GTTGGGAAAGAGAGGGAGCAGGG + Intronic
1136548566 16:30969307-30969329 CCTGAACAAGAGAAGGAGGCTGG + Exonic
1138103499 16:54273794-54273816 AATGGGAAAGAGGAAGAGGAAGG - Intergenic
1138195757 16:55050996-55051018 CCTTGGAGTGGGAAGGAGGAGGG - Intergenic
1138629203 16:58280058-58280080 CCTGGGAGAGGGATAGAGGAGGG + Exonic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1138928979 16:61629159-61629181 CGGGAGAAAGACAAGGAGGAAGG + Intergenic
1139180219 16:64738458-64738480 CCTGGGAAAGAAAATGATGGAGG + Intergenic
1139209941 16:65067686-65067708 ACAGAGAAAGAGAAGGAGGGAGG + Intronic
1139404363 16:66706573-66706595 CCATGGAGAGAGAAGGTGGAGGG - Intergenic
1139532324 16:67548433-67548455 CTTGGGCAAGAAATGGAGGATGG + Intergenic
1139657380 16:68397260-68397282 TCTGGGACAGAGGAGGAGGCAGG - Intronic
1139668605 16:68475676-68475698 GCTGTGCAAAAGAAGGAGGAGGG - Intergenic
1140112543 16:72016305-72016327 ACTGGCAAAGAGGAAGAGGAAGG + Intronic
1140480329 16:75258955-75258977 CCTGGGAAGGAGGAGGAGGAGGG + Intronic
1140728943 16:77838843-77838865 GGGGAGAAAGAGAAGGAGGAAGG - Intronic
1140874397 16:79137680-79137702 CGGGGGAAGGAGACGGAGGAGGG - Intronic
1141293936 16:82749174-82749196 ACAGAGAGAGAGAAGGAGGAAGG + Intronic
1141595487 16:85094729-85094751 CCTGGGAAGGAGCAGGACGCAGG + Intergenic
1141806417 16:86344682-86344704 CCTGCCAAAGGGAAGGAGGCAGG - Intergenic
1141849035 16:86631437-86631459 ACTGGGAGAGAGGATGAGGACGG - Intergenic
1142077277 16:88127267-88127289 CTTCAGAAAGTGAAGGAGGAGGG - Intergenic
1142237146 16:88927704-88927726 CCTGGGGAGGAGGAGGCGGAAGG - Intronic
1142254679 16:89007990-89008012 CCTGGCAAAGATGAGGTGGATGG - Intergenic
1203141663 16_KI270728v1_random:1771309-1771331 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141710 16_KI270728v1_random:1771452-1771474 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141842 16_KI270728v1_random:1771910-1771932 CCTGGGATTGAGATGGAGGAAGG - Intergenic
1142698636 17:1646755-1646777 CCAGGGCCAGAGAAGCAGGAGGG + Intronic
1142765329 17:2061169-2061191 CCTTGGAATGAGACGGGGGAGGG + Exonic
1142781322 17:2183218-2183240 CCTGGGAAAGGAAGGTAGGAAGG + Intronic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1142931088 17:3284551-3284573 CCTAGGAGAGAGAAGGATGGGGG + Intergenic
1142944324 17:3411956-3411978 CCTAGGAGAGAGAAGGATGGGGG - Intergenic
1143028923 17:3956649-3956671 CCTGGGTCACAGAATGAGGAAGG + Intronic
1143417029 17:6757834-6757856 CATGGGAAGGAGCAGGAGGGAGG - Intronic
1143658710 17:8312105-8312127 CCCTGGAACGAGAAGGAGGGCGG - Exonic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144107408 17:11998095-11998117 TGTGGGAAAGGGAAGGAGAAGGG - Intergenic
1144616741 17:16782950-16782972 CCTGAAAAAGACAAGGAGAATGG - Intronic
1144895950 17:18532711-18532733 CCTGAAAAAGACAAGGAGAATGG + Intergenic
1144965496 17:19074968-19074990 AGTGGGAATGACAAGGAGGAAGG - Intergenic
1144982471 17:19177215-19177237 AGTGGGAATGACAAGGAGGAAGG + Intergenic
1144985752 17:19201024-19201046 AGTGGGAATGACAAGGAGGAAGG - Intergenic
1145136263 17:20411509-20411531 CCTGAAAAAGACAAGGAGAATGG - Intergenic
1145218988 17:21073179-21073201 CCAGGAAGAGAGAAGGGGGAAGG + Intergenic
1145910211 17:28537943-28537965 TCTGGGAAAGAAAATGACGAGGG - Exonic
1145911878 17:28547849-28547871 CCTGAGCAAGAAAAGGAGGCAGG + Exonic
1146025824 17:29319954-29319976 ACTGTGAAAGAGAATGAGGGAGG + Intergenic
1146301628 17:31694063-31694085 CCTGGGGAAGAGCAGGAGTTAGG + Intergenic
1146456952 17:33015990-33016012 CTTGGCAAAGAGGAGGACGAAGG - Exonic
1146480455 17:33201010-33201032 TCTGGGAAAGACCTGGAGGAAGG - Intronic
1146487821 17:33258403-33258425 TAAGGGACAGAGAAGGAGGATGG + Intronic
1146720660 17:35121290-35121312 CCTGGGAAGGAGAATAAGGATGG - Exonic
1146831225 17:36070869-36070891 CCTGGGACAGAGAAGGACGCAGG + Intronic
1147647284 17:42041199-42041221 CCAGGGAAAGAAAGGGAGGGAGG + Intronic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1147955085 17:44128642-44128664 CCAGGCAAAGAGAAGAAGGGAGG - Intergenic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148536140 17:48440614-48440636 CCTGGGAAAGGGAAGGCCAAGGG + Intergenic
1148676062 17:49445740-49445762 CATGGGGCAGAGAAGGATGAAGG + Intronic
1148716623 17:49720369-49720391 AGTGGGAAAGAGAAGGAGCGAGG - Exonic
1148735298 17:49861692-49861714 CCTGGGCAAGTGAGGCAGGAAGG + Intergenic
1148736750 17:49869412-49869434 CCTGGGAAAGAGAATGGCCATGG - Intergenic
1148741674 17:49896890-49896912 CCTGGGGAAGAAGAGGCGGAGGG - Intergenic
1148777041 17:50101773-50101795 CCCAGGAATGAGAAGGAGGAGGG - Intronic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1148871062 17:50659008-50659030 CCTGGGGAGGAGGAGGAGAAGGG + Intronic
1148966163 17:51437856-51437878 CCTGGGAGGGAGATGGAGAAGGG + Intergenic
1149367504 17:55960581-55960603 GCTGGGAGACAGAAGCAGGAGGG + Intergenic
1149468602 17:56898671-56898693 TCTGGGGATGAGCAGGAGGAGGG + Intronic
1149634489 17:58155837-58155859 CTCGGGAAAGGCAAGGAGGAAGG + Exonic
1149757710 17:59201335-59201357 TCTAGGCAAGAGAAGGAGAAAGG + Intronic
1150183316 17:63151169-63151191 ACAGGGAAAGAGAAGGAAAAAGG - Intronic
1150282123 17:63934775-63934797 CCTGGGCTGGAGAAGGAGGCAGG - Intergenic
1150433826 17:65139176-65139198 GCTGGGGAGGAGGAGGAGGATGG - Intronic
1150832093 17:68531967-68531989 CCTGGGAAAGGGCAGGAGAAGGG - Exonic
1151163331 17:72184041-72184063 CCTGAGAAAAGGCAGGAGGAGGG + Intergenic
1151311507 17:73295423-73295445 GCTGGGAAAGAGAAGAGGGAAGG + Intronic
1151333077 17:73422611-73422633 CCTGGGGAGGAGACGGTGGAGGG + Intronic
1151393812 17:73805962-73805984 CCAGCCAAAGAGAAGGAGGTGGG + Intergenic
1151476149 17:74345249-74345271 GGTGGGAAGGGGAAGGAGGATGG + Intronic
1151482998 17:74381105-74381127 CCTGGGAAGAAGAAGAAGGGAGG - Intergenic
1151491440 17:74434020-74434042 CCCTGGAGAGAGAAGGAGGGAGG + Intronic
1151565437 17:74894724-74894746 CCTAGGAAAGAGAAGTTGGGTGG + Intergenic
1151565599 17:74895980-74896002 AGTGGGAAAGGGAGGGAGGAGGG - Intergenic
1152211593 17:79005326-79005348 CCTGGGAAAGGGCAGCAGCAGGG - Intronic
1152236536 17:79141965-79141987 CCTGAGAAAGAGGAGGAGACGGG + Intronic
1152261586 17:79270119-79270141 AATGGCAAAGGGAAGGAGGACGG - Intronic
1152283995 17:79402025-79402047 CCTGAGAAAGAGCAGAAGCAGGG + Intronic
1152294909 17:79461405-79461427 GCTGGGAAGGAGGAGGAAGATGG + Intronic
1152305491 17:79518071-79518093 CCTGGGGAAAAGGAGGAGGAGGG - Intergenic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152366854 17:79861388-79861410 ACTTGGACAGAGAGGGAGGAAGG + Intergenic
1152400838 17:80065238-80065260 CTTGGGAATGAGGAGGAGGAGGG - Intronic
1152596914 17:81242239-81242261 GCTGGGCACAAGAAGGAGGAAGG - Intergenic
1152912195 17:83011185-83011207 CCGGGGCGAGAGGAGGAGGAAGG + Intronic
1153229126 18:2920142-2920164 CCTGGGAAGGCAAAGGAGGATGG + Exonic
1153474755 18:5487317-5487339 GCTGGGAAGGATAGGGAGGATGG + Intronic
