ID: 1101409630

View in Genome Browser
Species Human (GRCh38)
Location 12:104457667-104457689
Sequence CTGGCTGCCCAGATCTACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 212}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101409614_1101409630 28 Left 1101409614 12:104457616-104457638 CCCTACCTCTCCGCCTTCGGCCT 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1101409630 12:104457667-104457689 CTGGCTGCCCAGATCTACCCGGG 0: 1
1: 0
2: 3
3: 12
4: 212
1101409625_1101409630 -5 Left 1101409625 12:104457649-104457671 CCTGGCTGCCCAGAGCTCCTGGC 0: 1
1: 0
2: 7
3: 77
4: 673
Right 1101409630 12:104457667-104457689 CTGGCTGCCCAGATCTACCCGGG 0: 1
1: 0
2: 3
3: 12
4: 212
1101409621_1101409630 15 Left 1101409621 12:104457629-104457651 CCTTCGGCCTCTTCGGGGCTCCT 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1101409630 12:104457667-104457689 CTGGCTGCCCAGATCTACCCGGG 0: 1
1: 0
2: 3
3: 12
4: 212
1101409623_1101409630 8 Left 1101409623 12:104457636-104457658 CCTCTTCGGGGCTCCTGGCTGCC 0: 1
1: 0
2: 4
3: 31
4: 292
Right 1101409630 12:104457667-104457689 CTGGCTGCCCAGATCTACCCGGG 0: 1
1: 0
2: 3
3: 12
4: 212
1101409615_1101409630 27 Left 1101409615 12:104457617-104457639 CCTACCTCTCCGCCTTCGGCCTC 0: 1
1: 0
2: 0
3: 23
4: 279
Right 1101409630 12:104457667-104457689 CTGGCTGCCCAGATCTACCCGGG 0: 1
1: 0
2: 3
3: 12
4: 212
1101409620_1101409630 18 Left 1101409620 12:104457626-104457648 CCGCCTTCGGCCTCTTCGGGGCT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1101409630 12:104457667-104457689 CTGGCTGCCCAGATCTACCCGGG 0: 1
1: 0
2: 3
3: 12
4: 212
1101409616_1101409630 23 Left 1101409616 12:104457621-104457643 CCTCTCCGCCTTCGGCCTCTTCG 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1101409630 12:104457667-104457689 CTGGCTGCCCAGATCTACCCGGG 0: 1
1: 0
2: 3
3: 12
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101409630 Original CRISPR CTGGCTGCCCAGATCTACCC GGG Intronic
900313905 1:2047826-2047848 CTGGCAGCACAGATCTCCCCAGG + Intergenic
900928827 1:5722984-5723006 CTGGCTGCCCAGCTCTGAGCTGG - Intergenic
901414219 1:9105740-9105762 CAGGCTGCCCAGGTCTTCCCAGG + Intronic
901532217 1:9860751-9860773 CTTGCTGGCCAGAACTTCCCAGG + Intronic
903023446 1:20410572-20410594 CTGGCTGCCCAATTCTCCCTTGG - Intergenic
903181456 1:21607023-21607045 CCGGCTGCCCAGGCCTGCCCAGG - Intronic
904329189 1:29746759-29746781 GGGGCTGCCGAGATCTGCCCAGG - Intergenic
907408065 1:54265851-54265873 CTGTCTGCCCAGTGCTGCCCTGG - Intronic
908883353 1:68758780-68758802 CTGGCTGCCTAGATATAAACTGG + Intergenic
912756189 1:112326466-112326488 CTGGATGCACAGTTCTGCCCTGG + Intergenic
915324795 1:155075849-155075871 CTGGCTGCCAAGATCTCTCCCGG - Intergenic
917518077 1:175724762-175724784 CTGGCTCCCCAGACCAAGCCAGG - Intronic
917698576 1:177555947-177555969 TTTGCTGCCCAGAGCTACCTTGG - Intergenic
919081650 1:192874342-192874364 CTGGCTACTCAGAGCCACCCTGG + Intergenic
919670215 1:200331346-200331368 CTAGGTGCCCACATCAACCCCGG + Intergenic
