ID: 1101409909

View in Genome Browser
Species Human (GRCh38)
Location 12:104458814-104458836
Sequence CAGTGAAAGGAGAAGGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 701
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 647}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101409909 Original CRISPR CAGTGAAAGGAGAAGGCGGG AGG (reversed) Intronic
900162358 1:1230095-1230117 CTGTGAAAGGAGTAGGCTCGTGG - Intronic
900932879 1:5747793-5747815 GAGAGAAAGGAGAAAGAGGGAGG + Intergenic
900955413 1:5883633-5883655 CAGTGAAGGGAGGTGCCGGGTGG - Intronic
901272518 1:7963616-7963638 CTGTAAAAGGCTAAGGCGGGCGG - Intronic
902652077 1:17843660-17843682 AAGTGAAAGGAGAAGGAAGGTGG - Intergenic
903179730 1:21599109-21599131 CAAAGAAAGGAGGAGGCGGCAGG + Intronic
903363561 1:22792368-22792390 CAGTTGAGGGAGAAGGAGGGGGG + Intronic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
905007932 1:34725996-34726018 CAGTGAAAGTATAAGGTGGTTGG - Intronic
905087075 1:35390364-35390386 CAGTGAAGGGAGATGGGGTGGGG + Intronic
905447516 1:38036689-38036711 GAGTTAAAGGAGAGGGCAGGGGG + Intergenic
905817417 1:40962606-40962628 CTTTGAGAGGTGAAGGCGGGTGG - Intergenic
905915859 1:41683874-41683896 CAGTGATAGGACCAGGAGGGTGG - Intronic
906080586 1:43085798-43085820 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
906156562 1:43617419-43617441 CAGAGAATGGAGAAAGCGGGTGG - Intronic
907981259 1:59483801-59483823 CAGTGAAATGAGAAGTCCTGGGG + Intronic
909266789 1:73570085-73570107 CTTTGAAAGGCCAAGGCGGGTGG + Intergenic
909473808 1:76059516-76059538 CAGTGAAAGCAGCGGGTGGGAGG + Intergenic
910283421 1:85526867-85526889 AAGTGAGAAGAGAAGGAGGGAGG + Intronic
911969160 1:104408318-104408340 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
912939481 1:114032359-114032381 CAGTGAAAGGAGATAGGGGTGGG - Intergenic
914206594 1:145536121-145536143 AAGTGAGAAGAGAAGGAGGGAGG - Intergenic
914803584 1:150976820-150976842 CTTTGAAAGGCCAAGGCGGGTGG - Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
915320091 1:155051634-155051656 GGGTGAAAAGAGAAGGAGGGGGG + Intronic
916508027 1:165445500-165445522 CTGTGAAAGGAGGAGGGGGTGGG + Intergenic
917106489 1:171497710-171497732 CTTTGAAAGGCGAAGGTGGGAGG - Intronic
917256836 1:173124732-173124754 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918284915 1:183042800-183042822 CAGTGCCAGGAGAGGGCTGGGGG - Intronic
918434836 1:184500716-184500738 CAGTTAAAGGAGAAGGAGCTGGG + Intronic
919074168 1:192793982-192794004 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
919818406 1:201456648-201456670 AACTGAAAGGTGAAGGTGGGGGG + Intergenic
919833111 1:201555849-201555871 CTGTGAAGGGAGATGGGGGGCGG + Intergenic
919928850 1:202208386-202208408 GAGAGAGAGGAGAAGGAGGGGGG + Intronic
920101995 1:203522483-203522505 CGGTGAAAGGAGTGGGCGTGGGG - Intergenic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
920226953 1:204446155-204446177 CACGGAAAGGAGAAGGTGGTGGG + Intronic
920706918 1:208258120-208258142 CAGTGAAAGGAGGCAGTGGGTGG - Intergenic
920892984 1:210011487-210011509 GAGTGAGAGGAGGAGGCGGGAGG - Intronic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
922023414 1:221727828-221727850 CAGTGAGAGGGGAAGGGAGGGGG - Intronic
923127649 1:231046530-231046552 CTCTGAAAGGCCAAGGCGGGAGG + Intergenic
923203662 1:231737561-231737583 CAGTGAAAGGAGAATAGGAGAGG + Intronic
923693180 1:236217417-236217439 CAGTGAAAAGAAAAGGTGAGGGG + Exonic
924539886 1:244970717-244970739 AGGAGAAAGAAGAAGGCGGGAGG - Exonic
924630513 1:245735420-245735442 CTGTGGAAGGCCAAGGCGGGTGG + Intergenic
924632993 1:245760011-245760033 TAGTGACAGGAGAGGGCAGGAGG + Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
924754948 1:246932094-246932116 CGGTGAAAGAAGGAGGTGGGAGG + Intergenic
1063430954 10:5987871-5987893 CAGAGTGGGGAGAAGGCGGGTGG + Intergenic
1063509972 10:6635194-6635216 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1063527204 10:6797184-6797206 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1063542231 10:6945392-6945414 AAGAGAGAGGAGAAGGAGGGTGG - Intergenic
1063896155 10:10684497-10684519 CTTTGAGAGGACAAGGCGGGTGG + Intergenic
1064172630 10:13047581-13047603 GTGTGAAAGAAGGAGGCGGGAGG - Intronic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1065522906 10:26589173-26589195 CAGGGAAAGAAGAAGGGGTGAGG - Intergenic
1065528830 10:26648444-26648466 CAGGGAAAGAAGAAGGGGTGAGG - Intergenic
1065559275 10:26946059-26946081 CAGGGAAAGAAGAAGGGGTGGGG + Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1067184303 10:44014091-44014113 GAGGGAAAGGAGAAGGGGAGGGG - Intergenic
1067304259 10:45045564-45045586 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1067672203 10:48333666-48333688 CAGGGAAAGAAGAAGGGGTGGGG + Intronic
1067694693 10:48526325-48526347 GAGTTAAAGGAGAGGGAGGGAGG - Intronic
1067987891 10:51171388-51171410 AAGTGAATGGAGGAGGCTGGTGG + Intronic
1068015403 10:51510093-51510115 CAGTGAAAGGAAAGGGAGGTTGG - Intronic
1068131971 10:52906356-52906378 CAGGGAAAGGAGAATGCTAGAGG + Intergenic
1069576845 10:69536739-69536761 CATTGAGAGGACGAGGCGGGTGG + Intergenic
1070190438 10:74107084-74107106 CAGTGATTGAAGAAGGGGGGAGG - Intronic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1071807741 10:89142766-89142788 AAGAGAAAGGAGAAGGGGAGGGG + Intergenic
