ID: 1101409684

View in Genome Browser
Species Human (GRCh38)
Location 12:104457918-104457940
Sequence CGACCTCGGCAGCAGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101409684_1101409694 19 Left 1101409684 12:104457918-104457940 CCTCCCTGCTGCTGCCGAGGTCG 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1101409694 12:104457960-104457982 GGAGCCGGCTGCTCTGCGCCCGG 0: 1
1: 0
2: 1
3: 21
4: 191
1101409684_1101409691 4 Left 1101409684 12:104457918-104457940 CCTCCCTGCTGCTGCCGAGGTCG 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1101409691 12:104457945-104457967 ATGAAAGAGTTACCCGGAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 83
1101409684_1101409695 20 Left 1101409684 12:104457918-104457940 CCTCCCTGCTGCTGCCGAGGTCG 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1101409695 12:104457961-104457983 GAGCCGGCTGCTCTGCGCCCGGG 0: 1
1: 0
2: 0
3: 20
4: 215
1101409684_1101409690 -2 Left 1101409684 12:104457918-104457940 CCTCCCTGCTGCTGCCGAGGTCG 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1101409690 12:104457939-104457961 CGGAGGATGAAAGAGTTACCCGG 0: 1
1: 0
2: 0
3: 7
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101409684 Original CRISPR CGACCTCGGCAGCAGCAGGG AGG (reversed) Intronic
900109899 1:1000966-1000988 CGAACTCAGCAGCAGCAAAGTGG + Intergenic
900307181 1:2016357-2016379 CGACCACGCCAGCACCAGGAAGG - Intergenic
900408780 1:2503720-2503742 GGGCCCCAGCAGCAGCAGGGTGG + Intronic
900504875 1:3024959-3024981 CGCCCCCAGCAGCAGCAGTGAGG - Intergenic
900992927 1:6106319-6106341 TGACGTTGGCAGCAGCAGGCAGG + Intronic
904575600 1:31503242-31503264 TGACCTCAGCAGCAGCAGCATGG - Intergenic
905824534 1:41018314-41018336 CTGCCTCGGCTGCAGGAGGGTGG - Intronic
906723979 1:48030344-48030366 AGAGCACCGCAGCAGCAGGGAGG + Intergenic
915393155 1:155562436-155562458 CGGCGGCGGCAGCAGCAGAGTGG + Exonic
917345210 1:174022257-174022279 CAGCCTCAGCAGCAGCAGGTGGG - Exonic
924004501 1:239593035-239593057 AGACATGGGCTGCAGCAGGGTGG - Intronic
1062855290 10:777096-777118 CGTCCTCTGCAGCGGCAGGTAGG - Intergenic
1063537084 10:6893905-6893927 TGCCCTTGGCAGCAGCATGGAGG - Intergenic
1065883841 10:30059555-30059577 CGGCCTCGGCGGCTGCAGGCGGG - Intronic
1066654949 10:37688344-37688366 GGAGCTCAGCAGCAGCATGGGGG + Intergenic
1067039909 10:42943814-42943836 GGAGCTCAGCAGCAGCATGGGGG + Intergenic
1067064048 10:43093738-43093760 GGCCCTCAGCAGCAGCAGTGAGG + Intronic
1067189042 10:44054465-44054487 CCACCTGGGCAGCAGCAGGGAGG - Intergenic
1067791175 10:49288853-49288875 TCACCTCGGCCCCAGCAGGGAGG - Intergenic
1069909053 10:71748823-71748845 CCTCCCCAGCAGCAGCAGGGAGG + Exonic
1072966944 10:99981948-99981970 CCACCTCTTCAGGAGCAGGGTGG + Intronic
1076752306 10:132549671-132549693 GGAGCTCTGCAGCTGCAGGGCGG + Intronic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077356351 11:2120671-2120693 CGTCCTCGGCAGGAGAAAGGTGG + Intergenic