919924523 1:202185538-202185560 CTGGCTGACCGACTCTACCCCGG + Intergenic
920915247 1:210253343-210253365 CTGCCTGCCCAGCTTTACTCTGG + Intergenic
1064002209 10:11673121-11673143 CTGGCTGCCCAGATGTCTCGGGG - Intergenic
1064122967 10:12635225-12635247 GTGGCTGCCCAGGTCTGACCCGG + Intronic
1069995796 10:72341343-72341365 CAGGCTGCCCAGATCCACTGAGG - Intronic
1070250475 10:74768651-74768673 CTGGGTGCCCAGGTGTGCCCTGG - Intergenic
1070779683 10:79130274-79130296 AAGGCTGCCCAGAGCTGCCCAGG + Intronic
1070960007 10:80492027-80492049 CTGGGTGCCCAGAGCCAGCCCGG - Intronic
1071722299 10:88159419-88159441 CTGGATTCCCAGACCTCCCCTGG + Intergenic
1073247975 10:102105231-102105253 CAGGCTGGCCAGATCTACAAAGG + Intergenic
1075397607 10:122139238-122139260 CTGGCTGGTCAGCTCTTCCCTGG - Intronic
1075760157 10:124849469-124849491 CTGCCTGCTCAGAGGTACCCAGG + Intergenic
1076081007 10:127580603-127580625 CTGGCATCCCAGGTCTTCCCCGG + Intergenic
1076895740 10:133310497-133310519 CTGGCTGCCCAGCTCTGTGCCGG + Intronic
1077220297 11:1412774-1412796 CTGGCTGCACAGATCAACCCAGG + Intronic
1077231329 11:1459341-1459363 CTGGGTGCCTACATCTACACAGG - Intronic
1077479828 11:2808317-2808339 CTGGCATCACAGAGCTACCCCGG + Intronic
1078526424 11:12104915-12104937 CTGCCTCCCCAGATCTATCTGGG - Intronic
1078857895 11:15221347-15221369 CTGGCTTCCCAGAACAGCCCAGG - Intronic
1082760110 11:57119148-57119170 TTGGCTGCTCAGATCCAGCCTGG - Intergenic
1084147590 11:67273324-67273346 GTGGCTCCCAAGATCTACTCTGG - Intronic
1084344856 11:68539997-68540019 CTGGCTGCCCAGATGTTCTTGGG - Intronic
1084692503 11:70735246-70735268 CTGGTTGCCCAGCTCCACCTGGG - Intronic
1085708214 11:78805658-78805680 CTGGCTTCCCAACTCCACCCAGG + Intronic
1089528668 11:119112890-119112912 CTGGGAGCCCAGCTCTAGCCAGG + Intronic
1090859552 11:130640670-130640692 CTTACTGCCCAGCTCTAGCCAGG - Intergenic
1091175288 11:133552443-133552465 CTGGCTGTCCAGAGCTCCCTGGG + Intergenic
1091602627 12:1927342-1927364 CTGTCTGCCAAGATGTACCCTGG + Intergenic
1092810266 12:12266460-12266482 CTGGCTTCCCAGACCTTCCCCGG - Intronic
1097379212 12:58875156-58875178 CTGGTGGCCCAGAGCTACTCTGG + Intronic
1098752690 12:74315718-74315740 CTGGCTGCCCAGAACTAGAAGGG + Intergenic
1101212804 12:102551489-102551511 CTGGCTGCCTAGAGCTTTCCAGG + Intergenic
1101322362 12:103683958-103683980 CTAGATTCCCAGAGCTACCCTGG - Intronic
1101409630 12:104457667-104457689 CTGGCTGCCCAGATCTACCCGGG + Intronic
1102504002 12:113372479-113372501 CTCCCTGCCCAGCTCTGCCCCGG - Intronic
1103916954 12:124380657-124380679 CTGGGTGCCCTGAGCTGCCCGGG + Intronic
1108041674 13:46345207-46345229 CTGGGTGCCCAGTTCTGCTCAGG - Intronic
1108503310 13:51087281-51087303 GTGGCTGCCCAGACCCAGCCTGG - Intergenic
1108726113 13:53183314-53183336 CTTGCTTCCCAGATTTACCAAGG + Intergenic
1108764094 13:53605490-53605512 CTGCCTGCCCAGATCAACAAGGG - Intergenic
1113523118 13:110954432-110954454 CTGCCTGCCCCAATCTGCCCTGG - Intergenic
1113808299 13:113122645-113122667 CTGGCCGCCCAGCTCTGCCTGGG + Intergenic