1073308478 10:102522427-102522449 GAGAGAAAGGAGGAGGCGTGTGG - Intronic
1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG + Intronic
1073970366 10:109040942-109040964 CAGTGAGAGGTGAAGCCGGCTGG + Intergenic
1075334832 10:121601069-121601091 AAGAGAAAGGAGAAGGGGGTGGG + Intergenic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076412623 10:130262723-130262745 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076412846 10:130264164-130264186 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1077204078 11:1333189-1333211 GAGTGGAGGGAGAGGGCGGGAGG + Intergenic
1077451182 11:2646757-2646779 CTTTGAAAGGATGAGGCGGGTGG - Intronic
1077495855 11:2886163-2886185 CAGACAAAGGAGCCGGCGGGGGG - Intergenic
1077524909 11:3058099-3058121 CCTTGAAAGGACAAGGCAGGAGG + Intergenic
1077889800 11:6410884-6410906 GAGGGAGAGGAGAAGGCGGCCGG - Exonic
1078377190 11:10806245-10806267 CAGTGAAAGCAGAAACTGGGTGG - Intronic
1078595599 11:12683756-12683778 AATTGAAAGGAGTAGGAGGGGGG + Intronic
1079093375 11:17495738-17495760 CAGTGAAAGGAGAAGCCCCATGG - Intronic
1079119950 11:17674913-17674935 CAGAGAAAGAAGAAGCCTGGAGG + Intergenic
1079132560 11:17756030-17756052 AAGTGCAAGAAGAAGGAGGGAGG + Intronic
1079727417 11:23892625-23892647 CAGTGAAGGGAGATGGTGTGGGG + Intergenic
1080277819 11:30523138-30523160 CAGTCAAAGGTGGGGGCGGGTGG + Intronic
1080994604 11:37583164-37583186 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1081612220 11:44569335-44569357 CAGTGGAAGGGGAAGCCCGGGGG - Intronic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1082912818 11:58395971-58395993 CACTGAAAGGAGATGGGGGTGGG + Intergenic
1083179835 11:60978204-60978226 CAGAGAAAGGACAAAGGGGGTGG + Intronic
1083372157 11:62190681-62190703 CAGAGATAGGAGGAGGCGCGGGG - Intronic
1083594824 11:63914174-63914196 CAGTGAAAGGAGAGGCAGGTAGG + Intronic
1084231973 11:67759972-67759994 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1084245886 11:67856713-67856735 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1084356034 11:68639320-68639342 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1084826785 11:71737801-71737823 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1085246662 11:75107472-75107494 CAGTGAAAGGAGGAATGGGGAGG - Intronic
1085543386 11:77294232-77294254 CAGTGAAAGGATAATGCTGGGGG + Intronic
1085771739 11:79331596-79331618 CAGTGTAAGGAGACTGTGGGAGG + Intronic
1086004756 11:82025735-82025757 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1086136602 11:83448287-83448309 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1087157790 11:94921848-94921870 CATTATAAGGAGAAGGCAGGAGG - Intergenic
1087501423 11:98959409-98959431 CTTTGAGAGGACAAGGCGGGTGG + Intergenic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087839871 11:102909600-102909622 CAGTGAAAGGAGATAGAGGTGGG + Intergenic
1088327656 11:108617279-108617301 GAGTGAGAGGATAAGGAGGGAGG + Intergenic
1089083931 11:115800844-115800866 CATTCACAGGAGAAGGCAGGGGG - Intergenic
1089553018 11:119295736-119295758 CAATAAAATGAGATGGCGGGAGG - Intronic
1089560285 11:119340188-119340210 GAGAGAAAGGCGAGGGCGGGAGG - Exonic
1089585108 11:119505570-119505592 CTTTGAAAGGACAAGGCGGGAGG + Intergenic
1089959203 11:122600719-122600741 CTTTGAAAGGCCAAGGCGGGAGG + Intergenic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1091494256 12:958457-958479 CAATGGAAGGCCAAGGCGGGTGG - Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091769611 12:3142397-3142419 CAGGGAAGGGAGGAGGCGAGAGG - Intronic
1091883744 12:4001150-4001172 GAGTGAAAGGAGAGGGTGGGTGG - Intergenic
1092146276 12:6216795-6216817 CTGTGATCGGAGAAGGCGGCTGG - Intronic
1092388890 12:8057776-8057798 AAGTGGAAGGAGAAAGAGGGTGG - Intergenic
1092475209 12:8813212-8813234 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1092789380 12:12058659-12058681 CAGTGAAGGGAGATGGGGTGGGG - Intronic
1093033932 12:14315301-14315323 CTTTGAGAGGAGAAAGCGGGTGG + Intergenic
1093312268 12:17603705-17603727 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1093622645 12:21310844-21310866 CTTTGAAAGGCCAAGGCGGGCGG - Intronic
1093844525 12:23952197-23952219 CAGGAAGAGGAGGAGGCGGGAGG + Intergenic
1094385417 12:29888692-29888714 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1094477273 12:30850881-30850903 CATTAAAAGGATAAGGTGGGAGG + Intergenic
1095349041 12:41188330-41188352 CAGTGGAGGGAGGTGGCGGGTGG - Intergenic
1095898832 12:47306616-47306638 CAGTGAAAGGTGAAGCCTGCTGG + Intergenic
1096098214 12:48951634-48951656 CATTGGAAGGCCAAGGCGGGCGG + Intronic
1096188306 12:49598579-49598601 CAGGGAGAGGTGAAGGCAGGTGG - Intronic
1096369516 12:51057338-51057360 CTTTGAAAGGCCAAGGCGGGAGG - Intronic
1096705036 12:53415405-53415427 CAGGGAAAGGAAAAGAAGGGGGG + Intronic
1096770555 12:53933560-53933582 TAGTGAAGCCAGAAGGCGGGAGG + Intergenic
1097222934 12:57461237-57461259 CAGTAGAGGGAGAAGGCGGGCGG + Intronic
1097240365 12:57571042-57571064 CATTGAAAGGCCAAGGCGGGAGG - Intronic
1097352810 12:58567142-58567164 CAGTGAAAAAAAAAGGGGGGGGG - Intronic
1097547606 12:61023721-61023743 CAGTGAGAGGTGAAGCCGGCTGG + Intergenic
1099437238 12:82659385-82659407 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1099713568 12:86262112-86262134 CAGTGAGATGAGAAGGCTAGTGG - Intronic
