ID: 1101409558

View in Genome Browser
Species Human (GRCh38)
Location 12:104457322-104457344
Sequence CGCCGCGCGGACCGGAGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101409558_1101409570 13 Left 1101409558 12:104457322-104457344 CCCGGGCTCCGGTCCGCGCGGCG 0: 1
1: 0
2: 2
3: 16
4: 145
Right 1101409570 12:104457358-104457380 TGCGCCCCGGGCGCGCTTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 101
1101409558_1101409566 1 Left 1101409558 12:104457322-104457344 CCCGGGCTCCGGTCCGCGCGGCG 0: 1
1: 0
2: 2
3: 16
4: 145
Right 1101409566 12:104457346-104457368 GGTCCCTGCTCCTGCGCCCCGGG 0: 1
1: 0
2: 3
3: 35
4: 307
1101409558_1101409574 22 Left 1101409558 12:104457322-104457344 CCCGGGCTCCGGTCCGCGCGGCG 0: 1
1: 0
2: 2
3: 16
4: 145
Right 1101409574 12:104457367-104457389 GGCGCGCTTCCCGGACACCCCGG 0: 1
1: 0
2: 0
3: 3
4: 67
1101409558_1101409565 0 Left 1101409558 12:104457322-104457344 CCCGGGCTCCGGTCCGCGCGGCG 0: 1
1: 0
2: 2
3: 16
4: 145
Right 1101409565 12:104457345-104457367 GGGTCCCTGCTCCTGCGCCCCGG 0: 1
1: 0
2: 2
3: 26
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101409558 Original CRISPR CGCCGCGCGGACCGGAGCCC GGG (reversed) Exonic
900607760 1:3531371-3531393 CGCCGAGCGGAGCGGATCCCGGG - Intronic
901050748 1:6424800-6424822 GGCAGCGCGGAGCGGAGGCCAGG + Exonic
901332762 1:8423721-8423743 GGCCGCGCGGCGCGGGGCCCGGG + Intronic
901703991 1:11059975-11059997 CGCCGCGCGGCCTGCAGTCCCGG - Exonic
902323728 1:15684733-15684755 CGACGAGCGGCCGGGAGCCCCGG + Intronic
907237773 1:53063254-53063276 TGCCGCGCGCACCGGGGCCGGGG - Intronic
912910952 1:113759034-113759056 TGCCCCGCGGGCCGGCGCCCGGG + Exonic
915289021 1:154870428-154870450 CGCCACTGGGGCCGGAGCCCAGG - Intergenic
916694509 1:167221635-167221657 CCCCGCGCGGGGCTGAGCCCGGG + Intronic
918048274 1:180954151-180954173 CGCCGCGCAGACAGGAGGCGTGG + Intergenic
1064712320 10:18140407-18140429 CGCGGCGGGGATCGGAGCCGCGG - Intergenic
1065727290 10:28677997-28678019 CGCGGCGAGGACGGGACCCCGGG - Intronic
1066022921 10:31320100-31320122 CGCTGCCCGGCCCAGAGCCCCGG + Intronic
1066548186 10:36524397-36524419 AGCCCCGAGCACCGGAGCCCGGG + Intergenic
1070179257 10:73998421-73998443 CGCGACGCGGGCCGGGGCCCCGG - Intronic
1070819735 10:79347797-79347819 CACCGCGCCGCCCGGGGCCCAGG - Intronic
1070954377 10:80454610-80454632 CGCCGCGCGGACGAGAGCCGCGG + Intronic
1071579461 10:86756496-86756518 CGCCGCGCGCACCCGACCACGGG - Intergenic
1073503988 10:103967557-103967579 CCCACCGCGGGCCGGAGCCCGGG + Exonic
1074055972 10:109923253-109923275 GGCCGCGCTCGCCGGAGCCCCGG - Intronic
1075037296 10:119080354-119080376 CGTCGCGGGGACCGCAGCCCGGG - Intronic
1076750003 10:132537762-132537784 CGCCCCGCGGAGCCGAGCCCGGG - Intergenic
1076869519 10:133186489-133186511 CGCAGCACGGACAGGGGCCCTGG + Exonic
1077419856 11:2445061-2445083 CGCCGCTCGGGCCGGCCCCCCGG + Exonic
1081851588 11:46278246-46278268 CGCCGCGAGGACGGGTGCCGAGG - Intronic
1083658415 11:64241303-64241325 CGCCGCACGGGGCGGAGTCCTGG + Intronic
1083849059 11:65354889-65354911 CGCCGCCCGGACAGGGGCTCGGG + Exonic
1084485077 11:69443461-69443483 CCCCACGCGGAGCGGAGACCAGG + Intergenic
