ID: 1101409633

View in Genome Browser
Species Human (GRCh38)
Location 12:104457679-104457701
Sequence ATCTACCCGGGTCACCGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 12}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101409623_1101409633 20 Left 1101409623 12:104457636-104457658 CCTCTTCGGGGCTCCTGGCTGCC 0: 1
1: 0
2: 4
3: 31
4: 292
Right 1101409633 12:104457679-104457701 ATCTACCCGGGTCACCGCGTCGG 0: 1
1: 0
2: 0
3: 0
4: 12
1101409628_1101409633 -10 Left 1101409628 12:104457666-104457688 CCTGGCTGCCCAGATCTACCCGG 0: 1
1: 0
2: 0
3: 15
4: 132
Right 1101409633 12:104457679-104457701 ATCTACCCGGGTCACCGCGTCGG 0: 1
1: 0
2: 0
3: 0
4: 12
1101409620_1101409633 30 Left 1101409620 12:104457626-104457648 CCGCCTTCGGCCTCTTCGGGGCT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1101409633 12:104457679-104457701 ATCTACCCGGGTCACCGCGTCGG 0: 1
1: 0
2: 0
3: 0
4: 12
1101409627_1101409633 -2 Left 1101409627 12:104457658-104457680 CCAGAGCTCCTGGCTGCCCAGAT 0: 1
1: 0
2: 8
3: 40
4: 362
Right 1101409633 12:104457679-104457701 ATCTACCCGGGTCACCGCGTCGG 0: 1
1: 0
2: 0
3: 0
4: 12
1101409621_1101409633 27 Left 1101409621 12:104457629-104457651 CCTTCGGCCTCTTCGGGGCTCCT 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1101409633 12:104457679-104457701 ATCTACCCGGGTCACCGCGTCGG 0: 1
1: 0
2: 0
3: 0
4: 12
1101409625_1101409633 7 Left 1101409625 12:104457649-104457671 CCTGGCTGCCCAGAGCTCCTGGC 0: 1
1: 0
2: 7
3: 77
4: 673
Right 1101409633 12:104457679-104457701 ATCTACCCGGGTCACCGCGTCGG 0: 1
1: 0
2: 0
3: 0
4: 12
1101409626_1101409633 -1 Left 1101409626 12:104457657-104457679 CCCAGAGCTCCTGGCTGCCCAGA 0: 1
1: 0
2: 6
3: 59
4: 389
Right 1101409633 12:104457679-104457701 ATCTACCCGGGTCACCGCGTCGG 0: 1
1: 0
2: 0
3: 0
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101409633 Original CRISPR ATCTACCCGGGTCACCGCGT CGG Intronic
902130143 1:14253141-14253163 CTCTACCCCGGTAACCGGGTGGG - Intergenic
1091274655 11:134342217-134342239 CTCTAGCTGGGTCACCTCGTGGG + Intronic
1101409633 12:104457679-104457701 ATCTACCCGGGTCACCGCGTCGG + Intronic
1114477450 14:23006922-23006944 ATCTCGCCGGGTCACCGGGGAGG + Intronic
1118383913 14:65239590-65239612 ATCCACACAGGTCACCCCGTGGG + Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161050873 19:2163692-2163714 GTCTCCCCGGGTCCCCGCTTCGG + Intronic
946422506 2:219572502-219572524 ACCTTCCCTGGTCACCGCGGGGG - Exonic
1175229204 20:57462768-57462790 ATGTACCCTGGTCATCGAGTAGG - Intergenic
991608475 5:68426799-68426821 AGCTCCCCGTGTCACCTCGTGGG - Intergenic
997795150 5:136802271-136802293 ACCTGCCAGGGTCACAGCGTAGG + Intergenic
1012754278 6:103205191-103205213 ATCTTCCTGGGTCACAGAGTTGG - Intergenic
1038580925 8:28748676-28748698 ATCTCCCCGGGGCAACGGGTAGG - Intronic