1153757962 18:8302385-8302407 GTTGGGCAAGAGAAGGAGGGAGG + Intronic
1154492338 18:14931914-14931936 CCCGGGACAGAGCAGGAGGGAGG - Intergenic
1154492376 18:14932005-14932027 CCTGGGACAGAGCAGGAGGGAGG - Intergenic
1155241981 18:23872666-23872688 GCTAGAAAAGAGATGGAGGAAGG - Intronic
1155576403 18:27252505-27252527 GGGGGGAAAGAGGAGGAGGAAGG + Intergenic
1155692564 18:28643949-28643971 CCTGGGAAAAAGAAGAAAAAAGG + Intergenic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1156197614 18:34793176-34793198 CCTGGAACAGGGAATGAGGATGG + Intronic
1156564960 18:38177025-38177047 CCTGAAAAAGAGGAGAAGGAGGG - Intergenic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1157210940 18:45741331-45741353 CTTGGGAACAAAAAGGAGGAGGG + Intronic
1157512731 18:48290307-48290329 ACTGGGACTGAGAAGGAGGTGGG - Intronic
1157520124 18:48339662-48339684 AGTGGGAATGGGAAGGAGGAGGG + Intronic
1157594241 18:48854222-48854244 CCTGGGAGTGAGAAGCAGGGAGG + Intronic
1158099856 18:53818947-53818969 CCTGGGCTGGAGGAGGAGGAAGG + Intergenic
1158496153 18:57956819-57956841 CCTGGGAAAGGTAAGGAGGCTGG + Intergenic
1158710226 18:59830897-59830919 CCAGAGAAAGACAGGGAGGAAGG + Intergenic
1158983031 18:62783916-62783938 CCTGAGAATGAGAAGAAAGATGG + Intronic
1159545991 18:69839714-69839736 CCTGGGAGAGAGGGGAAGGAGGG + Intronic
1160019920 18:75172488-75172510 GCTGGGAGAGAGTAGGAGGAAGG + Intergenic
1160344787 18:78123967-78123989 CCTGGCAGAGAGCAGGAGGCAGG - Intergenic
1160353168 18:78202243-78202265 AGTGGGACAGAGAAGGAGGTCGG - Intergenic
1160978792 19:1807080-1807102 CCTGGGCGAGAGTGGGAGGAGGG - Intronic
1161010377 19:1956973-1956995 CCTGGAAGAGAGAAGGAGGGAGG + Intronic
1161202963 19:3025961-3025983 GCTGGGAAGGAGAAGGGGGTGGG - Intronic
1161342441 19:3750708-3750730 CCAGGGAGGGAGAAGGAGGACGG - Exonic
1161414749 19:4139716-4139738 CAAGGGGGAGAGAAGGAGGAGGG + Intergenic
1161599175 19:5170440-5170462 CCAGGGGAAGAGAGGAAGGAGGG + Intronic
1161848526 19:6726269-6726291 TCTGGGAATGAGAGGAAGGAAGG - Intronic
1161985785 19:7653085-7653107 GCTGGGGAAGGGAAGGAGGAAGG - Intergenic
1162053108 19:8046845-8046867 GATGGGGAGGAGAAGGAGGAGGG - Intronic
1162078848 19:8206933-8206955 CCTTGGAAAGCGGAGGCGGAAGG + Intronic
1162459955 19:10808951-10808973 CATAGGAGATAGAAGGAGGAGGG - Intronic
1163130871 19:15272177-15272199 CCAGGGAAAGAGAAGAGGGGCGG + Intronic
1163131115 19:15273615-15273637 CCAGGCAAGGAGAAGCAGGAAGG + Intronic
1163178669 19:15583653-15583675 CCCGGGATGGAGAAGGCGGAAGG - Intergenic
1163386699 19:17004462-17004484 TCAGGGAAGGAGAAGGAGCAGGG - Intronic
1163445268 19:17342127-17342149 CCTGGGCAATAGACAGAGGAGGG - Intronic
1163571612 19:18085368-18085390 CCAGGGAAAGGGAAGGAGGATGG - Intronic
1163779652 19:19239712-19239734 CCTGGGGAGGAGCAGGAGGGAGG - Intronic
1163812652 19:19443583-19443605 AGTGGGAGAGAGAAGGAGAAAGG + Intronic
1164250390 19:23470522-23470544 GCTGGGAAAGAGAGGGCAGAAGG - Intergenic
1164712559 19:30367880-30367902 CATGGGAAGGTGCAGGAGGAAGG - Intronic
1165073604 19:33269110-33269132 CCTGGGAGGGAGCAGGAGGAAGG - Intergenic
1165393344 19:35550643-35550665 CCTGGGAGAGAGAGGGAGAAAGG + Exonic
1165426188 19:35746681-35746703 CATGGGAAACAGAAGCTGGAAGG - Intronic
1165474711 19:36023936-36023958 CCAGGGAAAGAAAGGGAGAAAGG - Intronic
1165816387 19:38645019-38645041 CCTGGGAAAGAGAAGGGGGTGGG + Intergenic
1165962546 19:39547502-39547524 CAAGGGGAAGAGAAGAAGGATGG - Intergenic
1166154907 19:40903683-40903705 CTTGTGAAAGAAAAGAAGGAAGG + Intergenic
1166178823 19:41092971-41092993 ATTTGGAAAGAGAAGGATGAGGG - Intronic
1166270202 19:41708811-41708833 CCTGGGAGAGGGTGGGAGGAGGG + Intronic
1166382787 19:42363358-42363380 CCAGGGAGATGGAAGGAGGAGGG - Intronic
1166459229 19:42971572-42971594 TCTTGGAAAGGGAGGGAGGAAGG - Intronic
1166670634 19:44707728-44707750 GCTGGGAAGGAGACTGAGGAAGG - Intronic
1166733136 19:45069791-45069813 CCTGGGGAACAGAGGGAGGCAGG - Intronic
1166802986 19:45469455-45469477 CCGGGGACAGAGAGGGGGGAAGG - Intronic
1166863647 19:45823536-45823558 CCCAGGAAAGAGAAGCAGGCAGG + Intronic
1166960294 19:46492923-46492945 GAAGGGAAAGAGGAGGAGGAGGG - Exonic
1167073277 19:47232956-47232978 TCGGGGAAAGCGAAAGAGGAGGG - Intergenic
1167175505 19:47861222-47861244 CCTGGGCAAGAGATGGGGGCTGG - Intergenic
1167378769 19:49126634-49126656 TCTGGGAAATTGAAGGAGGCAGG + Intronic
1167679792 19:50912297-50912319 CCCAGGGAAGAGGAGGAGGAGGG + Intergenic
1167698778 19:51030221-51030243 GCAGGGAGAGAGAGGGAGGAAGG - Intronic
1167725016 19:51205553-51205575 CATGAGAAAGAGAGTGAGGAAGG - Intergenic
1167770368 19:51511082-51511104 CCTTAGAAAGATAAGGAAGATGG - Intergenic
1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG + Intronic
1167787271 19:51646538-51646560 CAGGGGTAAGAGAAGGAGCAGGG + Exonic
1167801455 19:51745515-51745537 CCTAGGTAAATGAAGGAGGAGGG - Exonic
1168182354 19:54670975-54670997 CCATGGAAAGAGGAGGAGGAAGG + Intronic
1168238018 19:55075840-55075862 CCTGGGAGGGAGCAGGAGGAGGG + Intronic
1168422576 19:56214467-56214489 CCTGGGGAAGCGTTGGAGGATGG - Intergenic
1168424893 19:56231863-56231885 CCTGGGGAAGCGTTGGAGGATGG - Intronic
1168644506 19:58051481-58051503 GCTGGGCTAGAGACGGAGGAGGG - Intronic
1202663658 1_KI270708v1_random:96167-96189 CCTGAGAAAGAGAATGGGAAAGG - Intergenic
1202664927 1_KI270708v1_random:109495-109517 CCTGAGAAAGAGAATGGGAAAGG - Intergenic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925423216 2:3728195-3728217 GCTGGGAACGAGAAAGAGGAAGG + Intronic
925492707 2:4412781-4412803 CTTGGGCAAGAAGAGGAGGAGGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925910245 2:8569251-8569273 AAAGGGAAAGAGAAGGAGGGAGG + Intergenic
926849098 2:17175111-17175133 GCTGGGAAAGGGAAAGATGATGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927597850 2:24412960-24412982 CCTGGGAAACAGGAGCGGGAAGG - Intergenic
927665253 2:25027547-25027569 CCAGAGTAAGGGAAGGAGGATGG + Intergenic
928155855 2:28875809-28875831 CCTGAGAAAGAGATGGAGGGTGG - Intergenic
928389154 2:30895769-30895791 GCAGGGAAAGAGAAGGTGGGAGG - Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929419810 2:41779092-41779114 CCAGGGAAACAGATGGAAGAGGG + Intergenic
929818995 2:45258504-45258526 CCTGGAGATTAGAAGGAGGAAGG - Intergenic
930139595 2:47938506-47938528 CTTGGGAAAGAGGAGGAGGAGGG - Intergenic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
930307624 2:49695104-49695126 ACTAGTAAAGAGAAGGAGGCAGG - Intergenic
930374835 2:50551807-50551829 CCTGAGAAAGAGAGGGAAGGAGG - Intronic
931341216 2:61402386-61402408 AATAGGAAAGAGAAGAAGGAAGG + Intronic
931433849 2:62230829-62230851 CCAGTGAAAGAGAAGGGCGAGGG - Intergenic
931634281 2:64327811-64327833 AGTGGGGAAGGGAAGGAGGAAGG + Intergenic
932296942 2:70632663-70632685 CCAGGAAAAGAGAGGGAGAAAGG - Intronic
932505343 2:72224561-72224583 TCTTGGAGAGAAAAGGAGGAAGG + Intronic
932628159 2:73315380-73315402 CCTGGGAGAGTGCAGGAGGATGG - Intergenic