1084888382 11:72224675-72224697 CTCCGCTCGGCCCGCAGCCCGGG - Intronic
1086728819 11:90222912-90222934 CGAAGCGCTGACCGCAGCCCCGG + Exonic
1088823451 11:113475217-113475239 CGCCGCGCCGTTCAGAGCCCCGG + Exonic
1089527720 11:119107865-119107887 GCCCGCGGGGACCGGGGCCCGGG + Exonic
1090707672 11:129354081-129354103 TGCTGCTCTGACCGGAGCCCTGG + Intergenic
1091226043 11:133956909-133956931 CGCCGAGCCGAGCGGAGCCTAGG - Exonic
1096178686 12:49539157-49539179 GGCCGCGGGGCCTGGAGCCCGGG + Exonic
1096782768 12:54000564-54000586 CGCCGCGCGGACTGCGGCCCAGG + Exonic
1097267672 12:57755352-57755374 CCCCGCAAGCACCGGAGCCCCGG + Exonic
1097981443 12:65741452-65741474 TGCCGCGGCGGCCGGAGCCCGGG + Intergenic
1101409558 12:104457322-104457344 CGCCGCGCGGACCGGAGCCCGGG - Exonic
1101466806 12:104957981-104958003 CGCCGCCGGGTCCCGAGCCCAGG + Intronic
1104841600 12:131828501-131828523 CGCCGCGCAGCCCGGGGACCCGG + Exonic
1104961533 12:132490447-132490469 CGCCGCGCGGGCTCGGGCCCTGG - Exonic
1106602552 13:31200213-31200235 CCCCGCGCCGACCGGGGCACGGG - Intronic
1110450718 13:75635880-75635902 CGCCGCCCTCACCTGAGCCCCGG - Intronic
1112290724 13:98142846-98142868 CGCCGCGCGGAGCCCGGCCCTGG + Intronic
1113517778 13:110915755-110915777 CCCCGCCCGGACCGGCTCCCAGG - Intergenic
1113849159 13:113408068-113408090 GGCCGCGCAGACCGGCCCCCGGG - Intergenic
1115651327 14:35404447-35404469 TGCCGCGCGGCTCGGAGCCCTGG - Exonic
1119379776 14:74221138-74221160 CGCTGCCCAGACCTGAGCCCCGG - Intergenic
1122857425 14:104566519-104566541 GGCCGCGTGGCCAGGAGCCCTGG - Intronic
1123630467 15:22257250-22257272 CGCCGCGGGGTCCGGAGCCCCGG - Intergenic
1124118371 15:26867741-26867763 CGCCGCGCGCCTCAGAGCCCCGG - Intronic
1128374588 15:67065996-67066018 CGCGGCCCGGCCCGGCGCCCCGG + Exonic
1129273966 15:74433506-74433528 AGCGGCGGGGGCCGGAGCCCCGG - Intronic
1131466024 15:92655504-92655526 CACCGCCCGGCCCGGGGCCCGGG - Exonic
1132055514 15:98648377-98648399 AGACGTGCGGAGCGGAGCCCGGG - Intergenic
1132683749 16:1153835-1153857 CGCCTCGCGTCCCGGCGCCCCGG - Exonic
1136993287 16:35170254-35170276 CGCCGCGGGGCCCGGGACCCCGG + Intergenic
1137559223 16:49492411-49492433 CTCGCCGCGGACCCGAGCCCAGG - Intronic
1138179234 16:54931050-54931072 GGCGCCGCGGGCCGGAGCCCCGG + Exonic
1139878269 16:70163748-70163770 CGCAGCGCAGGCCGGAGCCCTGG - Intergenic
1141184791 16:81779475-81779497 CCCCGCGGGGACCGGCTCCCAGG + Intronic
1141477589 16:84284150-84284172 GGCCACGCTGACCAGAGCCCAGG + Intergenic
1141972623 16:87493397-87493419 CGCCGCGGGGTCCGGAGCCCCGG + Intergenic
1142316769 16:89352299-89352321 CGCCACGCGGTGCAGAGCCCTGG + Intronic
1142586930 17:979714-979736 CGCCGCGCGGACCGTGGAGCGGG - Exonic
1142704234 17:1684430-1684452 CGGCGCGCGGGCCGGAGGCGGGG - Intronic
1143059201 17:4185847-4185869 CCCCGCCCGGACCTAAGCCCCGG + Intronic
1143140648 17:4740101-4740123 CGCCACGCAGATCCGAGCCCAGG + Intronic
1143586891 17:7854924-7854946 CGAGGAGCGGACCAGAGCCCTGG - Intergenic
1143904450 17:10198156-10198178 CGCACCGAGGACCGCAGCCCCGG + Intronic
1146058697 17:29593540-29593562 CGCCCCGCGGCCCCGGGCCCCGG + Exonic
1146371098 17:32266021-32266043 CGGCGCGGGGACCGGGGCCATGG + Intergenic