1077501756 11:2912580-2912602 CCACCTGGGCAGCAGGTGGGAGG + Intronic
1080440452 11:32289424-32289446 CCACCTCGGCAGCACCACAGAGG + Intergenic
1081859005 11:46321303-46321325 CGGCTTGGGCAGCAGCAGGGGGG - Exonic
1082004847 11:47413816-47413838 CGGCCAGGACAGCAGCAGGGAGG - Intronic
1082066531 11:47905446-47905468 CGACCTCGGCAGGCACATGGCGG - Intergenic
1087777418 11:102268884-102268906 CGCCCTCTGCAGCAGCCGAGCGG - Intergenic
1088256492 11:107908352-107908374 CGACCTCGTTTGCATCAGGGAGG - Intronic
1091368270 11:135039439-135039461 AGACCTGGGCAGTAGGAGGGAGG + Intergenic
1092942951 12:13427634-13427656 GGACCTCTGCAGCAGGAGGCTGG + Intergenic
1095942957 12:47738299-47738321 TGCCCTGTGCAGCAGCAGGGAGG + Intronic
1097009254 12:55940727-55940749 GACCCTCGGCAGCAGCGGGGAGG + Intronic
1100329492 12:93570918-93570940 CCGCCTCCGCAGCAGCCGGGCGG + Intronic
1101409684 12:104457918-104457940 CGACCTCGGCAGCAGCAGGGAGG - Intronic
1102858118 12:116312429-116312451 AGACAAGGGCAGCAGCAGGGAGG + Intergenic
1106478286 13:30116519-30116541 AGCACTCGGCAGCAGCAGCGTGG + Intergenic
1112316871 13:98370703-98370725 TGACCACAGCAGCAGCAGGAAGG + Intronic
1113449214 13:110394687-110394709 CCACCTCTCCAGCAGCAGTGTGG - Intronic
1113627286 13:111856617-111856639 CCTCCAGGGCAGCAGCAGGGCGG - Intergenic
1114259123 14:21025024-21025046 CGGCCGCGGCGGCAGCAGGTAGG - Intronic
1114519007 14:23321483-23321505 CGGCGGCGGCAGCAGCAGCGGGG + Exonic
1118458523 14:65966795-65966817 CTACCTCTCCAGCCGCAGGGAGG - Intronic
1122819502 14:104334331-104334353 CGACCTGGGCAGCCGCCGGCTGG - Intergenic
1127288259 15:57549038-57549060 CGACATCGCCAGCAGCAGGCTGG + Exonic
1131432021 15:92394949-92394971 CGACCTCGCCAGAGGTAGGGTGG + Intronic
1133002408 16:2858027-2858049 CGACGCCAGCAGCAGCAGGGAGG + Exonic
1135342876 16:21664078-21664100 CCACCTGGGCCGCTGCAGGGAGG + Intergenic
1136183841 16:28573350-28573372 CCACATCGGAAGCAGCAGAGAGG + Intronic
1139348233 16:66318301-66318323 AGACCTTGGCAGCAGAAGGAAGG + Intergenic
1141620511 16:85234751-85234773 CCGCCCCCGCAGCAGCAGGGAGG + Intergenic
1141859061 16:86704227-86704249 CAACAGCGGAAGCAGCAGGGCGG + Intergenic
1146268894 17:31471737-31471759 CCCACTGGGCAGCAGCAGGGTGG - Intronic
1146371342 17:32266821-32266843 TGACCCCGGCCGGAGCAGGGAGG + Intronic
1148846474 17:50532904-50532926 CGACCTGTGCAGCAGCGGGACGG - Exonic
1149559972 17:57601562-57601584 CGAGCCGGGCAGCAGCAGGAAGG + Intronic
1152070467 17:78131584-78131606 CGACCGCGGCAGCAGCATCTCGG - Exonic
1152413965 17:80147004-80147026 CGAGGTCGGCAGCGGCAGCGAGG - Exonic
1152413971 17:80147042-80147064 CGAGGTCGGCAGCGGCAGCGAGG - Exonic
1152684128 17:81685522-81685544 CCAGCTTGGCAGCAGCTGGGGGG - Intronic
1152811207 17:82383581-82383603 AGGCCCCGGCAGCAGAAGGGAGG - Intergenic
1155053139 18:22165355-22165377 CGGCCACGGGAGAAGCAGGGAGG + Intergenic
1155120867 18:22817033-22817055 TCACGTCGGCTGCAGCAGGGAGG - Intronic