932753591 2:74389094-74389116 CCTGGGAAACAGCATTAGGAAGG + Intronic
933355019 2:81199195-81199217 CCAGTGCAAGAGAAGAAGGACGG - Intergenic
933436990 2:82260882-82260904 GCTGGGAAAGAGAGAGAGGAGGG + Intergenic
933884982 2:86711093-86711115 CCTGTGAAGAAGAAGGAAGAAGG - Intronic
934309431 2:91850144-91850166 CGTGGGATAGGGAAGGATGAGGG - Intergenic
934587878 2:95520059-95520081 AGAGGGGAAGAGAAGGAGGAAGG - Intergenic
934655709 2:96116069-96116091 GATGGTAAAGAGAATGAGGAAGG + Exonic
934767268 2:96886654-96886676 CCTGGCAAAGACAGGGAAGAAGG + Intronic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935567328 2:104622785-104622807 ACTGGGAAAGAGAAGAAGGGGGG + Intergenic
935942375 2:108254197-108254219 CCTGGGGAGGAGATGGAGCAGGG - Intronic
935950191 2:108321856-108321878 CCAGGTGAAGAGAAGGAAGAGGG + Intergenic
936115507 2:109699646-109699668 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
936996768 2:118423967-118423989 ACTGGGACAGAGCAGGAGGCAGG + Intergenic
937314157 2:120920406-120920428 CCTGGGGGAGAGAAGGAGGTAGG - Intronic
937980982 2:127615205-127615227 CCTGGGCCAAGGAAGGAGGAGGG + Intronic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
938173285 2:129101900-129101922 ACTGGGAAAGGGAAGGACAAGGG + Intergenic
938313282 2:130308786-130308808 AGAAGGAAAGAGAAGGAGGAGGG + Intergenic
938562932 2:132490625-132490647 CCTGGGAATGTGAGGCAGGAGGG + Intronic
938877943 2:135553449-135553471 CCATGGAAAGAGGAGTAGGAAGG + Intronic
939089699 2:137765216-137765238 CCTAGGAGAAAGAAGGAAGATGG - Intergenic
939202031 2:139048262-139048284 GGAGGGAAAGAGAAGGAGGGGGG + Intergenic
939683314 2:145166501-145166523 CCTTAGAAAGAGGAGGTGGAGGG - Intergenic
940029479 2:149246320-149246342 GCTGGGCAAGAGATGGAGGGAGG + Intergenic
940479710 2:154212715-154212737 CCTTAGAAGGAGAAGAAGGATGG - Intronic
940660163 2:156535415-156535437 CCTAGGAAAGAGAGGGGGGTGGG + Intronic
940680554 2:156779953-156779975 CCAGGGAAAGAGATAGAGGTAGG + Intergenic
940921945 2:159317274-159317296 GCTGGAAAAGAGAAGGAGCATGG + Intergenic
941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG + Intronic
941173779 2:162172056-162172078 ACTGGGAAAGAAATGGGGGAGGG - Intronic
941381849 2:164802836-164802858 GGAGGGAAAGAGAGGGAGGAAGG + Intronic
941432301 2:165427079-165427101 CCTGGGAAGGAGGTGGGGGATGG + Intergenic
941494202 2:166180859-166180881 CCTGGGGCGGTGAAGGAGGAAGG + Intergenic
941601326 2:167546925-167546947 CAAGGGAAAGTGAAGGATGAGGG - Intergenic
941836420 2:170025487-170025509 ACTTGGAAAGAAAAGAAGGAAGG + Intronic
941995751 2:171600624-171600646 CCCAGGAAAGGGACGGAGGAAGG + Intergenic
942086501 2:172449065-172449087 CCTGGGAAGTGAAAGGAGGAGGG + Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
943053828 2:182950150-182950172 GCTAGAAAAGTGAAGGAGGAAGG + Intronic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944099098 2:196003177-196003199 GATGGAAAAGAGAATGAGGAAGG + Intronic
944908396 2:204285445-204285467 CCTGGGAATGTGAAACAGGAAGG + Intergenic
945324024 2:208462422-208462444 CCTGGGAATAAGAATGTGGAAGG + Intronic
945507163 2:210656153-210656175 ACTGGGAAAGAAAAGAAGGTGGG - Intronic
945711974 2:213307994-213308016 CTTGGGAAAGAGAAGGCGAAAGG + Intronic
945808098 2:214515150-214515172 CCTCGGAATGAGAAGGAATATGG + Intronic
945932126 2:215865775-215865797 CCTGTAAAAGGGAAGGAGAAGGG + Intergenic
946006554 2:216530073-216530095 CCTGGGAAAGTGCAAGAGGCAGG - Intronic
946129306 2:217593652-217593674 CCTGAGAAAGACATGGAGGGAGG - Intronic
946396549 2:219446245-219446267 CCTGGTAAAGAAAGGCAGGAAGG - Intronic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
947321826 2:228927601-228927623 TATGGGAAAGAAAAGGAGGAAGG + Intronic
947605886 2:231484851-231484873 GCTGAGGAAGAGGAGGAGGAGGG - Intergenic
947856946 2:233330536-233330558 ACTGTGAAAGAAAGGGAGGAAGG - Intronic
948061886 2:235048177-235048199 TGTGGGAGAGGGAAGGAGGATGG + Intronic
948094309 2:235321397-235321419 CGTTGGAAAGAGCAGGAGGGAGG - Intergenic
948196592 2:236101417-236101439 CCTGAGAAAGAGAAGGTCGCAGG - Intronic
948256372 2:236571364-236571386 GGTGGGAAAGCGAAGGAAGATGG + Intronic
948379102 2:237540780-237540802 CCTAGGAAAGAGAAGGACGGAGG - Exonic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948691881 2:239711415-239711437 CCAGGGACAAAGGAGGAGGAGGG - Intergenic
948756950 2:240165539-240165561 CCTGGGAAGTGGAAGGAGGATGG + Intergenic
948811142 2:240479030-240479052 ACTGGGAATGAGAGGAAGGAGGG - Intergenic
948913052 2:241014965-241014987 TCAGGGACAGAGAAGCAGGAGGG - Intronic
1168951246 20:1803508-1803530 CCTGGGAAAGGGGCGGAGAAGGG + Intergenic
1169014444 20:2280191-2280213 CGTGGGAAATAGGTGGAGGAGGG - Intergenic
1169189665 20:3650129-3650151 CCTGGGAAATAAAAAGAGCAGGG + Exonic
1169255157 20:4091509-4091531 CCCGGGAAAGAGGAGGAGAGAGG + Intergenic
1169801238 20:9514729-9514751 CGGGGGACAGAGAAGGGGGAGGG - Exonic
1170110060 20:12795427-12795449 CATGGGAAAAAGGAGAAGGAGGG - Intergenic
1170159229 20:13295629-13295651 CCCAGGAAAGATAAAGAGGAAGG + Intronic
1170800533 20:19586523-19586545 CCTGGCAAAGGGTAGGGGGAAGG - Intronic
1170936233 20:20812217-20812239 GCTGACAAAGAGAAGGAAGATGG - Intergenic
1171138135 20:22716561-22716583 CCTGGGTAAGAGAAGAGGAAAGG + Intergenic
1171249115 20:23635373-23635395 CATGTGAAAGAGCAGGAGGCAGG + Intronic
1172105608 20:32515547-32515569 AGTGGGAAAGAGACGGAGCAGGG + Intronic
1172459015 20:35101209-35101231 GCTGGCAAGGGGAAGGAGGAAGG - Intergenic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1172906836 20:38376811-38376833 CCTGGTGAAGAGGAGGAGGGTGG - Exonic
1173207373 20:41005687-41005709 TCTGGGAGAGAGAAGGAGATAGG + Intergenic
1173235129 20:41238412-41238434 GCTGGAGAAGAGAAGAAGGAAGG + Intronic
1173253224 20:41375461-41375483 CCAGAGAAACAGGAGGAGGATGG - Intergenic
1173310952 20:41895459-41895481 CCAGGGACAGAGGAGGAGGGAGG - Intergenic
1173338142 20:42129972-42129994 CCTGTGGAAGAGAAGTAGGATGG + Intronic
1173423316 20:42922232-42922254 GCTGAGAAAGAGTAGGTGGAGGG - Intronic
1173863721 20:46300680-46300702 CCTGGGGAAGGGAAGGATGCTGG - Intronic
1173882464 20:46426381-46426403 TCTTGGAAAGGGAAGGAAGAAGG - Intronic
1173932090 20:46829308-46829330 ACTGGGAAAGAGAAGGAAATGGG + Intergenic
1174058979 20:47819167-47819189 CCTGGGAAAGAGATAAAGCATGG + Intergenic
1174173458 20:48630838-48630860 CCTGGGTAGGGGCAGGAGGATGG - Intronic
1174183031 20:48686942-48686964 CCTGGGAAGGAGCAGGAGCCCGG - Intronic
1174973073 20:55299841-55299863 GTTGGGAAATAAAAGGAGGATGG + Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175196177 20:57244783-57244805 CCTGGGGAAGGGAGGGAGGACGG - Intronic
1176033054 20:63023133-63023155 CCTGGGAAGGAGACTCAGGACGG - Intergenic
1176113840 20:63422543-63422565 CATGGGGAAGAGACGGGGGAGGG + Intronic
1176270389 20:64233154-64233176 GGAGGGAAAGGGAAGGAGGAAGG - Intronic