1099835601 12:87907389-87907411 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1099985094 12:89652970-89652992 CTTTGAAAGGCCAAGGCGGGAGG - Intronic
1100561838 12:95754765-95754787 CAGTGAAGGGAGATGGGGTGGGG - Intronic
1101359685 12:104014582-104014604 CAGGGAGAGGAGAAAGAGGGTGG + Intronic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1102073969 12:110045342-110045364 CAGTGAGAGGCCAAGGCGGGCGG + Intronic
1102184666 12:110938320-110938342 CTTTGAAAGGCCAAGGCGGGAGG - Intergenic
1102518951 12:113467469-113467491 CAGGGAAGGGAGAAGAGGGGGGG - Intronic
1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG + Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103413193 12:120726983-120727005 GAGTGGAAGGAGGAGGCAGGAGG - Intronic
1103926895 12:124428153-124428175 CACTGGAAGGAGGAGGCCGGTGG - Intronic
1104429391 12:128704570-128704592 CAGTGCAGGGAGAAGAGGGGAGG + Intronic
1104451875 12:128875876-128875898 CAGAGAAAGGAGAAGATGAGGGG - Intronic
1104667166 12:130655935-130655957 GAGTGAAAGGAGGATGCTGGTGG + Intronic
1105237138 13:18567803-18567825 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1105352915 13:19632106-19632128 CAGTTAAAGGAAAAAGAGGGAGG - Intergenic
1105599841 13:21876869-21876891 CAGTGAGAGGTGAAGCCAGGGGG - Intergenic
1105806139 13:23952770-23952792 CAGTGAGAGGTGAAGCCGAGTGG - Intergenic
1105939774 13:25137373-25137395 CAGTCAAAGGAGAATGCTGATGG + Intergenic
1106466652 13:30019847-30019869 AAGTGACAGGAGAAGGAGGTGGG + Intergenic
1106643175 13:31607434-31607456 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1107882294 13:44843268-44843290 GAGTGGGAGGAGAAGGGGGGTGG + Intergenic
1109061901 13:57631388-57631410 CATTTAAAGGAGGAGGGGGGAGG - Intergenic
1109247625 13:59975976-59975998 GGGTGACAGGAGAAGGTGGGCGG - Intronic
1109282409 13:60372260-60372282 CAGAGACAGGAGAAAGCGGTAGG - Intergenic
1109499817 13:63219009-63219031 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1109814058 13:67556081-67556103 CAGTGTAGGGAGAAGCCAGGTGG + Intergenic
1110267721 13:73557476-73557498 CAGAGAAAGGCTGAGGCGGGGGG - Intergenic
1110529961 13:76585384-76585406 CTTTGAAAGGCCAAGGCGGGAGG - Intergenic
1111021977 13:82462081-82462103 CTTTGAGAGGACAAGGCGGGTGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112547314 13:100383381-100383403 CATTGAGAGGCTAAGGCGGGAGG + Intronic
1112717208 13:102200857-102200879 CATTGGGAGGACAAGGCGGGCGG + Intronic
1112908133 13:104449022-104449044 CAGTGAAACAAGAAGGCAGGTGG - Intergenic
1113222788 13:108124345-108124367 CAGTGTGAGGGGAAGGCTGGTGG - Intergenic
1113387294 13:109860495-109860517 AAGTGAAAGGGGCAGGCAGGAGG - Intergenic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113677013 13:112214603-112214625 AAGGGAAAGGCGAAGGCTGGAGG + Intergenic
1113842682 13:113369357-113369379 CAGGGCAAAGGGAAGGCGGGAGG - Intergenic
1114180742 14:20365516-20365538 CTTTGAAAGGCCAAGGCGGGTGG - Intergenic
1114445667 14:22786075-22786097 CTTTGAAAGGCCAAGGCGGGTGG + Intronic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1116984899 14:51208011-51208033 GAGGGAAAGGAGAAGAAGGGAGG - Intergenic
1117162035 14:52999437-52999459 CTGTGAATGTAGAAGGTGGGGGG + Intergenic
1117569550 14:57032953-57032975 CAGTGGGAGGCCAAGGCGGGTGG - Intergenic
1118571738 14:67201050-67201072 CTTTGAAAGGACAAGGCAGGAGG + Intronic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118630643 14:67699309-67699331 CACTGGAAGGCCAAGGCGGGAGG + Intergenic
1119011246 14:70991445-70991467 CTTTGAAAGGCCAAGGCGGGTGG - Intronic
1119030470 14:71188338-71188360 CAGTGAAGGGAGCTGGGGGGTGG + Intergenic
1119182167 14:72612592-72612614 CAGGGAAGGGAGAGGGCAGGAGG + Intergenic
1119726654 14:76925518-76925540 CTTTGAGAGGACAAGGCGGGTGG + Intergenic
1120395429 14:83961865-83961887 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1122059910 14:99130126-99130148 CAGGGGAAGGAGAGGGCGTGGGG - Intergenic
1122161844 14:99790819-99790841 CAGGGAAAGGAAATGGGGGGAGG - Intronic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122272912 14:100576347-100576369 CAGTGCATGGAGGAGGAGGGAGG - Intronic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1122844767 14:104486882-104486904 CAGTGTCAGGAGCAGGCGAGGGG - Intronic
1123018860 14:105388258-105388280 CAGTGTGAGGAGACGGCGGCTGG - Intronic
1202835425 14_GL000009v2_random:74546-74568 GAGTGAAAGGTGAAGGTGGGGGG + Intergenic
1124547624 15:30646270-30646292 CGGGGAAAGGAGAAGCCTGGTGG - Exonic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125555342 15:40580116-40580138 GTGTGACAGGAGAAGGAGGGAGG + Intergenic
1125674158 15:41493769-41493791 AAGTGGAAGGAGTGGGCGGGGGG + Intronic
1125850061 15:42894506-42894528 CTGTGGGAGGCGAAGGCGGGTGG + Intronic
1126436662 15:48644902-48644924 CAGCGCCTGGAGAAGGCGGGAGG - Exonic
1127071232 15:55289876-55289898 AGGTGACAGGAGAAGGCGGGAGG - Intronic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1127959374 15:63879465-63879487 TGGTGAAAGGAGGAGGCAGGAGG - Intergenic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129306412 15:74667420-74667442 GAAAGAAAGGAGAAGGGGGGAGG + Intronic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129637971 15:77342650-77342672 CTTTGGAAGGACAAGGCGGGAGG - Intronic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1130255185 15:82322691-82322713 CAGTGCCAGGAGAACTCGGGCGG - Intergenic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130599789 15:85267315-85267337 CAGTGCCAGGAGAACTCGGGCGG + Intergenic