1113878239 13:113607907-113607929 ATGGCTGCCGAGGTCTCCCCTGG + Intronic
1114640025 14:24213381-24213403 CTGGCTGGCCAGTCCCACCCTGG + Intronic
1114844712 14:26307630-26307652 CTGGCTGCCCAGATCTCCCTTGG + Intergenic
1115777502 14:36731837-36731859 CTGGCTGCCCTGCTCTCCCCTGG + Intronic
1119559609 14:75579466-75579488 CAGGCTGCCCAGCTTCACCCAGG - Exonic
1119713878 14:76844513-76844535 CAGGTTGCCCAGATCTCCCAGGG - Intronic
1121403470 14:93703225-93703247 CTGGCTTCCCAGGACTACCAAGG + Intronic
1121710726 14:96037893-96037915 CAGCCTGCCCAGAACTGCCCAGG - Intergenic
1121731365 14:96189402-96189424 CGGGCTGCCCAGAGCCTCCCAGG - Intergenic
1122215105 14:100198252-100198274 CTCACTGCCCAGCTCTACGCAGG + Intergenic
1122275382 14:100588127-100588149 CAGGCTGGCCAGTCCTACCCTGG + Intergenic
1122280342 14:100618522-100618544 CTGGCTGCCCAGAGCTTTCTGGG + Intergenic
1123162579 14:106293650-106293672 GTTGCTGCCCACATCAACCCTGG + Intergenic
1202858268 14_GL000225v1_random:64553-64575 CTCGCTGGCCAGCTCTTCCCTGG + Intergenic
1123470655 15:20549839-20549861 CCCCCTGCACAGATCTACCCGGG + Intergenic
1123647405 15:22450864-22450886 CCCCCTGCACAGATCTACCCGGG - Intergenic
1123730956 15:23144816-23144838 CCCCCTGCACAGATCTACCCGGG + Intergenic
1123749095 15:23342242-23342264 CCCCCTGCACAGATCTACCCGGG + Intergenic
1124281468 15:28366124-28366146 CCCCCTGCACAGATCTACCCGGG + Intergenic
1124301236 15:28545495-28545517 CCCCCTGCACAGATCTACCCGGG - Intergenic
1124341115 15:28889571-28889593 CTTACTGCCCAGATCTGCCCTGG + Intronic
1124966006 15:34434124-34434146 CTCATTGCCCAGATCTGCCCTGG - Intronic
1124982626 15:34580223-34580245 CTCATTGCCCAGATCTGCCCTGG - Intronic
1125527915 15:40389985-40390007 CATGCTGCCAAGATCAACCCCGG - Intronic
1126087506 15:45023465-45023487 CTGGCTGCCCAGATCCCAGCTGG + Intronic
1127966225 15:63924743-63924765 CTGGCTGCCCAGGCCAACCCTGG + Intronic
1128533383 15:68470591-68470613 CTGGCTGACCAGAAAAACCCAGG - Intergenic
1129220331 15:74128563-74128585 CTATCTGCCCAGAGCTTCCCTGG - Exonic
1129880869 15:79005296-79005318 CTGGCTCCCCAGGGCTCCCCAGG - Intronic
1130971762 15:88739354-88739376 CTGTCTGCCCAGATGGACCGAGG - Intergenic
1135924011 16:26676350-26676372 CCTGCTGCCCCGATCTACCTTGG - Intergenic
1136113294 16:28078584-28078606 CTGGCTGTTCAGCTCTGCCCTGG - Intergenic
1136274371 16:29169793-29169815 CTGTTGGCCCAGATCGACCCTGG - Intergenic
1136683596 16:31981718-31981740 GAGGCTGCCCAGGTCTAGCCGGG + Intergenic
1136784227 16:32925278-32925300 GAGGCTGCCCAGGTCTAGCCGGG + Intergenic
1136885557 16:33928528-33928550 GAGGCTGCCCAGGTCTAGCCGGG - Intergenic
1137664954 16:50244737-50244759 CCAGCTGCTCAGATCTTCCCGGG + Intergenic
1138035462 16:53601162-53601184 CTGGTTACCCAGATACACCCTGG + Exonic
1138229441 16:55326525-55326547 GCAGCTGCCCAGAGCTACCCTGG + Exonic
1138901382 16:61274929-61274951 CTTGCAACCCAGATCTGCCCTGG - Intergenic
1139163063 16:64534725-64534747 CTGGCAGCACAGTTCTTCCCAGG - Intergenic
1139923294 16:70472722-70472744 CCGGCTGCCCAAAACCACCCAGG - Intronic