1176285318 21:5016245-5016267 CCTGAGGAGGAGGAGGAGGAGGG + Intergenic
1177146903 21:17416603-17416625 ACTGGGAAGGGAAAGGAGGAAGG + Intergenic
1177262515 21:18749290-18749312 AATGGGAAAGAGCAGCAGGAAGG + Intergenic
1178006606 21:28227400-28227422 AGAGGGAAAGAGAGGGAGGAAGG + Intergenic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1178359310 21:31934644-31934666 GGTGGGAAAGAGGAGGACGAGGG - Intronic
1178361052 21:31948720-31948742 CCAGGGAAACAGAAGCTGGAAGG + Intronic
1178434480 21:32545909-32545931 CTAGGGAAAGGGAAGGAAGAAGG - Intergenic
1178702633 21:34846290-34846312 CCGGGGAAAGAGATGAATGAAGG - Intronic
1178750486 21:35297892-35297914 TATGTGAAAGAGAAAGAGGAAGG - Intronic
1178970133 21:37167090-37167112 CCTCAGAAAGAGAAGGAAAAAGG + Intronic
1179544853 21:42107139-42107161 GTTGGGAAAGAGAAGGAATAGGG - Intronic
1179871863 21:44247230-44247252 CCTGAGGAGGAGGAGGAGGAGGG - Intronic
1180048347 21:45319990-45320012 CCTGGGAGAGAAGAGGGGGATGG + Intergenic
1180330392 22:11473051-11473073 CCTGAGAAAGAGAATGGGAAAGG - Intergenic
1180331652 22:11486415-11486437 CCTGAGAAAGAGAATGGGAAAGG - Intergenic
1181460437 22:23083043-23083065 GTTGGGAGAGTGAAGGAGGAGGG + Intronic
1181934285 22:26428229-26428251 CCTGGGACAGGGAGGGAGGTGGG + Intergenic
1182474796 22:30571191-30571213 CCTGGGACTGAGAAGGAGCTGGG + Intronic
1182477307 22:30583183-30583205 GCTGGGGAAGGGAAGAAGGAAGG + Intronic
1182559563 22:31149096-31149118 CCAGGGAAATGGAAAGAGGAAGG + Intergenic
1182710896 22:32322640-32322662 GCTGGGAAAGAGCAGGATGGGGG + Intergenic
1182741075 22:32567891-32567913 GGTTGGCAAGAGAAGGAGGAGGG - Intronic
1183188388 22:36305762-36305784 GGTGGAAAAGAGAAGGAGGTGGG + Intronic
1183467042 22:37985030-37985052 CCTGGGAAAAGGTAGGAGGCAGG - Intronic
1183627824 22:39015414-39015436 ACGGGGAGAGAGAAAGAGGAGGG - Intronic
1183630409 22:39029195-39029217 ACTGGGAGAGAGAAAGAGGAGGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183633870 22:39049281-39049303 ACTGGGAGAGAGAAAGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183637028 22:39070371-39070393 CCTGGGAAGGAGGAGGAGGAAGG - Intronic
1183663157 22:39233366-39233388 CCAGGGAAAGAGAACGGGGGCGG - Intronic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1184257335 22:43294737-43294759 CACGGGGCAGAGAAGGAGGAGGG - Intronic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184374751 22:44104703-44104725 GCTGGGGCAGTGAAGGAGGAGGG - Intronic
1184385277 22:44170682-44170704 CCTGGGAAGGAGCTGGGGGAGGG - Intronic
1184677225 22:46050351-46050373 CCTGTGAAGGGGAAGAAGGATGG - Exonic
1185009927 22:48307160-48307182 CCTGAGACAGAGCAGGAGGAAGG - Intergenic
1185028792 22:48430871-48430893 CCTGAGCAAGAGAGGGAGGAGGG - Intergenic
1185072906 22:48667037-48667059 CCTGGGATTGAGGGGGAGGAGGG + Intronic
1185089383 22:48757251-48757273 GATGGGAAGGAGGAGGAGGAGGG + Intronic
1185089412 22:48757352-48757374 GATGGGAAGGAGGAGGAGGAGGG + Intronic
1185107690 22:48883579-48883601 CCTGGGAAGGAGAGGGAGTAGGG + Intergenic
1185231955 22:49688525-49688547 CCTGGGGAAGGGGAGCAGGAGGG + Intergenic
949725647 3:7041294-7041316 CCTGGGAATGGGAAGGTGGAAGG - Intronic
949832524 3:8230790-8230812 GCTGGGAAAAAGAAGGAGACAGG - Intergenic
949838756 3:8297637-8297659 CATGGCAAAGAGAGGGAGGGGGG + Intergenic
949903140 3:8836503-8836525 CCTGGGAAAGAAAATCTGGATGG - Intronic
950018373 3:9769669-9769691 CCTGGGACAGAGGTGGAGAAAGG + Intronic
950187093 3:10951926-10951948 CCTGAGGAAGAAGAGGAGGAGGG + Intergenic
950340428 3:12239473-12239495 CTTGGGAAAGCCAAGGAGAAGGG - Intergenic
950405246 3:12800203-12800225 GCTAGGAGAGAGAAGGAGGCTGG - Intronic
950726020 3:14917490-14917512 CCAGGGAAAGGGGAGGGGGATGG + Intronic
950932169 3:16800905-16800927 AGTGAGGAAGAGAAGGAGGAAGG + Intergenic
951017669 3:17747545-17747567 CCTGGGAAAGCTAAGGGGAAAGG - Intronic
951843954 3:27065396-27065418 CATGGGAAAGAGAAATAGCATGG - Intergenic
952041053 3:29262444-29262466 CCTGGCAAAGAGAAGGACCCTGG - Intergenic
952817273 3:37456534-37456556 TCTGGGGCAGAGAAGGAGGAGGG - Intronic
952887786 3:38022150-38022172 CCTGGGAGAAAGGTGGAGGAAGG - Intronic
953143201 3:40248640-40248662 CCTGGGAAAGACAAGGTCAATGG - Intronic
953211373 3:40878019-40878041 CCTGGCAAGGAGCAGGAGGTTGG - Intergenic
953979330 3:47405893-47405915 CCTGGGAGGGAGTGGGAGGATGG - Exonic
954291030 3:49650106-49650128 CCTGGGAAAGAGTGTGGGGAAGG + Intronic
954314942 3:49795905-49795927 CCTGGAACAGTGAGGGAGGAAGG - Intronic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
954535805 3:51358478-51358500 ACAGGGAGAGAGGAGGAGGAGGG - Intronic
954601469 3:51874002-51874024 GCTGGCAAAGAGGCGGAGGATGG - Exonic
954966064 3:54612109-54612131 CCTTGGGAAGAGGAAGAGGAAGG + Intronic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955166391 3:56518431-56518453 CCCTGGAAAGAAAAGAAGGAAGG + Intergenic
956608960 3:71102592-71102614 CTTGGGAAAGAGAAGAAAGACGG - Intronic
956642612 3:71429093-71429115 GCTGGGGACGAGAAGGTGGATGG + Intronic
956903054 3:73736657-73736679 CCTGGGAAAGGGAGGGAAGGAGG + Intergenic
957091015 3:75730237-75730259 CCTGAGAAAGAGAATGGGAAAGG + Intronic
957175838 3:76808400-76808422 CCTGGGACAGAGGAGGAAGGAGG - Intronic
957370124 3:79283218-79283240 GCTGGGAGAGGGATGGAGGAGGG + Intronic
957780004 3:84806811-84806833 CCAGGGACAGAAAAGGAGGCAGG + Intergenic
958658073 3:97028531-97028553 CCTTGGAAAGAGAAAGAGAAAGG - Intronic
959030935 3:101299007-101299029 CCTGAAAAAGACAAGGAGAAAGG - Intronic
959080386 3:101794692-101794714 TCTTGGGTAGAGAAGGAGGAAGG + Intronic
959182841 3:103004055-103004077 CTTTGGGAAGCGAAGGAGGAAGG - Intergenic
959802797 3:110515502-110515524 TCTGGGAAGGGAAAGGAGGAAGG - Intergenic
960139644 3:114139696-114139718 CCTGTGGATGAGAAGGGGGAAGG + Exonic
960324525 3:116279156-116279178 CCTGGGAAAGAGAGGGACAGAGG + Intronic
960951201 3:122999650-122999672 CCTGGGGAGGGGAAGGAGAAAGG - Intronic
961014513 3:123457290-123457312 CCTGGGAGCTAGAAGGAGGAGGG + Intergenic
961184981 3:124906906-124906928 GCTGGGAAAGAGATGGGGAATGG - Intronic
961673658 3:128551869-128551891 TCTGGGACACAGAAGGAGGTGGG - Intergenic
961990544 3:131185356-131185378 CCTGTGAAAGGCAAGCAGGAAGG + Intronic
962800839 3:138889255-138889277 CATGGCAAAGAGGATGAGGAAGG + Intergenic
962803634 3:138911124-138911146 GCTGGAAAATAGAAGTAGGAAGG - Intergenic
962952212 3:140229635-140229657 CCTGAGTGAGTGAAGGAGGAAGG + Intronic
963557251 3:146807698-146807720 TCTGGTAAAGAAAAGCAGGAAGG - Intergenic
963854301 3:150238180-150238202 ACAGTGAAAGAGAAGGAAGAGGG - Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964317201 3:155457230-155457252 GCTGGGAAAAAGGAGGATGATGG + Intronic
964780444 3:160331308-160331330 CCTGGGAAAACAAAGTAGGATGG + Intronic
965710063 3:171548295-171548317 CCTGGGCAACAGAGGGAGAATGG - Intergenic
965727715 3:171736662-171736684 CCTCCAAAAGACAAGGAGGAAGG + Intronic
965884029 3:173422602-173422624 GCTGGCAAGGAGAAAGAGGAAGG - Intronic