1131668622 15:94596268-94596290 CTTTGGAAGGACAAGGCGGGTGG + Intergenic
1131779011 15:95834324-95834346 CAGTGAGAGGGGAATGGGGGTGG - Intergenic
1132378523 15:101348905-101348927 GAGTGAGAGGAGCAGGAGGGTGG - Intronic
1133032664 16:3018798-3018820 CAGTGCGAGGCCAAGGCGGGCGG - Intronic
1133150120 16:3821784-3821806 CTTTGAAAGGCCAAGGCGGGTGG + Intronic
1133307693 16:4821251-4821273 CATTGAATGGAAAAGGTGGGGGG - Intronic
1133963582 16:10515552-10515574 CTTTGAAAGGCGGAGGCGGGAGG + Intergenic
1134481524 16:14623591-14623613 CACTGGAAGGCCAAGGCGGGTGG + Intronic
1135116392 16:19727341-19727363 CACTGGAAGGCCAAGGCGGGCGG + Intronic
1135389139 16:22074324-22074346 CACTGGAAGGCCAAGGCGGGAGG + Intronic
1135436176 16:22428240-22428262 CTGTGATAGGCCAAGGCGGGAGG - Intronic
1136000040 16:27285569-27285591 CTGTGGAAGGCCAAGGCGGGAGG + Intronic
1136989713 16:35144614-35144636 TAATGAGAGGAGAAGGTGGGAGG - Intergenic
1137725885 16:50656319-50656341 CAGTGGAAGGTGAAGGGGAGCGG - Intergenic
1137872918 16:51967793-51967815 AGCTGAAAGGAGAAGGCTGGGGG - Intergenic
1138478627 16:57286771-57286793 CTTTGAAAGGCCAAGGCGGGTGG - Intergenic
1139055527 16:63179074-63179096 GAGTGAAAGGAGAGGGGGGGGGG + Intergenic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1140196489 16:72859731-72859753 CAGTGAGGGGAGAATGCGGCAGG + Intronic
1140518259 16:75560220-75560242 CAGTGTCAGGAGATGGCGTGAGG + Intergenic
1141089461 16:81120312-81120334 CAGTGAACCGTGGAGGCGGGTGG + Intergenic
1141113914 16:81292173-81292195 CTTTGAAAGGCCAAGGCGGGAGG - Intergenic
1141117101 16:81318417-81318439 CTGTGAGAGGTGGAGGCGGGAGG + Intronic
1141598383 16:85111121-85111143 GAGGGAAAGGAGAGGGCGTGAGG - Intronic
1141671955 16:85496806-85496828 CAGTGACAGGAGCAGGTGAGGGG - Intergenic
1142131977 16:88435290-88435312 CAGAAAAAAGAGAAGGCCGGAGG + Exonic
1142141460 16:88474529-88474551 CAGGGATGGGAGGAGGCGGGTGG - Intronic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1142421586 16:89973748-89973770 AAATGAATGGAGATGGCGGGGGG - Intergenic
1142582299 17:949693-949715 CAGGGAGAGGAGGAGGCAGGGGG - Intronic
1143644504 17:8221643-8221665 CACGAAAAGGAAAAGGCGGGGGG - Intergenic
1143712284 17:8743226-8743248 CAGTGCAAGGACAAGGATGGAGG + Intronic
1144116647 17:12100008-12100030 GAGGGAAAGGAGAAGAGGGGTGG - Intronic
1144257761 17:13486464-13486486 CAGAGGCAGGAGAAGGCAGGAGG + Intergenic
1144394872 17:14834319-14834341 CACTGAAAGGTGAAGCCGGCTGG + Intergenic
1145415564 17:22711283-22711305 TGGTGAAAGGAGAAGGCAAGTGG + Intergenic
1145991721 17:29083062-29083084 CAGAGAAAGGAAAAGGGGCGGGG + Intronic
1149528355 17:57375820-57375842 GAATGAAAGGAGAAGGATGGGGG - Intronic
1150197619 17:63317313-63317335 CAGGGAAATGACAAGGAGGGGGG - Intronic
1150373058 17:64658109-64658131 CACTGGAAGGCTAAGGCGGGCGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151377624 17:73701751-73701773 CTTTGATAGGACAAGGCGGGCGG - Intergenic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151618462 17:75230284-75230306 CACTGAAAGGCCGAGGCGGGTGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152032800 17:77854399-77854421 GAGGGAAAGGAGAAGGCGCTGGG + Intergenic
1152094040 17:78263004-78263026 CTTTGAAAGGCCAAGGCGGGTGG - Intergenic
1152103438 17:78315767-78315789 CAGGGAAAATGGAAGGCGGGCGG + Intergenic
1153170823 18:2313996-2314018 CATTGAGAGGTGAAGGAGGGAGG + Intergenic
1153336290 18:3929048-3929070 CAATGATAGTAGAAGGCGGAGGG - Intronic
1153407141 18:4753541-4753563 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154210459 18:12375475-12375497 CTTTGAGAGGAGGAGGCGGGAGG + Intronic
1154239024 18:12634689-12634711 CTTTGAAAGGCCAAGGCGGGTGG + Intronic
1154308985 18:13253193-13253215 AGGTGACAGGAGAAGGTGGGAGG + Intronic
1155282394 18:24253151-24253173 CAATGAAAAGACATGGCGGGGGG + Intronic
1155838138 18:30613002-30613024 CAGCGAAAGGAGATGGGGTGGGG - Intergenic
1156844770 18:41652657-41652679 CAGTGAAAGAAGAATGGGGCAGG + Intergenic
1157687009 18:49650807-49650829 CAGTGAAAGGAGAAGACCTCAGG - Intergenic
1157947923 18:52002081-52002103 CAGGGAAAGGAGATGGCATGAGG - Intergenic
1158261823 18:55614136-55614158 CATTGGAAGGCTAAGGCGGGAGG - Intronic
1158336016 18:56415762-56415784 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1158336844 18:56421220-56421242 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1158671094 18:59474516-59474538 AAGTGAAGGGAGAAGGCTGAGGG + Intronic
1159164153 18:64682008-64682030 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1159972934 18:74676333-74676355 CTTTGGAAGGAGAAGGCAGGCGG - Intronic
1160002047 18:75033864-75033886 CAGGGAAAGGAGAAGGGAAGAGG - Intronic
1160975531 19:1790543-1790565 CAGTGGAGGGAGAAGGGGAGAGG - Intronic
1161533563 19:4804645-4804667 CACTGGAAGGCCAAGGCGGGAGG + Intergenic
1161585518 19:5103405-5103427 CAGGAAAATGAGAAAGCGGGCGG - Intronic
1162383808 19:10349007-10349029 CTTTGAAAGGCCAAGGCGGGCGG - Intergenic
1162745355 19:12794777-12794799 CTTTGAAAGGCCAAGGCGGGAGG - Intronic
1163845746 19:19637386-19637408 TCCTGGAAGGAGAAGGCGGGCGG + Exonic
1163880559 19:19917757-19917779 CATTGAAAGGCCAAGGCGGGTGG - Intronic
1164826872 19:31290382-31290404 CAGAGAGAGGAGATGGCAGGGGG + Intronic
1164849526 19:31470076-31470098 AAGATAAAGGAGAAGGCAGGTGG + Intergenic