1156372002 18:36479808-36479830 CTACCTGGGCAGTAGCATGGAGG - Intronic
1160442639 18:78904065-78904087 GGACCTTGGCCTCAGCAGGGAGG + Intergenic
1162307719 19:9885500-9885522 CGTGCTCAGCAGCTGCAGGGTGG - Intronic
1163357905 19:16826449-16826471 CAACCTTGGCATCAGCTGGGTGG - Intergenic
1163618022 19:18341062-18341084 GGACCTCGGAAGGGGCAGGGAGG - Intronic
1163686348 19:18714029-18714051 CGTGCCCGGAAGCAGCAGGGTGG + Intronic
1165097292 19:33416596-33416618 CCTCCTCCCCAGCAGCAGGGAGG + Intronic
1165388751 19:35526712-35526734 CGGCCTGGCCAGCAGCATGGTGG + Exonic
1165393461 19:35551192-35551214 AGATGTCAGCAGCAGCAGGGAGG + Intronic
1166843584 19:45713018-45713040 GGCCCTCCTCAGCAGCAGGGGGG + Exonic
1167736979 19:51300775-51300797 CCACCTTGGGAGCAGCAGGCAGG + Intergenic
924995767 2:359148-359170 CCAAGTCGGCAGCAGCAGGAGGG - Intergenic
926142250 2:10374693-10374715 TGAGCTGGGCACCAGCAGGGAGG + Intronic
929672316 2:43886552-43886574 CCCTCTCGGCAGCAGCGGGGGGG - Exonic
938100181 2:128493128-128493150 CGCTCTGGGCAGGAGCAGGGTGG - Intergenic
943394422 2:187315028-187315050 CGACCTTGGCAGAAGCAGTAGGG + Intergenic
947526432 2:230879317-230879339 GGACCTCGGGAGCAGCAGGCAGG + Intergenic
948938341 2:241182887-241182909 CGACCTCAGGAGCAACAGGTGGG - Exonic
1168765783 20:381072-381094 CGAGCTCGGCAGCAGCGCAGCGG + Exonic
1169265169 20:4163006-4163028 GGAGCTGGGCAGCAGCGGGGTGG + Intronic
1170487064 20:16829140-16829162 TGAACTAGGCAGCAGAAGGGTGG + Intergenic
1170629729 20:18056791-18056813 CGGCAGCGGCAGCAGCAGCGCGG - Exonic
1172959401 20:38787875-38787897 GGACACCGGCAGCAGCAGCGAGG + Intergenic
1175407073 20:58741802-58741824 CCAGCTCTGCAGCAGAAGGGTGG + Intergenic
1175939119 20:62529780-62529802 AGCCCTCGGGAGCAGCAGTGGGG - Intergenic
1178812094 21:35893701-35893723 CGCCCAGGGCAGCAGCAGAGTGG + Intronic
1180715925 22:17872263-17872285 CTCCCTCGTCAGCAGCAGGCTGG - Intronic
1180736929 22:18024323-18024345 CTGCCTCGGCAGGGGCAGGGTGG + Exonic
1181175490 22:21032526-21032548 CGGCTGCGGCAGCAGCAGGTGGG - Exonic
1181773219 22:25141775-25141797 GGACCTCGGCTTCAGCAGGCTGG - Intronic
1182310605 22:29402886-29402908 CAAGGTGGGCAGCAGCAGGGAGG + Intronic
1182435455 22:30326923-30326945 GGGCGTCGGCGGCAGCAGGGCGG - Intronic
1182690445 22:32157860-32157882 CAAGGTGGGCAGCAGCAGGGAGG - Intronic
1183352300 22:37341117-37341139 CGACCTCACCAGCAGCCAGGGGG + Intergenic
1184148841 22:42627133-42627155 CGGCCTTGGCAGCAGCACGGCGG - Intronic
1184937610 22:47736444-47736466 AGGCCCCAGCAGCAGCAGGGAGG + Intergenic
953163655 3:40445137-40445159 AGACATCGGCTGCAGCAGGGAGG + Intergenic
954369467 3:50162637-50162659 CCTCCGTGGCAGCAGCAGGGAGG + Intronic
954656488 3:52197386-52197408 CACCCTGGGCACCAGCAGGGTGG - Intergenic
955732405 3:62000422-62000444 AGACCTAGGCAACAGAAGGGAGG + Intronic
961685834 3:128630116-128630138 CATCCTGGGCAGCAGCAGGAAGG + Exonic
962702124 3:138010166-138010188 CACCTTCGGCAGCAGGAGGGCGG + Exonic