1139949462 16:70662097-70662119 CTTGGTGCCCGGACCTACCCAGG + Exonic
1141484049 16:84326984-84327006 CTGGCTGCCCACATTTACCCTGG - Intronic
1141875874 16:86824102-86824124 TTGGCTGCCCAGATGCACACAGG + Intergenic
1142078652 16:88135439-88135461 CTGTTGGCCCAGATCGACCCTGG - Intergenic
1142176549 16:88647984-88648006 GTGGCTCCCCAGCTCTGCCCTGG + Intronic
1142201225 16:88762011-88762033 ATGGCTGCCCAGATAAGCCCTGG - Intronic
1203086882 16_KI270728v1_random:1189284-1189306 GAGGCTGCCCAGGTCTAGCCGGG + Intergenic
1145078447 17:19874569-19874591 CATGCTGCCCAGACCTTCCCTGG - Intergenic
1147144514 17:38477425-38477447 GAGGCTGCCCAGGTCTAGCCGGG + Intronic
1147581684 17:41630768-41630790 CTGGCTCCCCAGAAGTTCCCAGG - Intergenic
1147581701 17:41630834-41630856 CTGGCTCCCCAGAAATTCCCAGG - Intergenic
1147581718 17:41630900-41630922 CTGGCTCCCCAGAAATTCCCAGG - Intergenic
1147581735 17:41630966-41630988 CTGGCTCCCCAGAAATTCCCAGG - Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1147973035 17:44230062-44230084 CTGCCTGCTCAGCTCTATCCTGG - Intergenic
1148075131 17:44931350-44931372 CTGGCTGCCTGGATGTACTCTGG + Intronic
1150436057 17:65155142-65155164 TTGGGTGCCCAGAGCTACGCTGG - Intronic
1151349792 17:73525031-73525053 CTGGCTGCCCAGGGCCACACAGG - Intronic
1151473607 17:74332710-74332732 CTGTCCGGCCAGATCTCCCCTGG - Intronic
1152417500 17:80172018-80172040 CTGGCTGTCCAGAACTCCCAGGG + Intronic
1153748619 18:8206952-8206974 CTGGTGGCCCAGATGTTCCCTGG - Intronic
1155872308 18:31043050-31043072 CTGGCAGCCCAGATCGTCCCAGG + Intergenic
1156498564 18:37542358-37542380 CTGGCTGCTCTGATCTTCCATGG + Intronic
1159961174 18:74556805-74556827 CTGGCTCCCCAGCTCTGCCCAGG - Intronic
1160418533 18:78728338-78728360 CTGTCTGCTCAGACTTACCCCGG - Intergenic
1160979421 19:1810094-1810116 CTGGCGGCCCAGATCTTTCTGGG + Intronic
1161290320 19:3490595-3490617 CTGGCTGGGCAGATCTGACCAGG + Intergenic
1161358377 19:3832255-3832277 CTGGCTGCTCAGATGGGCCCTGG - Intronic
1161645547 19:5451277-5451299 CTGGGTGCCCACATCTGCGCTGG - Intergenic
1161657678 19:5525904-5525926 CTGAGTGCCCATATCTACACTGG + Intergenic
1162704830 19:12547675-12547697 ATGCCTGCCAAGTTCTACCCAGG + Intronic
1165342747 19:35224452-35224474 TAGGCTCCCCAGATCTGCCCTGG - Intergenic
1165934983 19:39383733-39383755 CTGGCTGCCCCCAACTCCCCGGG - Exonic
1166431219 19:42729617-42729639 GTGCCTACCCAGATCTTCCCAGG + Intronic
1167579502 19:50333254-50333276 CTTGCTGCCCAGAGCTGCCGGGG - Intronic
1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG + Exonic
925027385 2:620768-620790 CAGGCTGCCCGGATCCACGCGGG + Intergenic
925517079 2:4694799-4694821 CTGCCTGCCCAGGACTACCAAGG + Intergenic
926225788 2:10966099-10966121 TAGGCTGCCCAGAGCTACCACGG + Intergenic
929458098 2:42080424-42080446 CTTGCTGCGCTGCTCTACCCAGG + Intergenic
931371902 2:61671167-61671189 CTCTCTCCCCAGATCTTCCCTGG + Intergenic
933986140 2:87593902-87593924 CAGGCAGCCCAGAGCTGCCCAGG + Intergenic
934884014 2:98008582-98008604 TTGGCTCCCCAGCTCTTCCCAGG + Intergenic