1146664194 17:34685933-34685955 CGCAGCTGGGGCCGGAGCCCCGG - Intergenic
1147924450 17:43938161-43938183 TGCCGCGCTGACCACAGCCCCGG + Intergenic
1148323618 17:46771452-46771474 CCCAGCGCGGCCCGGGGCCCGGG - Intronic
1148615110 17:48996018-48996040 CGCCGCGCGTTTCGGAGTCCCGG - Intergenic
1151470540 17:74315050-74315072 CACAGCGGGGACGGGAGCCCAGG + Intergenic
1151559157 17:74861535-74861557 CTCCGCGGGCGCCGGAGCCCGGG + Intergenic
1151783947 17:76265997-76266019 CGCCGCGCTGACAGCGGCCCCGG - Intronic
1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG + Intergenic
1152552025 17:81034835-81034857 CGCGGCGCGGGCTGGGGCCCTGG - Intergenic
1152617809 17:81345965-81345987 CGCCGTCCGGGCAGGAGCCCCGG + Intergenic
1154303850 18:13217358-13217380 CGCCACGCGGGCCCGAGCCCTGG + Intergenic
1155519748 18:26656628-26656650 GGCCGAGCGGACTGGGGCCCGGG - Intronic
1157354131 18:46917592-46917614 CGCCGCGCGGACTGAAGGCGCGG - Intronic
1159947864 18:74457328-74457350 CGCCGAGCGGGCCTGAGCCGCGG - Intronic
1160613839 18:80109347-80109369 CGCCGCGCGGGGCGGAGGCGCGG + Exonic
1160765357 19:805235-805257 GGCCGCTCAGTCCGGAGCCCCGG + Intronic
1160788271 19:911988-912010 CGACCCGCGGACAGGGGCCCAGG + Intronic
1160891887 19:1383456-1383478 CGCAGCGCGGGACGGAGTCCCGG - Intergenic
1160987931 19:1848229-1848251 CACCGGGCGCGCCGGAGCCCCGG + Exonic
1161307796 19:3577341-3577363 CGGGGCGCGGAGCGGAGCTCGGG - Intronic
1161733801 19:5978216-5978238 TGCCGCGCGGAGGCGAGCCCCGG + Intergenic
1163551274 19:17967437-17967459 CTCCGTGCGGTCCGGAGCCTAGG + Intronic
1164639070 19:29811810-29811832 CGCCTCGCGGGCCGGCGCCGTGG + Intergenic
1165420096 19:35718182-35718204 GGCCGGGCGGAGCCGAGCCCGGG + Exonic
1166873858 19:45885771-45885793 CGGCGCGCGGACTGGGGCCATGG - Exonic
1167258194 19:48443300-48443322 CGCTGGGCGGCCTGGAGCCCTGG + Exonic
1168721778 19:58558408-58558430 CGCCGCGGGGCCCGGGACCCCGG + Exonic
929033809 2:37672180-37672202 CTCCGCGCCCACCGGAGCCCGGG - Exonic
929541605 2:42827575-42827597 CGAAGCGCTGACCGCAGCCCCGG + Intergenic
930585199 2:53259849-53259871 CGAGGCGCGGGCAGGAGCCCAGG - Intergenic
934933217 2:98445121-98445143 CGCCGCGGGGGCCGGGGCCGGGG + Intronic
934993555 2:98937298-98937320 CGCCGCGCACACTGGAGGCCTGG + Intergenic
940316875 2:152335753-152335775 CGCCGCCCGGCCCGGGGCCCCGG - Intronic
940830195 2:158457479-158457501 CGCTGCGCGTACGGGAGACCGGG - Intronic
943037717 2:182767192-182767214 CGCAGAGCGTACCGGTGCCCAGG + Intronic
945033533 2:205685713-205685735 TGCCGCGCAGAGCGGAGCGCAGG - Intronic
946339298 2:219057889-219057911 CGCCGTGCGGTCCAGATCCCCGG - Intronic
946373542 2:219294891-219294913 CGCCGCTCGGCCTGGAGCCCCGG - Intronic
947229559 2:227871517-227871539 CCCCCCGCGCGCCGGAGCCCCGG + Intronic
948140530 2:235669674-235669696 GTCCGCGCGTCCCGGAGCCCAGG + Intronic
1168753096 20:297646-297668 CCCCGCGCGGCCCGCGGCCCGGG + Exonic
1168795903 20:610076-610098 CGCGGCGCGGCCCGGGCCCCGGG - Exonic
1168814566 20:728091-728113 CGCCGCGTGGGCCGGGGTCCGGG + Intergenic
1169093172 20:2873633-2873655 CGCCGCGGGGCTCGGAGCCGCGG + Intronic
1180014726 21:45074651-45074673 CCTCGCGCGGCCCGGAGCCCCGG - Intronic