1165439479 19:35816445-35816467 CAGTGAAAAGACAAAGAGGGAGG - Intergenic
1165944403 19:39433058-39433080 GAGTGGAAGCAGAAGGCAGGGGG - Intergenic
1166273306 19:41732472-41732494 AAGTGAAAGAGGAAGGCAGGAGG - Intronic
1166278376 19:41772297-41772319 AAGTGAAAGAGGAAGGCAGGAGG - Intergenic
1166347028 19:42172883-42172905 CAGTGAAAGGAAATGGCGCTGGG + Intronic
1166462848 19:43004566-43004588 AAGTGAAAGGGAAAGGCAGGAGG + Intronic
1166489949 19:43250091-43250113 GAGTGAAAGAGGAAGGCAGGAGG + Intronic
1167281654 19:48572752-48572774 CAGGGAGAGGAGAAGGCCTGAGG + Intronic
1167424307 19:49422173-49422195 GAATGAAAGGAGGGGGCGGGGGG + Intergenic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1167674706 19:50877149-50877171 CAGGGAAGGGGGAAGGAGGGCGG - Intronic
1168023265 19:53625294-53625316 CAGTGAGAGGCCGAGGCGGGAGG - Intergenic
1168058727 19:53878735-53878757 CACTGGGAGGACAAGGCGGGAGG + Intergenic
1168082110 19:54017718-54017740 AAGTAAAAGGAGGAGGAGGGAGG - Intergenic
1168701631 19:58443371-58443393 CAGTGAAAAGTGAAGCCGGCTGG - Intergenic
1168725001 19:58576196-58576218 GAGTGACAGGGAAAGGCGGGTGG - Intergenic
1202637199 1_KI270706v1_random:52803-52825 GAGTGAAAGGTGAGGGTGGGGGG - Intergenic
925096385 2:1207741-1207763 CGGTGAGAGGAGACGGGGGGCGG - Intronic
925229456 2:2220038-2220060 CAGTGAGTGGAGAAGAGGGGAGG + Intronic
927000569 2:18790533-18790555 GAGTGAAAGCTGAAGGCTGGAGG + Intergenic
927144919 2:20157272-20157294 CTTTGAAAGGAGCAGGAGGGAGG + Intergenic
928347078 2:30509805-30509827 CTTTGAAAGGCCAAGGCGGGTGG - Intronic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
930429945 2:51263135-51263157 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
930585155 2:53259663-53259685 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
931759325 2:65402587-65402609 GAGGGAAAGGAGAAGGGGGTAGG + Intronic
932003617 2:67906726-67906748 AAAGGAAAGGAGAAGGCTGGAGG + Intergenic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
932433104 2:71687042-71687064 CCGAGTAAGGAGAAGGCAGGGGG - Intergenic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
933982938 2:87568419-87568441 GAGGGAAAGGAGAAAGAGGGAGG - Intergenic
934039372 2:88115358-88115380 CAGTAAAAGAGGAAGGCAGGAGG - Intergenic
934557566 2:95295518-95295540 CAGTGAAAGGAGGATGGGGCTGG + Intergenic
934606861 2:95701968-95701990 TACTGAAAGGAGCAGGCAGGTGG - Intergenic
934882302 2:97995258-97995280 CAGTGACAGGAGACGGGGGAAGG + Intronic
935785534 2:106545202-106545224 CAGTGAAAGGAGACGGTGGCAGG - Intergenic
936152664 2:110030177-110030199 CAGGGAGGGGAGCAGGCGGGAGG + Intergenic
936192016 2:110341235-110341257 CAGGGAGGGGAGCAGGCGGGAGG - Intergenic
936310903 2:111382376-111382398 GAGGGAAAGGAGAAAGAGGGAGG + Intergenic
937110583 2:119364063-119364085 CAGAGATAGGAGAAAGGGGGAGG + Intronic
937344613 2:121117265-121117287 CTTTGAAAGGCCAAGGCGGGTGG - Intergenic
937749587 2:125458867-125458889 CATTGGGAGGTGAAGGCGGGTGG + Intergenic
937797085 2:126036447-126036469 AAGGAAAAGGAGAAGGCAGGGGG - Intergenic
937993994 2:127679608-127679630 TAGGGAAGGGAGAAGGTGGGGGG - Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
939121924 2:138127429-138127451 CAGTGAAAGCAGTAGCCGGCTGG + Intergenic
939428250 2:142069055-142069077 CAGAGAAGGGAGAAGGGTGGAGG - Intronic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
942455621 2:176136574-176136596 CTGGGAAAGCAGAATGCGGGGGG - Intergenic
942737108 2:179126937-179126959 CAATGAAAATGGAAGGCGGGGGG - Intronic
944237151 2:197450896-197450918 CAGTGAGAGGTGAAGCCGGCTGG + Intergenic
944485608 2:200201966-200201988 CAGTGAAAGGAGATAGGGGTGGG + Intergenic
944718911 2:202403439-202403461 CTTTGGAAGGAGAAGGCAGGAGG - Intronic
944811790 2:203334182-203334204 CTGTGGAAGGCCAAGGCGGGTGG - Intronic
944818918 2:203409137-203409159 CAGTGAAAAGAGAAGGTAGTTGG - Intronic
944822007 2:203440879-203440901 CAGGGATAGGAGGAGGTGGGGGG + Exonic
944855935 2:203766779-203766801 CTTTGAAAGGCCAAGGCGGGTGG + Intergenic
945006862 2:205417741-205417763 CAGTGAAAGGTTAAGGGGGCTGG - Intronic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945735890 2:213599927-213599949 CTGTGAGAGGCCAAGGCGGGTGG - Intronic
946144427 2:217718339-217718361 CAGAGAGAGGAGAAGAAGGGAGG - Intronic
946254892 2:218435221-218435243 CAGTGAATGTAGTAGGAGGGTGG + Intronic
946367300 2:219256662-219256684 AAGTGAAAGAAGGAGGCAGGAGG + Intronic
946871207 2:224087454-224087476 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
946915460 2:224516046-224516068 GAATGAAAGGAGAAGGTTGGAGG - Intronic
947349638 2:229229775-229229797 CAGGAAAGGGAGAAGACGGGTGG - Intronic
947897071 2:233685274-233685296 CTTTGAAAGGCGGAGGCGGGCGG - Intronic
947985856 2:234446867-234446889 CGGTGGAAGGAGGAGGTGGGAGG - Intergenic
948307146 2:236956769-236956791 CTGTGAAAGGAAAAGGGAGGAGG - Intergenic
1169399318 20:5266319-5266341 CTTTGAGAGGATAAGGCGGGTGG + Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170940679 20:20845625-20845647 CAGGGAAAGGAGATGGGGAGAGG + Intergenic
1171132039 20:22662998-22663020 TGGTGAAAGGAGGAGGCGGGTGG - Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171840132 20:30199726-30199748 CATTGGAAGGCCAAGGCGGGGGG - Intergenic
1172367946 20:34363868-34363890 CAATGGAAGGAGGAGGCGAGTGG - Intronic
1172429224 20:34876357-34876379 GAGTGAAAGCAGAAGGGGCGGGG - Intronic