934925659 2:98380309-98380331 CTGGCTGCCCACATTTGCCTGGG - Exonic
936307696 2:111356901-111356923 CAGGCAGCCCAGAGCTGCCCAGG - Intergenic
936959394 2:118057469-118057491 CTGGCTGACCACATCTGACCGGG + Intergenic
938382926 2:130846711-130846733 CTGGCTGTCCAGCTCTGGCCTGG - Intronic
941801525 2:169665014-169665036 GTGCCTGCCCAGCTCTTCCCAGG - Intronic
941895040 2:170620677-170620699 CTGTGTGCACAGATCTACCCGGG - Intronic
941934284 2:170971155-170971177 CTGTTTGCCCAGCTCTGCCCAGG + Intergenic
946130724 2:217604604-217604626 CGGGCTGTCCAGATCTCCACTGG - Intronic
948919206 2:241053419-241053441 CTGGATGCCCAGCTCTGACCTGG + Intronic
1175105237 20:56610327-56610349 CTGGCCACCCAGGTCTGCCCAGG - Intergenic
1179828303 21:43980682-43980704 CTGCCTGCCCAGCACTGCCCCGG - Intronic
1179933005 21:44583363-44583385 CTGGCTGCCCAGCACAACTCTGG + Intronic
1181766743 22:25097866-25097888 CTGGATGCATAGATCCACCCAGG + Intronic
1183178190 22:36239543-36239565 CCGGCCTCCCAGATATACCCTGG + Exonic
1183742084 22:39674392-39674414 CTGCCTTCCCTGATCTCCCCAGG - Intronic
1184155635 22:42664991-42665013 CTGGCTGCCGCCCTCTACCCAGG + Intergenic
1184437810 22:44490245-44490267 CTGGCTGCCCAGACCTGCAGCGG + Intergenic
1184646644 22:45898877-45898899 CTGGCTCCCCAGAGCCATCCTGG - Intergenic
1185394397 22:50579321-50579343 CAGGCTGCCCACAGCCACCCGGG + Intronic
950264578 3:11564571-11564593 CTTCCTGCCCAGACCTGCCCGGG - Intronic
951036456 3:17938317-17938339 CTGCCTGCCCTGCTCTACCAAGG + Intronic
951691058 3:25396899-25396921 CTGGTTGCCTAGATATACACTGG - Intronic
954573932 3:51664407-51664429 CTGGGGGCTCAGTTCTACCCTGG - Exonic
955315302 3:57933610-57933632 CTGGTTGCCCAGATATTCTCTGG - Intergenic
955910183 3:63851993-63852015 TTTGCTGCCCAGAGCTACCTTGG + Intronic
961370275 3:126424425-126424447 GTGGCTGCCCAGCTCTCACCTGG + Intronic
963452602 3:145503272-145503294 CTTGCTTCCCATATCTGCCCTGG - Intergenic
963530534 3:146469305-146469327 CAGGCGGCCCAGCTGTACCCTGG - Intronic
966393484 3:179476977-179476999 CTTGCTGCCCAGAGCCACCTTGG - Intergenic
968764596 4:2461691-2461713 CTGACTGTCCAGGTCGACCCTGG - Intronic
968900457 4:3429088-3429110 CTGGGTGCCCAGCTCTGCCTAGG - Intronic
969921677 4:10545951-10545973 CTCACTGCCCACAGCTACCCTGG - Intronic
972907213 4:43765745-43765767 CTGGCAGATCAGATCAACCCAGG - Intergenic
975320567 4:73005680-73005702 CTGGCTGCCCCCATTTAACCTGG - Intergenic
980000697 4:127484391-127484413 CTGACTTCCCAGAAATACCCTGG + Intergenic
986335340 5:6750881-6750903 CAGGCAGCCCAAACCTACCCAGG - Intronic
986580891 5:9264699-9264721 CTGGTTGCCAGGATCTACCAAGG - Intronic
987095091 5:14542561-14542583 CTGGCAGAGCAGAACTACCCAGG - Intergenic
989099960 5:37814086-37814108 CTGGCTGCCCAGTGCAGCCCGGG - Intronic
992166919 5:74061764-74061786 GTGGCTGCCCTGATATAACCAGG - Intergenic
992769609 5:80035236-80035258 CCAGCTGCCCAGCTCTTCCCAGG + Intronic
996640299 5:125743738-125743760 CTTGCTGCCCAGATCTCTCATGG + Intergenic
997427935 5:133816986-133817008 CTTGCTGCCCACAGATACCCAGG + Intergenic
997845827 5:137284913-137284935 CCCGCTGCCCATCTCTACCCAGG - Intronic