1180091955 21:45537880-45537902 TGCCGCCAGGACCGGAGCTCGGG + Exonic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1181283376 22:21735658-21735680 GCCCGCGCTGACCGGGGCCCGGG - Exonic
1183370216 22:37427788-37427810 GGCCCCACGGACCCGAGCCCCGG + Intergenic
1183601559 22:38843330-38843352 CGCGGCGGGGCCCGGCGCCCTGG + Exonic
949260501 3:2098843-2098865 CGCCGCGCCAGACGGAGCCCGGG + Intronic
950487711 3:13282765-13282787 CGCCGCCCCGACCCGGGCCCCGG - Intergenic
953748699 3:45594042-45594064 CGGCGCGCGGGCGGGCGCCCAGG - Intronic
954632918 3:52056616-52056638 GGCCGCGGGGGCCGGCGCCCGGG + Intergenic
959073398 3:101724948-101724970 CTTCGCGCGGCCCGGCGCCCTGG + Intronic
961827446 3:129606498-129606520 GGCGGCGCGGGCCGGCGCCCTGG - Exonic
967098073 3:186193786-186193808 GGCCGCGCGGGCCGGAGCAGGGG - Intronic
968514820 4:1011654-1011676 CGCCTCGCGGCGCGGCGCCCCGG + Intronic
968701513 4:2060065-2060087 CCCCGAGCGGGCCGGAGCCGGGG + Intronic
968921886 4:3526613-3526635 CGCGGCGCGGACCTGAGGGCTGG - Intronic
972979533 4:44678704-44678726 GTCGGCGCGGACCGGGGCCCCGG - Exonic
977848104 4:101790673-101790695 CGCCCAGCAGAGCGGAGCCCTGG + Exonic
981128499 4:141132955-141132977 CGCCGCGGGGACCGGATTCCGGG + Intronic
985660700 5:1155503-1155525 CGCCGCGCGCTCCGGGGACCTGG - Intergenic
989230120 5:39075054-39075076 CACCGCGGGGACCGCCGCCCTGG - Intergenic
992663546 5:78984710-78984732 CGCCCCGCGGACCCGCGCCCCGG - Intronic
997253660 5:132410783-132410805 CCACGCGCAGACCCGAGCCCGGG + Intronic
1008573781 6:52839542-52839564 CGCCGTGTGGACCTGAGCCTCGG - Intronic
1008576898 6:52869335-52869357 CGCCGCGTGGACCTGAACCTCGG - Intronic
1009808765 6:68635218-68635240 CGCCGCGCGGACGCGCTCCCGGG + Intergenic
1019474258 7:1236468-1236490 CGCGGCGCGCACGGCAGCCCGGG - Exonic
1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG + Intronic
1029552377 7:101244337-101244359 CGCCGCGGGGAGGGGAGACCGGG - Intronic
1031919129 7:127588583-127588605 CGCGGCCCGGACCGGGGCGCCGG + Intronic
1035573172 8:687677-687699 CGCAGCGCTGACCGGACCCAGGG + Intronic
1036260781 8:7238456-7238478 CCCCGCGGGGACCGAACCCCTGG - Intergenic
1036312817 8:7697000-7697022 CCCCGCGGGGACCGAACCCCTGG - Intergenic
1037788963 8:21919923-21919945 CGCCGCCCGTCCCGGAGCCCCGG + Intronic
1039921502 8:41896905-41896927 CGCCGCGCCGGCCGGGCCCCCGG - Intergenic
1049220752 8:141427746-141427768 CGCCACAAGGACTGGAGCCCTGG - Exonic
1049623380 8:143609336-143609358 CGCCCAGCGGAGCGGAGACCCGG + Intronic
1053230170 9:36401145-36401167 CGGCGCGCGGTGCGGAGCCTGGG - Intronic
1054775636 9:69121635-69121657 CGCCGCGCCGCCCAGCGCCCCGG + Intronic
1057478708 9:95426991-95427013 CTCGCCGCGGACCGGAGCCGGGG - Intergenic
1059541257 9:115132754-115132776 CGGCTAGCAGACCGGAGCCCGGG + Intergenic
1062332668 9:136051443-136051465 CGCCGGGCTGCCCGGACCCCGGG + Intronic
1062551161 9:137087229-137087251 CGCCGGGCTGACTGGGGCCCGGG + Intronic
1062558693 9:137129481-137129503 CGCCGGGCGGACCGAGGCCCGGG - Intergenic
1192425147 X:71068454-71068476 CGCCGCACGGGCCTGGGCCCCGG + Intronic
1194977410 X:100408936-100408958 CGCCGCCCGACCCGCAGCCCTGG - Exonic
1200277783 X:154750893-154750915 CGCCCCGCGGGCGGGTGCCCCGG + Intronic