1173013977 20:39208548-39208570 CTTTGAAAGGCCAAGGCGGGTGG - Intergenic
1173289759 20:41704204-41704226 CAGTGAATGGAGAAGGGGATGGG - Intergenic
1173375422 20:42478203-42478225 GGGTGAAAGGAGAAGGGGGAAGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1173984711 20:47252048-47252070 CTGTGGAAGGCCAAGGCGGGAGG + Intronic
1174660562 20:52209252-52209274 CAGTTATAGGAGGAGGCTGGAGG + Intergenic
1175143654 20:56879738-56879760 CAGTGGGAGGCCAAGGCGGGTGG + Intergenic
1175642515 20:60642877-60642899 CAGGGAAAGAAGCAGGCAGGAGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175791418 20:61742438-61742460 CAGTAAAAGGTGAATGCGAGGGG + Intronic
1176685830 21:9847780-9847802 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1176781125 21:13196085-13196107 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1180679563 22:17615654-17615676 CTTTGAAAGGCCAAGGCGGGTGG + Intronic
1180685633 22:17664416-17664438 CTGTGAAAGGAGCCGGGGGGGGG - Intronic
1181097746 22:20517508-20517530 CAGTGAAAAGAGCAGGGTGGTGG - Intronic
1181136881 22:20773621-20773643 CAGTGAAAGGTGGAGGAGAGAGG - Intronic
1181237945 22:21459294-21459316 CTTTGAAAGGCCAAGGCGGGCGG - Intergenic
1181383969 22:22529882-22529904 CTTTGAAAGGCCAAGGCGGGCGG + Intergenic
1181526121 22:23489127-23489149 CATTGGAAGGCCAAGGCGGGCGG + Intergenic
1181550543 22:23636730-23636752 AAGGGAAAGGAGGAGGCAGGAGG + Intergenic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1181797736 22:25321962-25321984 AAGGGAAAGGAGGAGGCAGGAGG - Intergenic
1181947482 22:26529451-26529473 CAGGGAGGGGAGAAGGCAGGTGG - Intronic
1182204262 22:28607881-28607903 GAGTGAAAGCAGAAGCAGGGAGG - Intronic
1182998340 22:34834899-34834921 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1183066784 22:35368874-35368896 CAGTTACAGGAGGAGGTGGGAGG - Intergenic
1183320196 22:37160596-37160618 ACGTGAAAGGCCAAGGCGGGTGG + Intronic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1183742521 22:39676834-39676856 AAGGGAAGGGAGAAGGCAGGAGG - Intronic
1184300264 22:43554591-43554613 CAGGGAAGGGAGAAGGAGTGTGG + Intronic
1184951958 22:47849523-47849545 AAGGGAAGGGAGAAGGCAGGTGG + Intergenic
950311336 3:11960972-11960994 CAGAGAACGGAGGAGGCAGGAGG + Intergenic
950349983 3:12340274-12340296 CATTGAAATGAGAAGACGGAAGG - Intronic
951117943 3:18887165-18887187 CAGTCAAAGCAGAAGTTGGGGGG - Intergenic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
951781521 3:26368581-26368603 CAGTAAAAGGAGGAAGTGGGGGG + Intergenic
951844778 3:27073500-27073522 CCAGGAAAGGAGAAGGCAGGTGG + Intergenic
952015000 3:28945893-28945915 CACTGAAGGGAGGCGGCGGGGGG - Intergenic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952810941 3:37402014-37402036 CAGTGAGAGGAGCAGGTTGGGGG - Intronic
952895584 3:38076391-38076413 CAGTGAAGGGAGATGGGGTGGGG + Intronic
953500098 3:43424888-43424910 CAGTGAAAGAAGAAAGGGAGAGG + Intronic
954347906 3:50016090-50016112 CCGTGGGTGGAGAAGGCGGGTGG - Intronic
954593064 3:51800809-51800831 CACTGAGAGGTGAAGGAGGGAGG + Intergenic
954940906 3:54372313-54372335 CAGTGAAAGAAGAGGGTGGGTGG + Intronic
955253076 3:57304135-57304157 CAGTGAAGGGAGATGGGGTGGGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955976787 3:64487515-64487537 CAGTGAGAGGAGATGTCTGGGGG - Intergenic
956406399 3:68932618-68932640 CAGGGACAGGAGCAGCCGGGCGG - Intergenic
956828757 3:73024654-73024676 AAAGGAAAGGAGAAGGAGGGAGG - Intronic
957042303 3:75345305-75345327 TAGGGAAAGGAGGAGGCTGGTGG - Intergenic
959061177 3:101617908-101617930 CAGTGAAGGGAGAAGGTGCATGG - Intergenic
960119930 3:113937759-113937781 CTTTGAAAGGCCAAGGCGGGTGG + Intronic
961047031 3:123716155-123716177 TAGGGAAAGGAGGAGGCTGGTGG - Intronic
961058389 3:123808125-123808147 CAGTGAAGGGTGAAGGAGGCTGG - Intronic
961253239 3:125523978-125524000 CACTGAAAGGAGAAATGGGGTGG - Intergenic
961418684 3:126782005-126782027 CAGTCAGAGGAGTTGGCGGGTGG + Intronic
961894010 3:130152442-130152464 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
962106640 3:132396614-132396636 CAGTGAAAGGTGAAGCCGGCTGG + Intergenic
962561623 3:136612361-136612383 CATTGAGAGGACAAGGCGGAAGG + Intronic
962635262 3:137324928-137324950 CACTGAGAGGAAAAGGTGGGAGG - Intergenic
963692761 3:148525435-148525457 CAGTGAAAGGTGAAGCTGGCTGG + Intergenic
964846596 3:161051110-161051132 CAGTCTGAGGAGATGGCGGGTGG - Intronic
965070008 3:163907814-163907836 CAGTGAAAGGAGATAGGGGTGGG - Intergenic
965466944 3:169041403-169041425 CTGTGGAAGGCCAAGGCGGGTGG - Intergenic
965625213 3:170677952-170677974 CAGTGAAAGGAGACAGGGGTGGG + Intronic
965802859 3:172512418-172512440 CAGTGATGGGAGAAGGTGGCAGG - Intronic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
966275086 3:178155822-178155844 CACTGAAGGGAGAAAGCGGAGGG + Intergenic
966314759 3:178633119-178633141 CTGTGAAAGGAGCTGGCGGGGGG - Intronic
966490467 3:180522482-180522504 CAGAGAATGGGGAGGGCGGGAGG + Intergenic
967119491 3:186370362-186370384 CTTTGAAAGGCCAAGGCGGGAGG - Intergenic
967151800 3:186658051-186658073 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968648210 4:1750175-1750197 CAGAGAGAGGAGGGGGCGGGGGG + Intergenic
968651260 4:1761152-1761174 CAGTGACAGGAGATGGGGGCGGG - Intergenic
968678170 4:1896925-1896947 CTTTGAAAGGCCAAGGCGGGTGG + Intronic
969295642 4:6269538-6269560 CTGTTACAGGAGAAGGCGAGCGG + Intergenic