1002053438 5:176584842-176584864 TAGGCTGCCCACATCGACCCCGG - Exonic
1005080226 6:21949619-21949641 CTGTCTGCCCAGGTTTTCCCAGG - Intergenic
1005841215 6:29745668-29745690 CTGACTGCACAGATCCATCCTGG + Intergenic
1005870691 6:29972404-29972426 CTGACTGCACAGATCCATCCCGG + Intergenic
1006072095 6:31505654-31505676 CTGACTGCACAGATCCATCCTGG - Exonic
1010365137 6:75041655-75041677 CTGGCTGGGCTGATCTTCCCAGG + Intergenic
1012028344 6:94027054-94027076 GTGGCTGCCCAGGCCTATCCAGG + Intergenic
1012290083 6:97443630-97443652 CTGGCTCCCCAGATGTAGCATGG + Intergenic
1013424885 6:110002212-110002234 CTCACTGCCCAGAGCTGCCCTGG + Intergenic
1017706241 6:157125543-157125565 CTGTCTGGCCAGATTTGCCCGGG + Intronic
1018429192 6:163710027-163710049 TGGGCTGCCCAGATCCAGCCAGG - Intergenic
1018711592 6:166501391-166501413 CTGGCTCTCCAGACCCACCCAGG + Intronic
1019947850 7:4344270-4344292 CTGGCGTCCCAGAACAACCCTGG - Intergenic
1020139577 7:5605214-5605236 CTGGCTCCCCACCCCTACCCTGG - Intronic
1022509825 7:30927979-30928001 CTGGCTGACCTGATCTTCCTAGG - Intergenic
1023856474 7:44187230-44187252 CTGGCTGTCCAGGCCCACCCAGG - Intronic
1026848763 7:73712071-73712093 CTGCGTGCCCCCATCTACCCTGG - Intronic
1026868856 7:73838779-73838801 ATGCCTGCCCAGACCTGCCCAGG + Intronic
1026877179 7:73886508-73886530 CGGGCTGCCCAGACTTCCCCAGG - Intergenic
1029253880 7:99255798-99255820 ACAGCTGCCCAGATCTTCCCTGG + Intergenic
1032474671 7:132203800-132203822 CTGGCTGCCCAGGGAAACCCTGG + Intronic
1034278104 7:149832914-149832936 CTCCCTGCCCAGACCCACCCTGG - Intergenic
1038146134 8:24897926-24897948 CTGTATATCCAGATCTACCCAGG + Intergenic
1040545169 8:48393333-48393355 TTGGCTGCCCAGAGATTCCCAGG - Intergenic
1047697714 8:127419392-127419414 TTGTCTCCCCACATCTACCCAGG + Exonic
1049305282 8:141899552-141899574 GTGGCTGTCCAGACCTGCCCAGG - Intergenic
1049352576 8:142171997-142172019 AGGCCTGCCCAGATCTGCCCCGG + Intergenic
1052995382 9:34549306-34549328 CTGGCTCCCCAGAACCACCATGG + Intergenic
1056036667 9:82613690-82613712 CTGGCTGCCCACATCTGACAAGG + Intergenic
1056857162 9:90141530-90141552 CTGGCTGCCCCAGTCTGCCCAGG - Intergenic
1056886816 9:90450764-90450786 CTGTCTCCCCAGAACTTCCCTGG - Intergenic
1057075165 9:92134760-92134782 CTGGCTGACCGACTCTACCCCGG + Intergenic
1058808069 9:108612038-108612060 CTGGCTGCCCAGGTCGGCACTGG - Intergenic
1059653048 9:116333411-116333433 CAGGCTGCCCAGAGCTCTCCAGG - Intronic
1060826032 9:126688599-126688621 CTGGCTGTCCAGCTCTCCCGAGG - Intronic
1061950404 9:133932860-133932882 CCTGCTGCCCAGGTCTCCCCAGG + Intronic
1062334739 9:136060053-136060075 CCGGCTGCCCGCATCTGCCCTGG + Intronic
1187762479 X:22603163-22603185 CTGGCTGCCGAGATTCACACTGG + Intergenic
1189848039 X:45154188-45154210 CTGGCTTGGCAGATCTTCCCTGG - Exonic
1199792975 X:151172224-151172246 CTGGCTGTCCAGCTCCACCTGGG + Intergenic
1199827832 X:151516920-151516942 CTGTCTGCCGACATCTACCAAGG - Intergenic
1200246530 X:154529496-154529518 CTGTGAGCCCAGATCCACCCTGG - Intergenic