965909370 3:173752782-173752804 ACTGGGAAGTAGAAGGAGAATGG - Intronic
966044011 3:175528330-175528352 CCTGGGAAATAGATGTAGGCTGG + Intronic
966294373 3:178401968-178401990 TATGGGAAGGAGAAGGAGAAGGG - Intergenic
966905890 3:184525700-184525722 CCTGGGAAAGAGAAAGCGGCCGG - Intronic
966916613 3:184587770-184587792 CTTGGCAGAGAGAAGGAGAAAGG + Intronic
967376793 3:188812945-188812967 GCAGGGAAAGGGAAGGAGAATGG + Intronic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
967840749 3:194003134-194003156 CCTGGGAGCGGGAGGGAGGAGGG - Intergenic
968075993 3:195816401-195816423 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076105 3:195816820-195816842 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076118 3:195816864-195816886 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076156 3:195816998-195817020 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076170 3:195817042-195817064 CCCGGTAAGGAGAAGGAGGCCGG - Intergenic
968076181 3:195817081-195817103 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076205 3:195817165-195817187 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076218 3:195817209-195817231 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
968076267 3:195817387-195817409 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076280 3:195817431-195817453 CCTGGTAAGAAGAAGGAGGCTGG - Intergenic
968076305 3:195817520-195817542 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968286081 3:197509732-197509754 CCTGGGAACTAGAGGAAGGAGGG - Intergenic
969135417 4:5025129-5025151 CCTGAGTCAGAGAAGGGGGAAGG - Intergenic
969578820 4:8052003-8052025 CCTGGTAGAGAGAAAGAGGGAGG - Intronic
969849757 4:9947071-9947093 CCTGGGGAAGAGGGGTAGGAAGG - Intronic
970012980 4:11480935-11480957 CCTGTGAAAGACAAAGGGGAAGG + Intergenic
970422326 4:15916855-15916877 CCTGTGGAAAAGAAGGAGCATGG - Intergenic
970581454 4:17477608-17477630 CCTGGTAGAGAAAGGGAGGATGG - Intronic
970754654 4:19410808-19410830 TTTGGGGAAAAGAAGGAGGAAGG + Intergenic
970923005 4:21417094-21417116 CTTGAGAAAGAGAAGAATGATGG - Intronic
971134738 4:23855865-23855887 GCTGGCAAAGAGATGCAGGAAGG + Intronic
971152068 4:24043901-24043923 ACTTGGAAAGACATGGAGGAAGG + Intergenic
971862817 4:32130107-32130129 GCTGAGAAAGAGGAGGAAGAGGG + Intergenic
971934320 4:33128127-33128149 CCAGGGAAAGGGTGGGAGGAGGG - Intergenic
971967893 4:33585745-33585767 GTTGGGGAAGAGAAGGAGGCAGG + Intergenic
972601141 4:40573702-40573724 CCTGGGGAAGAGACAGAGCAAGG + Intronic
972790245 4:42364909-42364931 GGAGGGAAAGAGAAAGAGGAAGG - Intergenic
973251950 4:48069750-48069772 ACTGAGACATAGAAGGAGGAAGG - Intronic
973669365 4:53199908-53199930 CATGGCAGAGAGAAGGAGGGAGG + Intronic
973760464 4:54110004-54110026 CGTGGGAAAGAGACGTGGGAAGG + Intronic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
974597003 4:64027245-64027267 GATGGGAATGAGAAGGAGGTGGG - Intergenic
975029663 4:69599766-69599788 CCTGGGAAAGGAAGGAAGGAGGG + Intronic
976379697 4:84385082-84385104 GCTTGGAAAGAGAAGGAGACAGG + Intergenic
976455043 4:85236670-85236692 CCTAGGAAACAGAAGCAGCAAGG - Intergenic
977174009 4:93797470-93797492 CCTTGGAAAGATACAGAGGAAGG + Intergenic
977435728 4:96991678-96991700 CTTGGGAATGTGCAGGAGGAGGG + Intergenic
978490171 4:109303271-109303293 TGTGGGAAAGTGAGGGAGGAGGG - Intergenic
978760318 4:112350428-112350450 CCAGGGATGGAGTAGGAGGAGGG - Intronic
978937114 4:114391085-114391107 CCAAGGAAAGAGACGGAGAATGG - Intergenic
979798002 4:124871266-124871288 ACTGGGAAAAGGTAGGAGGAAGG - Intergenic
979828852 4:125275604-125275626 GCTGAGAAAGAGGAGAAGGAGGG + Intergenic
979968656 4:127107364-127107386 CCTGAAAGAGATAAGGAGGATGG + Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
981421913 4:144560628-144560650 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
982432917 4:155343268-155343290 AGTGGGAGAGAGAAAGAGGAGGG + Exonic
983658713 4:170110101-170110123 AATAGGAAAGAGTAGGAGGAAGG + Intergenic
983671408 4:170241850-170241872 CCAAGGAAATAGAAGGAGGCTGG - Intergenic
984155034 4:176186289-176186311 ACTGGGAAAGGGAAAGAGCAGGG - Intronic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984885687 4:184447182-184447204 CCTGGGAAAGGAAATAAGGAAGG + Intronic
984918885 4:184746873-184746895 CCTGAGAAAGAGAAAATGGAAGG + Intergenic
985010222 4:185574194-185574216 CCTGGGAAGGAAGCGGAGGAGGG + Intergenic
985026883 4:185747183-185747205 CGTCGGCAAGACAAGGAGGAAGG + Intronic
985280570 4:188282653-188282675 CCGGGGATAGGGAAGGAGGAAGG - Intergenic
985846896 5:2356448-2356470 GCTGGGACAGAGAGGGAGGAAGG - Intergenic
985887237 5:2689030-2689052 CCAGGGAAAGACAAGGAGAGAGG + Intergenic
986517751 5:8581328-8581350 AGTGGGATAGATAAGGAGGATGG - Intergenic
986578296 5:9235594-9235616 CCTGGGAGAGGGAAGGAGGGTGG + Intronic
986613881 5:9597116-9597138 CCAGTGACAGAGGAGGAGGAAGG - Intergenic
986649493 5:9949269-9949291 CCTGGGCAAGAGTGGGGGGATGG + Intergenic
986773519 5:10994377-10994399 CCGGGGAAAGAGGAGGGGGGCGG + Intronic
986922891 5:12709216-12709238 TCTGGAAGAGAGAAGGAGGATGG + Intergenic
988632921 5:32950412-32950434 CCTAGTAATGTGAAGGAGGACGG + Intergenic
988844624 5:35115619-35115641 CCTGGGAAAGGGCTGGAGGTGGG + Intronic
989229723 5:39073507-39073529 CCCGGGAAAGGGAAGCAGAAGGG + Intronic
989400076 5:40999388-40999410 TCTGGGGAAAAGAAGGAGCAAGG + Intronic
990090187 5:52035409-52035431 GCAGGGAAAGCGATGGAGGAGGG + Intronic
990597933 5:57329932-57329954 GCTGGGAATGGGAAGGAGGCAGG - Intergenic
990804487 5:59643407-59643429 TCTGGGAAAAAGCTGGAGGAAGG + Intronic
990827198 5:59914298-59914320 CCTGGGAAAGGTAAGGAGCCTGG + Intronic
991654551 5:68891141-68891163 GCTGGAAAAGAGTAGGGGGAAGG - Intergenic
992339150 5:75804749-75804771 CGTAGGAAAGAAAAGAAGGAAGG - Intergenic
992483781 5:77176499-77176521 CATGGGCATGAGCAGGAGGAGGG + Intergenic
992689862 5:79231684-79231706 CCTGTGGAAGAGAAGGGGAAGGG - Intronic
992952356 5:81872855-81872877 AGAGGGAAAGAGAAGGAGGGTGG - Intergenic
992996551 5:82339730-82339752 CCTGGGAGAAGGTAGGAGGATGG + Intronic
994086497 5:95765446-95765468 CCTGGGAAAGCACAGGAAGAAGG - Intronic
994128500 5:96197254-96197276 ACTGGGAAAGAGAAGGCTGTGGG - Intergenic
994920659 5:106039012-106039034 CATGGGGATGAGAAAGAGGAAGG - Intergenic
994945058 5:106377164-106377186 AGTGAGAAAGGGAAGGAGGAAGG - Intergenic
995285799 5:110386871-110386893 CCTGGGAGAGAGCAGGTGGGAGG + Intronic
995387763 5:111607144-111607166 GCTGGGGAAGAGAAGGAGGAGGG - Intergenic
995712594 5:115050355-115050377 TCTGAGAAAGAGTAAGAGGAGGG - Intergenic
996548346 5:124704940-124704962 ACTGGGAAACAGAAGAAGGGTGG + Intronic
996813616 5:127548100-127548122 CCTGGAAAACAAAAGGAGGAAGG - Intronic
997045556 5:130312649-130312671 CCTGTTAAAAAGAGGGAGGATGG - Intergenic
997253247 5:132407613-132407635 CCTGTGAAAGAGAAGAGGGAAGG + Intergenic
997366630 5:133329575-133329597 CCTGGGAAAAAGATGTAGGCTGG + Intronic