969436569 4:7192525-7192547 CAGAGAAAGGAGCCGGCGAGGGG - Exonic
969843878 4:9904435-9904457 AAGTGAAAGGGGGAGGCAGGAGG - Intronic
969920534 4:10535103-10535125 CTTTGAGAGGATAAGGCGGGCGG + Intronic
969983906 4:11187580-11187602 GAGGGAAAGGTCAAGGCGGGAGG + Intergenic
970095677 4:12460640-12460662 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
970351456 4:15205861-15205883 CATTGAAAGGAGAAGTTTGGGGG - Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971471147 4:27028408-27028430 CAATGAAAGGATGAAGCGGGTGG - Intergenic
972933607 4:44104624-44104646 CAGTGGAAGGAGAGTGTGGGTGG + Intergenic
973393605 4:49576262-49576284 GAGTGAAAGGTGAGGGTGGGGGG + Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974798720 4:66785851-66785873 CAGAGAATGGAGATGGCAGGAGG + Intergenic
975818115 4:78240948-78240970 CAGTTAAAGGAGTAAGTGGGAGG + Intronic
977535438 4:98251764-98251786 CTTTGAGAGGACAAGGCGGGTGG + Intergenic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
977907792 4:102498570-102498592 CAATGGAAGGCAAAGGCGGGTGG - Intergenic
979307328 4:119162265-119162287 GTGTGAAAGGAGAAAGCAGGCGG + Intronic
979621808 4:122806492-122806514 CAGTGAAATAAGAAGCAGGGGGG + Intergenic
979894687 4:126145287-126145309 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
980575172 4:134678038-134678060 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
980956109 4:139430819-139430841 CAGTGAGAGCAGAACCCGGGTGG + Intergenic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
981633109 4:146844622-146844644 CTGTGAGAGGCCAAGGCGGGTGG - Intronic
982013163 4:151126417-151126439 CAGTGCTAGAAGAAGGAGGGTGG - Intronic
982526402 4:156484543-156484565 CTTTGAAAGGCCAAGGCGGGCGG + Intergenic
983640664 4:169941597-169941619 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
984099362 4:175466784-175466806 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
984801634 4:183722133-183722155 CTCTGAGAGGACAAGGCGGGTGG + Intergenic
985078473 4:186242058-186242080 CAGTGAAGGGAGATGGGGTGGGG + Intronic
985436225 4:189931735-189931757 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1202764518 4_GL000008v2_random:138660-138682 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
985521952 5:377897-377919 CAGTGTCAGGAGCAGACGGGCGG - Intronic
985548791 5:523047-523069 CGGAGAAGGGAGGAGGCGGGAGG + Intronic
987511866 5:18849720-18849742 CAGGGAACGGACAAGGCCGGGGG + Intergenic
987853022 5:23381496-23381518 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
988839214 5:35066732-35066754 GAGTGAGAGGAGGAGGCAGGAGG - Intronic
989163325 5:38412041-38412063 CTTTGGAAGGCGAAGGCGGGCGG - Intronic
990140255 5:52694945-52694967 TAGTGAAAGGAGAAAGGGAGAGG - Intergenic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
992221320 5:74576590-74576612 CTTTGAAAGGCCAAGGCGGGAGG + Intergenic
992869298 5:80990425-80990447 CAGTGAAAGGAGTCGGGAGGGGG + Intronic
993027422 5:82662810-82662832 CAGTGGAAGGAGGAGGCCAGGGG + Intergenic
994085859 5:95758444-95758466 GAGTGAAAGGTGATGGCTGGTGG + Intronic
994126393 5:96172074-96172096 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
995296558 5:110531210-110531232 CAGTGAAGGGAGATGGGGTGGGG - Intronic
996357884 5:122616993-122617015 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
996832484 5:127755132-127755154 CAGTGAAGGGAAAAGGATGGAGG + Intergenic
997294567 5:132761625-132761647 CACTGAAAGCAGAGGGCCGGTGG + Exonic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
997679175 5:135737190-135737212 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
997788996 5:136739501-136739523 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
998120522 5:139572885-139572907 CATTGAAAGGCTTAGGCGGGTGG - Intronic
998359633 5:141573803-141573825 CAGGCAAAGGAGGAGGTGGGGGG + Exonic
998693976 5:144616592-144616614 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
999091361 5:148939089-148939111 GAGTTCAAGGAGGAGGCGGGAGG - Intronic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999690648 5:154143278-154143300 CAGTGTCAGGAGAAGGCTGTGGG - Intronic
1000095675 5:157968994-157969016 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1000550634 5:162658459-162658481 CAGTGGAGGGAGCAGGTGGGAGG + Intergenic
1001057866 5:168464352-168464374 CAGTGTACAGAGAGGGCGGGTGG + Intronic
1001140125 5:169137445-169137467 CATTGATAGGAGAAGACGAGGGG - Intronic
1001485165 5:172114862-172114884 CAGTGAAGGCCGAAGGTGGGGGG - Intronic
1001706091 5:173742017-173742039 CAGTGCAAGAAGCAGGTGGGAGG + Intergenic
1002775336 6:323591-323613 CAGTGCAAGGAGAGGACGCGGGG + Intronic
1004226163 6:13786034-13786056 CTGTGAGAGGCCAAGGCGGGTGG - Intergenic
1004574899 6:16886263-16886285 CAGTGAAGGGAGATGGGGGTGGG - Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005631597 6:27713276-27713298 CAGAGAAAAGTGAAGACGGGTGG + Intergenic
1006303684 6:33207166-33207188 CAGAGAAAGGAGAGGGGTGGGGG - Intergenic
1007135947 6:39522089-39522111 CAGTGAAGGGAAAAGGCTGAAGG - Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007752180 6:44077163-44077185 CAGGGAAGGGAGGAGGCGGTCGG + Intergenic
1008292612 6:49736329-49736351 CTGTGGAAGGAGTAGGCGGCTGG - Intronic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1008477115 6:51944303-51944325 CAGTGAAGGGAGATGGGGCGGGG - Intronic