963253384 3:143121194-143121216 CGACGGCGGCAGCGGGAGGGCGG - Exonic
964433727 3:156631177-156631199 CCACCTCTGCAGAAGTAGGGAGG - Intergenic
968641147 4:1715705-1715727 GGCCCTCTGCAGGAGCAGGGTGG - Intergenic
971389437 4:26172260-26172282 AGCCCACGGCAGCTGCAGGGTGG - Intronic
973041027 4:45471286-45471308 AGACGCCGGCTGCAGCAGGGAGG + Intergenic
975166926 4:71187411-71187433 CGGCCCCGGCAGCTGCCGGGAGG + Intronic
975342572 4:73258563-73258585 CGACCTCCGCCGCCGCGGGGGGG + Exonic
992202295 5:74396304-74396326 CCACCTTGGCAGCAGCTGAGGGG - Intergenic
994043463 5:95284141-95284163 CGGCCTCGGGAGCAGCGGGAGGG - Exonic
998330219 5:141319351-141319373 TGACCTCAGCAGCAGCAGTGAGG - Exonic
998382520 5:141735812-141735834 CTACCTAGGCAGCTGCTGGGAGG + Intergenic
1000091282 5:157931594-157931616 TGACCTCGGCGGCGTCAGGGAGG + Intergenic
1003096817 6:3148652-3148674 CCACCTGAGCAGCAGCTGGGAGG - Intronic
1004794900 6:19070602-19070624 GGACCTTGGCAGAAGCAGGAAGG + Intergenic
1010980247 6:82363692-82363714 CAACCTCGGCAGCCGTAGGTAGG - Exonic
1020034938 7:4959085-4959107 CGGCGGCGGCAGCAGCAGGTTGG + Exonic
1020248541 7:6449254-6449276 CCACCCCGCCAGCTGCAGGGTGG - Intronic
1026830162 7:73605785-73605807 CGACATCAGCAGCAGCAGGCAGG + Intronic
1028417601 7:90596421-90596443 CGGCCTGGGCCGCAGCTGGGCGG - Intronic
1029202216 7:98846781-98846803 CCACCTCGGGAGCAGCTGGCAGG + Exonic
1029419150 7:100463432-100463454 CGTCCTCGGCAGCTGCAGTAGGG + Exonic
1035127482 7:156619016-156619038 CGGCCTCCGCAGCAGCAGCTGGG + Intergenic
1037918810 8:22789628-22789650 CAACGTCTGCAGCAGCATGGGGG + Intronic
1039244872 8:35597614-35597636 TGACTTTGGCAGCAGCAGAGAGG + Intronic
1049341511 8:142115016-142115038 CCACCTGGGAAGCAACAGGGTGG - Intergenic
1049418466 8:142506177-142506199 CGACCTTGGCAGGAGCCGAGTGG + Intronic
1049574209 8:143382967-143382989 TGCCCAGGGCAGCAGCAGGGTGG - Exonic
1049817923 8:144616619-144616641 CGCCCTAGGCAGCAGCCAGGAGG + Intergenic
1052063198 9:23986316-23986338 CGACCCCTGCAGCAGCAGTATGG + Intergenic
1053175045 9:35916437-35916459 CCACCTCGACACCAGCAGGAGGG + Intergenic
1057217383 9:93236607-93236629 CGGACTCAGAAGCAGCAGGGCGG - Intronic
1061050474 9:128191854-128191876 GGACCGCGGCGGCCGCAGGGAGG - Intronic
1062390473 9:136331768-136331790 CAGCCTCGTCAGCAGCGGGGCGG - Intronic
1185737377 X:2503745-2503767 GGACCTCGGCAGGGGCTGGGGGG - Intergenic
1185890360 X:3816509-3816531 CGACCTCCTCAGCCGCAGCGGGG - Intergenic
1186196298 X:7113132-7113154 CCTCCTCTGCAGCAGCATGGGGG - Intronic
1189211627 X:39288825-39288847 TGAGCAGGGCAGCAGCAGGGAGG + Intergenic
1190685239 X:52867673-52867695 CGACCCGGGAAGGAGCAGGGTGG - Intronic
1191829490 X:65401221-65401243 CACCCTTGGCAGCAGCAGTGTGG + Intronic
1197987309 X:132279503-132279525 CCACCCCAGCAGCAGCAGCGTGG - Intergenic
1200038648 X:153349911-153349933 AGACCCCGCCAGCAGCAGTGGGG + Exonic
1200117108 X:153774197-153774219 CAACCTGGGCATCAGCAAGGAGG + Exonic