997632180 5:135377192-135377214 CCTGGGAAGGAGAAGGTGCCTGG + Intronic
997836094 5:137194640-137194662 CCCGGGAAAGAGGAGGATGTTGG - Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998510952 5:142713518-142713540 CCTGGGAAACAGGAGGAGAACGG - Intergenic
998605925 5:143634509-143634531 CCTGGGAAGAAGAACCAGGATGG + Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
998708352 5:144791477-144791499 CCGGGGGAAGGGAAGGAAGAGGG - Intergenic
999082202 5:148855231-148855253 CCAGGGGAAGAAAAGGAGCATGG + Intergenic
999253251 5:150195107-150195129 CCTGGGGATGAGAGGGAGGAAGG - Intronic
999435404 5:151559574-151559596 GCTGGAAGAGAGGAGGAGGATGG - Intronic
999795785 5:154988664-154988686 AGTGGGAAACAGAAAGAGGATGG - Intergenic
1000115726 5:158151735-158151757 CCTGGGCAACAGAGCGAGGAAGG - Intergenic
1000215673 5:159153632-159153654 CTTGGGAAAGAGGAGGTGGAGGG + Intergenic
1000731399 5:164838651-164838673 AATAGGAAAGAAAAGGAGGAAGG - Intergenic
1000759663 5:165206672-165206694 CCTGGGAAAGAGAAGTGTGTGGG + Intergenic
1001145013 5:169176252-169176274 CCTGAGAAAAAGAAGGAAGAAGG - Intronic
1001148003 5:169201729-169201751 CCAGGGGAAGAGAAGGAAGGAGG + Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001295469 5:170495890-170495912 CCAGGAAGAGGGAAGGAGGAAGG - Intronic
1001319558 5:170669028-170669050 GATGAGAAAGAGAAGCAGGAGGG - Intronic
1001425269 5:171618512-171618534 CCCAGGAAAGGGGAGGAGGAGGG - Intergenic
1001629119 5:173161406-173161428 CCTTGGAGAGAGAGGGAGCAAGG + Intronic
1002563496 5:180097771-180097793 CCTGCAAAAGAGGAGGAGGCAGG + Intergenic
1003147410 6:3520362-3520384 CCAAGGAAAGGGAAGAAGGAAGG - Intergenic
1003895094 6:10599847-10599869 CCTGGCACATAGAAAGAGGAAGG + Intronic
1004063057 6:12217192-12217214 CCTGGGCAAGAAAAGAAGCAAGG - Intergenic
1004076186 6:12346155-12346177 CCTGGGAGAGGGATGGAGGAAGG + Intergenic
1004294844 6:14401211-14401233 CTAGGGAAAGAGAAAGAGTAGGG - Intergenic
1004428639 6:15523788-15523810 CCTGGGGAAGAGAAGGAGCTTGG - Intronic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005309397 6:24544942-24544964 CCAAGGACAGAAAAGGAGGAGGG + Exonic
1005674640 6:28141538-28141560 GCTGGGAAAGTGTTGGAGGAGGG - Intergenic
1006004065 6:30988639-30988661 CTTGGGAGAGATAAGGAGGGAGG + Exonic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006313958 6:33279517-33279539 CCTGGTGAAGAGGAAGAGGAAGG - Exonic
1006386679 6:33734878-33734900 CCTCTGAAAGCCAAGGAGGATGG - Intronic
1006511898 6:34526022-34526044 CCAGGGAGGGGGAAGGAGGAGGG + Intronic
1006671595 6:35732688-35732710 ACTGGTAAAGAGAATGAGGAAGG + Intergenic
1006677719 6:35776474-35776496 CCTGCGGAAGGGAAGGAGGGAGG - Intergenic
1006922546 6:37636277-37636299 CCAGGGGCAGTGAAGGAGGAGGG - Exonic
1007036230 6:38676695-38676717 TTTGGGAAAGGGGAGGAGGAAGG - Exonic
1007116688 6:39348096-39348118 CCTGGAGAAGGGAAGGAGAAAGG + Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007335788 6:41154090-41154112 CCTGGGGAAGGAAAGGAGGTGGG + Exonic
1007342705 6:41201546-41201568 CCTGGGAGAGAGAGAGAGGAAGG - Intergenic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1007714258 6:43845254-43845276 CCTGGAAAGGAAAAGAAGGAGGG - Intergenic
1008520313 6:52356783-52356805 CCTGGGGGAGAGAGGGAGGTGGG - Intergenic
1009194185 6:60664805-60664827 CCTGGGGAAGAGGCAGAGGAAGG + Intergenic
1009497328 6:64367490-64367512 TTTTGGAAAGAGAGGGAGGATGG + Intronic
1009578600 6:65500748-65500770 CCTGGGAGAGAGAAATAAGAGGG - Intronic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1010061600 6:71628719-71628741 TCTGGCAAGGATAAGGAGGAGGG - Intergenic
1010756763 6:79674053-79674075 CTTTGGAAACAGAAGTAGGAAGG + Intronic
1010915574 6:81613883-81613905 CCTGGAACAGGGAAGAAGGAAGG + Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012258416 6:97060548-97060570 CCGGTGAAAGAGGAGGAGAATGG - Intronic
1012270888 6:97209030-97209052 CCTGTGATAAGGAAGGAGGAGGG - Intronic
1012625374 6:101398963-101398985 CCTGTGAAAGCAGAGGAGGAGGG - Exonic
1012849923 6:104434344-104434366 TCTGGGGATGGGAAGGAGGAAGG + Intergenic
1012919397 6:105205856-105205878 CCAGGGAAAGAGAAAGAATAGGG - Intergenic
1013048413 6:106510268-106510290 CCTGGGAAAGCGGGGGAGCAGGG - Intergenic
1013370855 6:109470020-109470042 CCTGGGAATGATGAGGAGGGTGG + Intronic
1013677891 6:112487517-112487539 CCTGGGAGAGAAAAAGAGAAGGG - Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1014294914 6:119606219-119606241 CATGGGACAGAGAAGTAGGAGGG - Intergenic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1014811345 6:125889731-125889753 CCTGGGAAAGAGAACTACTAAGG - Exonic
1015213412 6:130722431-130722453 AGAGGGCAAGAGAAGGAGGAAGG + Intergenic
1015671330 6:135693257-135693279 CCTGGAGAAGAGAAGGCAGAAGG + Intergenic
1015802953 6:137078925-137078947 CCGGGGAAAGTGTAGGAGGTGGG - Intergenic
1016090583 6:139973877-139973899 ACTAGGACAGAGAAGAAGGAGGG - Intergenic
1016130490 6:140462315-140462337 CCTGGGAATTAGAAGGAGTTTGG - Intergenic
1016544238 6:145202592-145202614 CCTGGGAAACATAAGAAGGGAGG - Intergenic
1017074993 6:150609754-150609776 AGTGGTACAGAGAAGGAGGATGG + Intronic
1018478937 6:164170896-164170918 CCTGGGAATGATGGGGAGGATGG - Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018711415 6:166500424-166500446 CCAGGGAGTGAGAAGGAGGCAGG + Intronic
1018731022 6:166650499-166650521 GCTGGAGGAGAGAAGGAGGAGGG + Intronic
1018768854 6:166955682-166955704 CCTGGGAAGGAGTAGGGGGTAGG - Intronic
1018950177 6:168373984-168374006 CCAGGGAAGGAGAAGGAGCTGGG + Intergenic
1019263064 7:93141-93163 CCAGGGAATGAGAAGGAGTGAGG - Intergenic
1019938876 7:4273755-4273777 CCTGGGGAAGAGACTGAGCATGG - Intergenic
1020100841 7:5393605-5393627 CCTGGGAGGAGGAAGGAGGAAGG + Intronic
1021913411 7:25408563-25408585 GCTGGGAAAGATGAAGAGGAGGG - Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022175626 7:27869506-27869528 CATGGGGAGGAGAAGGGGGATGG - Intronic
1022480451 7:30740034-30740056 CCAGGGTAAGAGAAGGAGTGGGG + Intronic
1023219414 7:37903565-37903587 CCTGTGAGAGAGAATGGGGAGGG - Intronic
1023242982 7:38168673-38168695 CCTGGCTAAGAGAAAGGGGATGG + Intergenic
1023281750 7:38577769-38577791 GGAGAGAAAGAGAAGGAGGAAGG + Intronic
1023677812 7:42649066-42649088 CGTGGGAAAGAAAGGGAGCAGGG + Intergenic
1024871888 7:53973137-53973159 CCTGGGAAAAAGAAGAATGTGGG - Intergenic
1024875718 7:54020714-54020736 CGGGGGAAAGAGTGGGAGGAGGG - Intergenic
1024991024 7:55234561-55234583 CCTGGGAAACAGGAGCAGGAGGG + Intronic
1025085921 7:56023171-56023193 CCTGGGAAGGAGAACGAAAATGG + Intronic
1025888314 7:65620660-65620682 CCTGGGTATTAGGAGGAGGAAGG + Intergenic
1026018670 7:66692316-66692338 CATGGGTAAGAGAGGGAGGCAGG - Intronic
1026547405 7:71335605-71335627 CCGGGGAAAGAGTAGCCGGAAGG - Exonic
1026881732 7:73910382-73910404 CATGGGTAAGAGAGGGAGGCAGG + Intergenic
1026894042 7:73999880-73999902 CCTGGGAAAGAAAAGAAACACGG - Intergenic
1026910488 7:74088963-74088985 CCTGGGACAGTGACTGAGGATGG + Intronic
1027218636 7:76200372-76200394 GCTGAGGAAGGGAAGGAGGATGG + Intergenic
1027246548 7:76371408-76371430 CATGGGAATGAGAAGGAGTGTGG + Intergenic
1027305548 7:76892587-76892609 CCAGGAAAAGGAAAGGAGGAAGG - Intergenic
1027343911 7:77238002-77238024 TCTGGGCAAGATAAGAAGGAGGG - Intronic
1028242399 7:88437267-88437289 CTTGAGAAAGTGAAAGAGGATGG - Intergenic
1028424706 7:90673422-90673444 CCTGGGCAACAGAGGGAGGGAGG - Intronic
1028492127 7:91424249-91424271 CCTGGGAAAGAAAAGAAAAAAGG + Intergenic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1029184889 7:98731438-98731460 ACTGTGGAAGAGGAGGAGGAGGG + Intergenic
1029408643 7:100393792-100393814 CCTGGCAAAAAATAGGAGGAAGG + Intronic
1029611733 7:101630248-101630270 ACTGGGAGGGAGCAGGAGGAGGG - Intergenic
1030334764 7:108313314-108313336 CCAGAGAAAGAGAGGAAGGATGG + Intronic
1031854121 7:126901307-126901329 CCTGGGTATTAGGAGGAGGAAGG - Intronic
1032130340 7:129222802-129222824 CCTGGCAAGGAGAAGGAAGGAGG - Intergenic
1032478416 7:132227619-132227641 GCGGGGGGAGAGAAGGAGGAGGG + Intronic
1032505514 7:132431502-132431524 ACTGTGAGAGGGAAGGAGGAAGG + Intronic
1032619116 7:133509522-133509544 CCAGGGAGAGAGGAAGAGGAAGG - Intronic
1032763791 7:134971197-134971219 ACTGGCAATGAGAAGGAGGATGG - Intergenic
1033045969 7:137962450-137962472 TCAGGGAAGGGGAAGGAGGATGG - Intronic
1033147989 7:138887576-138887598 CTTGGGAAAGGGAAGGTGGGAGG - Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033606858 7:142933829-142933851 CCTGGGGAAGAAAAGGAGGAGGG + Intergenic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034400708 7:150859812-150859834 GCTGAGGAAGAGGAGGAGGAGGG + Intronic
1034447054 7:151119096-151119118 TGTGGGAAAAAGGAGGAGGAGGG + Intronic
1034902549 7:154916356-154916378 CCTGGGAAAGCTAAGGATGGAGG - Intergenic
1035041906 7:155935181-155935203 CGTGAGGAAGAGGAGGAGGAGGG - Intergenic
1035268205 7:157703867-157703889 ACAGGGAAAGAGAAAGTGGAGGG - Intronic
1035483590 7:159205465-159205487 CCAAGGAAAGCAAAGGAGGAAGG + Intergenic
1035704428 8:1664316-1664338 CCTGGGAAGCAGGAGTAGGACGG - Intronic
1035759073 8:2055956-2055978 CCTGGGAAGGAGGCGGTGGAGGG - Intronic
1035760449 8:2064783-2064805 CCAGGAGAGGAGAAGGAGGAGGG - Intronic
1035790407 8:2298755-2298777 GCAGGGAGAGAGTAGGAGGACGG - Intergenic
1035802398 8:2422950-2422972 GCAGGGAGAGAGTAGGAGGACGG + Intergenic
1035834498 8:2734033-2734055 GCTGGGTATGAGAGGGAGGAAGG - Intergenic
1035922693 8:3694619-3694641 CCTGGGCATGAGAGGGAGGCTGG + Intronic
1036029460 8:4951491-4951513 ACAGGGAAAGGGAAAGAGGAAGG + Intronic
1036080930 8:5554676-5554698 GGTCTGAAAGAGAAGGAGGAAGG - Intergenic
1036289000 8:7470644-7470666 TCTAGGAAAGTGGAGGAGGATGG - Intronic
1036332475 8:7840884-7840906 TCTAGGAAAGTGGAGGAGGATGG + Intronic
1036387348 8:8294051-8294073 CCTGGGAAAGAAGAAGAGGAGGG + Intergenic
1036561482 8:9903477-9903499 CCTGAGGAAGGAAAGGAGGAAGG + Intergenic
1036681072 8:10874703-10874725 CTTGGAAATGAGAAGGAGAAAGG - Intergenic
1036734008 8:11292042-11292064 CTTGGAAAAGAAAAGAAGGAAGG - Intronic
1037102574 8:15065326-15065348 CCTGGGTCAGAGGAAGAGGAAGG - Intronic
1037787870 8:21913066-21913088 CCAGGGAAGGGGAAAGAGGATGG + Intronic
1038281341 8:26168045-26168067 CCTCAGAAGGAGAAGGAGGTGGG - Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1039080660 8:33731277-33731299 TCTGGGAAAGAGACAGAGGCGGG + Intergenic
1039456797 8:37712596-37712618 ACAGGGAAACAGAAGGAGGTGGG - Intergenic
1039475808 8:37838934-37838956 CCTGGGAAAGGGCAGGAAGGAGG - Exonic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1039847610 8:41336849-41336871 CTTGGGAGAGAGTATGAGGAAGG - Intergenic
1039920180 8:41888220-41888242 CTTGGGAAAGAGGAGGGGGACGG - Intronic
1040740399 8:50567997-50568019 CCTGGGGAAGGGAAAGAGAAGGG - Intronic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041571875 8:59346440-59346462 CCTGGGAAAAAGAAAAATGAAGG + Intergenic
1041645069 8:60243276-60243298 CCTGGAAAAGAGGAGGAGGGAGG - Intronic
1042461056 8:69069349-69069371 CTTGGGAAAAAGAAAGATGAAGG - Intergenic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1043657724 8:82691560-82691582 ACTGGGAAAGAGAAGAGGGCTGG + Intergenic
1045219049 8:100179137-100179159 CCTTGGAAAGCCAAGGAGGGTGG + Intronic
1045287813 8:100807154-100807176 CCTGTCAAATGGAAGGAGGAGGG - Intergenic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045426786 8:102075008-102075030 CCAGGCAAAAGGAAGGAGGAAGG + Intronic
1045522391 8:102914600-102914622 CCTGGGGAAGAGAAGGAGCATGG - Intronic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1046958172 8:120083036-120083058 CTTAGGAAAGGGAGGGAGGAAGG + Intronic
1047254243 8:123204066-123204088 CCTGGGAAAGGGATGCAAGAAGG + Intronic
1047641201 8:126823607-126823629 GCAGAGAAAGAGAAAGAGGAGGG + Intergenic
1047749216 8:127867253-127867275 CCTGGGAGGGTGGAGGAGGAGGG + Intergenic
1047785321 8:128148659-128148681 GGTGGGAAAGAGAAGGAGGGAGG + Intergenic
1047938313 8:129803140-129803162 AGTGGCAAAGAGAAGGAGAAAGG - Intergenic
1047962122 8:130018074-130018096 CCTGGCCAAGAGAAGGCGCAAGG - Intergenic
1048037157 8:130688242-130688264 CCTGAGACATAGATGGAGGAAGG + Intergenic
1048081150 8:131128673-131128695 CCTGGGGAAGAGAAGGTTCACGG + Intergenic
1048199401 8:132359365-132359387 CCTATGAGAGAGAAGGAGCAAGG - Intronic
1048842379 8:138577285-138577307 CCTGGCAAAGAGAAGAGGGGAGG - Intergenic
1049199783 8:141334427-141334449 GCTGGGACAGAGAGGGACGAGGG - Intergenic
1049199866 8:141334735-141334757 CCTGGTAAACAGTAGGAGCACGG + Intergenic
1049276611 8:141723260-141723282 TCTGGCAAAGAGGAAGAGGAGGG - Intergenic
1049308091 8:141918154-141918176 TCTGGGAAAGAGGAGGGGGATGG + Intergenic
1049322855 8:142006208-142006230 CCTGGGCTTGAGAAGAAGGAAGG - Intergenic
1049341120 8:142113194-142113216 CCTGGGAAGGAGCAGGAAGCAGG - Intergenic
1049439202 8:142601504-142601526 TCTGGGAATGAGGAGGAGGCCGG + Intergenic
1049558381 8:143295205-143295227 GCTGGGAAAGCAAAGGAGGCTGG - Intronic
1049562986 8:143321352-143321374 GCAGGAAATGAGAAGGAGGACGG - Exonic
1050203486 9:3173894-3173916 TCGTGGAAGGAGAAGGAGGAGGG + Intergenic
1050342717 9:4656431-4656453 CCTGTGAAAGAAAGGAAGGAAGG + Intronic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051242336 9:15072367-15072389 TCTGGGAAGGAGAAATAGGATGG + Intergenic
1052338263 9:27340871-27340893 GCTGGGTATGAGAAGGAGGGAGG - Intronic
1053003343 9:34589786-34589808 CATGGGCGAGAGAAGGAGGGAGG - Intronic
1054746187 9:68856249-68856271 CCAGGGATAGAGAAGCAGTAAGG - Intronic
1054784925 9:69201363-69201385 CCTGACAAAGAAAAGGGGGAGGG - Intronic
1055075028 9:72205333-72205355 CCTGAGAAAGGGAAGAAGGAAGG - Intronic
1055091630 9:72369304-72369326 GCTGGGAACGAAAGGGAGGAAGG - Intergenic
1055441592 9:76342011-76342033 CCTGGAGCAGAGAAGGTGGATGG + Intronic
1055705783 9:79001313-79001335 TGTGGGAAAGAGAAGAAAGAGGG - Intergenic
1055796177 9:79977114-79977136 ACTTGGAAAGGGCAGGAGGAAGG - Intergenic
1056017527 9:82406256-82406278 ACTGGGACAAATAAGGAGGAAGG - Intergenic
1056108567 9:83372100-83372122 CCTGGGAAAGTGGACGTGGAGGG + Intronic
1056496843 9:87164491-87164513 CCAGGCAAAGAGTTGGAGGAGGG - Intergenic
1056545111 9:87606659-87606681 ACAGGGAGAGAGAGGGAGGAAGG - Intronic
1056568279 9:87793977-87793999 CCTTGGAAAGACATTGAGGAAGG - Intergenic
1056655084 9:88502622-88502644 CCTGGGGGACACAAGGAGGATGG - Intergenic
1057194797 9:93110951-93110973 CATGAGAGAGAGACGGAGGAAGG - Intronic
1057497721 9:95574134-95574156 ACAGAGAAAGAGAAGCAGGAAGG - Intergenic
1057851936 9:98572668-98572690 CCTGAGAGTGAGAAGGAGGCAGG + Intronic
1057948170 9:99348050-99348072 CCTGGGAAACAGAAAGAAAAAGG - Intergenic
1058199912 9:102026845-102026867 CCTGAAAAAGACAAGGAGAATGG - Intergenic
1058315148 9:103555524-103555546 CCTGAGAAAGATGAGGAGAATGG + Intergenic
1058436547 9:104968781-104968803 ACTGGGAAAGGGTAGGAGGTGGG - Intergenic
1059002598 9:110365697-110365719 ACAGGGAAAGAGAAGGAAAAAGG - Exonic
1059424017 9:114209653-114209675 CCTAGGAAAGAGAAGAAAGGGGG - Exonic
1059426075 9:114221770-114221792 GCTGAGAAAGGGAAGGAGGCTGG + Intronic
1059493679 9:114691520-114691542 CTTTTGGAAGAGAAGGAGGAAGG + Intergenic
1060135453 9:121149037-121149059 CCATGGGAAGGGAAGGAGGAAGG - Intronic
1060250873 9:121986069-121986091 CCTGGGCCAGAGGAGGAGCATGG - Intronic
1060307940 9:122433306-122433328 CTTGGGAAAGAGAAGGTTGGTGG - Intergenic
1060344424 9:122803918-122803940 CCTGGGGAAAACAAGGAGAAGGG + Intronic
1060718311 9:125955319-125955341 CCTGGGGAGGAGCAGGAGCAAGG - Intronic
1060943763 9:127558047-127558069 CCAGGAAAAGAGGAGGGGGAAGG - Intronic
1061147589 9:128808892-128808914 CCAGGGAGGGAGAAGGAAGAGGG + Exonic
1061366903 9:130176947-130176969 CATGGGGAGGAGAAGGAGAAGGG - Intronic
1061517250 9:131096960-131096982 CCAGGGGAAGGGAAGGAAGAGGG - Intronic
1061772835 9:132939960-132939982 TCTAGGAAAAAGAAGGATGAAGG + Intronic
1061901403 9:133674043-133674065 CCTGCCAAAGAGAGGGAGGCTGG + Intronic
1062066658 9:134531584-134531606 CCTGGTCAAGAGTAGGTGGAGGG + Intergenic
1062098253 9:134713828-134713850 CCCGGGACAGAGAAGGTGGGTGG + Intronic
1062136352 9:134930387-134930409 GCAGGGAAAGAGAAGGAGTGTGG - Intergenic
1062164555 9:135100984-135101006 CCTGGGAAGAGGGAGGAGGAAGG - Intronic
1062212485 9:135372501-135372523 CCTGGGAAAGACTCGGGGGAGGG - Intergenic
1062358338 9:136175681-136175703 CCTGGGAACGGGAAGGCTGATGG - Intergenic
1062411911 9:136429983-136430005 CCTGGGACAGAGCCGCAGGAAGG + Intronic
1062509295 9:136896035-136896057 CCTGGGAAAGAGGTGGAGGAAGG - Intronic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1203768183 EBV:37235-37257 CCGGGGACAGAGCAGGGGGAGGG + Intergenic
1203778904 EBV:89721-89743 CCAGGGTAAGAGGAGGAGGGCGG - Intergenic
1203485450 Un_GL000224v1:49305-49327 CCTGAGAAAGAGAATGGGAAAGG - Intergenic
1185532468 X:832905-832927 CATGGGAAAGAGGAGGGGGTTGG + Intergenic
1185878795 X:3722042-3722064 CCTGTGAAAGAAAAAAAGGAAGG + Intergenic
1185950348 X:4425468-4425490 ACAGGGAGAGAGAAGGAGGAAGG + Intergenic
1186185808 X:7018706-7018728 TCTTGGAAAGGGAGGGAGGAAGG - Intergenic
1186296609 X:8155578-8155600 ACTGGCAAAGAAAAGGAGGTGGG + Intergenic
1186423005 X:9441483-9441505 GGTGGGGAAGAGAAGGAAGAGGG - Intergenic
1186953969 X:14659681-14659703 CCTGGGAGAAAGAAGGAGAAAGG + Intronic
1186962611 X:14752935-14752957 CCAGAGACAGAGAAGAAGGAAGG - Intergenic
1187137159 X:16559195-16559217 CCAGGGAGAGAGAGGGAGGGAGG - Intergenic
1187555541 X:20347859-20347881 CCTGTGAAAGCAGAGGAGGAAGG - Intergenic
1187576224 X:20559173-20559195 CAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1188013001 X:25077233-25077255 CCTGGGGACAGGAAGGAGGATGG - Intergenic
1188116656 X:26252346-26252368 CCTGAGAAAGGGAAAGAGCATGG + Intergenic
1188215741 X:27474859-27474881 CCTGGGCCAGAGAAGTAGGTAGG - Intergenic
1188310757 X:28613666-28613688 ACTGGGCAAGAGAATGTGGATGG - Intronic
1189261733 X:39684023-39684045 CCTAGAAAAGAAAAGGAAGAGGG - Intergenic
1189353326 X:40293599-40293621 CCAGGAAAAGAGAAGGGGGTCGG + Intergenic
1190061101 X:47212278-47212300 CCTGGGAGAGAAAAGGGGCAAGG - Intronic
1190478722 X:50853233-50853255 CCTCAGAAAGAGAAGGAAAAGGG - Intergenic
1190894965 X:54608500-54608522 CGGGGGAAAGAGTAGGAGGGGGG - Intergenic
1190913296 X:54791084-54791106 CCTGGGCAGGAAAGGGAGGATGG + Exonic
1191934441 X:66411319-66411341 CCTGTGAAAAAGATGGAGGAGGG - Intergenic
1192198549 X:69048575-69048597 TCAGGGAAAGAGGAGGCGGAGGG - Intergenic
1192318135 X:70067463-70067485 CCTGGGAGAGAAAGGAAGGAGGG + Intergenic
1192331842 X:70182023-70182045 GGTGAGAAAGAAAAGGAGGAAGG - Intronic
1192522862 X:71816590-71816612 TCTGGGAGAGACAGGGAGGATGG + Intergenic
1193150186 X:78116826-78116848 GCTGGGACAGAGAAGGCAGATGG - Intronic
1194275531 X:91876208-91876230 TCGGGGAAAGAGAAGGAAGGTGG + Intronic
1194390073 X:93306278-93306300 AGTGGGAAAGAGAAGGTGGCTGG - Intergenic
1194409643 X:93542349-93542371 CCTGGGAAAGAGAAAGAAATGGG - Intergenic
1194542889 X:95196580-95196602 CCTGCCAAAGTGAAGGAGCATGG - Intergenic
1195082369 X:101383899-101383921 TCTGGGGAGGGGAAGGAGGAGGG - Intronic
1195394032 X:104391852-104391874 AGTGGGGAAGAGAAGCAGGAGGG + Intergenic
1196050325 X:111297596-111297618 ACTGTGGAGGAGAAGGAGGAAGG + Exonic
1196576603 X:117325747-117325769 CCATGGAAAGGGAAGGAAGAGGG - Intergenic
1196834486 X:119801906-119801928 GGAGGGAAAGAGAAGGAGGGAGG - Intergenic
1196834502 X:119801986-119802008 GAAGGGAAAGAGAAGAAGGAAGG - Intergenic
1197005996 X:121499113-121499135 TCTAGGAAAGAGCAGCAGGAAGG + Intergenic
1197276886 X:124489855-124489877 CCAAGGAAAGAGGAGCAGGAAGG - Intronic
1197765305 X:130056186-130056208 TCGGGGAAAGACAAGGAGGTGGG - Exonic
1197838822 X:130723715-130723737 CCTGGGAAACAAAATGGGGAGGG - Intronic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1197965003 X:132050803-132050825 CCTGGGAAAAATAAGGATAATGG + Intergenic
1198011500 X:132560590-132560612 CCTGAGGCAGAGCAGGAGGAGGG + Intergenic
1198273545 X:135079081-135079103 CTAGGGAAAAAAAAGGAGGAGGG - Intergenic
1198313160 X:135439027-135439049 CGTGGGAAAGAGGAAGGGGACGG + Intergenic
1198724372 X:139661533-139661555 TGTGGGAAGGAGAAGGAGAAAGG + Intronic
1199950984 X:152706145-152706167 CCTGAGGGAGAGAAGGGGGAAGG + Intergenic
1199953281 X:152722759-152722781 CCTGAGGGAGAGAAGGGGGAAGG + Intergenic
1199956401 X:152745691-152745713 CCTGAGGGAGAGAAGGGGGAAGG - Intergenic
1199958698 X:152762316-152762338 CCTGAGGGAGAGAAGGGGGAAGG - Intergenic
1199988090 X:152966818-152966840 ACTGGGAATGAGAAGAAAGAAGG - Intronic
1200169371 X:154061154-154061176 CCAGGGAAAGAGAAGGTCTAGGG + Intronic
1200239240 X:154485265-154485287 CCTTGGTGTGAGAAGGAGGAAGG - Exonic
1201981132 Y:19911450-19911472 GCTGGGAAAGAGAAGGGGTTGGG - Intergenic