1009355510 6:62739882-62739904 CATTGAAAGTAGATGGAGGGAGG + Intergenic
1009591161 6:65672867-65672889 CAGTGAAGGGAGATGGGGTGTGG + Intronic
1011698975 6:89937772-89937794 CTTTGAAAGGCCAAGGCGGGTGG - Intronic
1011829301 6:91351910-91351932 CACTGAAAGGAGAAGAAGTGAGG - Intergenic
1012013922 6:93830213-93830235 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013388358 6:109655864-109655886 CAGTGACAGGAGAGGTGGGGAGG + Intronic
1014066026 6:117126591-117126613 CAGTGAAAGGATATGGAGGCTGG + Intergenic
1014611801 6:123557132-123557154 CAGTGAAGGGAGATGGGGTGCGG - Intronic
1015788841 6:136945953-136945975 CAGTGAAATGAGAACGTGGGTGG - Intergenic
1016125526 6:140397822-140397844 CAGTGAAAGGGCAAGGCTGCAGG + Intergenic
1016183538 6:141175290-141175312 CATTGAAAGGTGAAGCCGGCTGG + Intergenic
1016536075 6:145108558-145108580 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1017110602 6:150928785-150928807 CTTTGGAAGGAGGAGGCGGGCGG - Intronic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1017894471 6:158667384-158667406 CATTAACAGGAGAAGTCGGGAGG + Intronic
1018078114 6:160234199-160234221 CAGTGAAAGGAGATAGGGTGGGG - Intronic
1018268968 6:162055582-162055604 CACAGAAAGGAGGAGGAGGGAGG + Intronic
1019410963 7:906640-906662 AAGGGAAAGGAGAAAGGGGGCGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020015554 7:4829365-4829387 CAGTGAAAGTGGAAGGCGTTCGG + Intronic
1020204825 7:6105662-6105684 AAGGGAGAGGAGAAGCCGGGTGG + Intronic
1020632511 7:10656617-10656639 CAGAGAACTAAGAAGGCGGGTGG + Intergenic
1021146885 7:17099944-17099966 CTTTGAAAGGCCAAGGCGGGTGG + Intergenic
1022045628 7:26620167-26620189 CACTGAAAGGAGAATGAGTGAGG - Intergenic
1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG + Exonic
1022626483 7:32042054-32042076 CTTTGAAAGGCCAAGGCGGGTGG + Intronic
1022912786 7:34916469-34916491 CAGTGAAAGTAGAAGGACAGTGG + Intergenic
1025186228 7:56861675-56861697 CATTGAAAGGCCAAGGCGGGTGG + Intergenic
1025252780 7:57363023-57363045 CAGTGACAGGACAAGGGCGGCGG + Intergenic
1025685694 7:63715234-63715256 CATTGAAAGGCCAAGGCGGGTGG - Intergenic
1026582839 7:71632423-71632445 CAAAGAAAGGAGAAGGCAGTAGG + Intronic
1026778598 7:73248070-73248092 CTTTGAAAGGTGGAGGCGGGCGG + Intergenic
1026978659 7:74514088-74514110 CTGTGAAAGGGGAGGACGGGTGG + Intronic
1027035951 7:74925422-74925444 AAGTGAAAGGCCAAGGTGGGCGG - Intergenic
1027397180 7:77767849-77767871 GAATGAAAGGAGAGGGAGGGGGG - Intronic
1027776368 7:82470379-82470401 CTTTGAGAGGTGAAGGCGGGTGG - Intergenic
1028399037 7:90404668-90404690 CGGTGAAAGGATAAGGAAGGTGG - Intronic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029884951 7:103858958-103858980 CAGAGAAAGAAGAAGACTGGAGG + Intronic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1030950900 7:115789908-115789930 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1031217796 7:118919895-118919917 CACTGAAAGGAGTAGGAGGTTGG + Intergenic
1031421938 7:121563749-121563771 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1031777926 7:125923989-125924011 CAGTGAAGGGAGAAAGGGGTGGG - Intergenic
1031846006 7:126806672-126806694 CAGTGACAGGTGAAGCCGGCTGG - Intronic
1032162325 7:129520462-129520484 CTTTGCAAGGACAAGGCGGGTGG - Intergenic
1032479757 7:132236854-132236876 GAGAGAAAGGAGAAGGCTGGGGG - Intronic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1032938419 7:136760858-136760880 CAGTGGAAGGTGAAGGGGAGTGG - Intergenic
1033378744 7:140791236-140791258 CAGTAAGAGGAGAAGGCAGCAGG - Intronic
1033909823 7:146248915-146248937 CAGTGAAGGGAGAAAGGGGTGGG + Intronic
1034054982 7:148024829-148024851 CAAAGAAAGGAGAAGGCAGGGGG - Intronic
1034904752 7:154934260-154934282 CCGTGAAAGCAGCTGGCGGGGGG - Intronic
1035163637 7:156969899-156969921 GGGTGAGAGGAGAAGGAGGGAGG + Exonic
1035598438 8:880163-880185 CAGTGGAGGGAGAAGGGGCGGGG - Intergenic
1036403012 8:8427085-8427107 CATTGAGAGGCTAAGGCGGGTGG + Intergenic
1036640439 8:10580104-10580126 CAGGGAAAGGGGGAGGCAGGTGG + Intergenic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038310545 8:26443118-26443140 CACTGAAAGGAGAAAGGGGGAGG + Intronic
1038711087 8:29946437-29946459 TAGGGAGAGGAGAAGGAGGGAGG - Intergenic
1038765624 8:30425198-30425220 GAGTGAGAGGCCAAGGCGGGAGG - Intronic
1039704586 8:39993764-39993786 CACTGAGAGGAAGAGGCGGGTGG + Intronic
1039889172 8:41672712-41672734 CAGTGACCAGAGAAGGCGTGAGG + Exonic
1041803589 8:61825619-61825641 CAGAGAAAGGACAAGGCATGGGG - Intergenic
1042006171 8:64182682-64182704 CAGTGGGAGGAGGAAGCGGGTGG - Intergenic
1042281477 8:67061344-67061366 CTTTGGAAGGCGAAGGCGGGAGG + Intronic
1042719517 8:71812276-71812298 GAGAGAAAGGAGAAGGCTGAAGG - Intergenic
1042732459 8:71952153-71952175 CAGTGAAAGGATAAGCTGGATGG - Intronic
1042874627 8:73429678-73429700 CTTTGAAAGGCCAAGGCGGGAGG - Intronic
1043263855 8:78237575-78237597 TTTTGAAAGGAGAAGGCAGGAGG + Intergenic
1043342978 8:79263948-79263970 CTGAGGAAGGAGAACGCGGGAGG + Intergenic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1044302872 8:90606264-90606286 CAGTGAGAGGTGAAGCCGGCCGG - Intergenic
1044457058 8:92401261-92401283 CATTGAAAGGTGAAGCCGGCTGG - Intergenic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1045250439 8:100479214-100479236 CTTTGAAAGGCCAAGGCGGGTGG - Intergenic
1046955037 8:120054029-120054051 CAGTGAAAAGACGAAGCGGGCGG - Intergenic
1048410643 8:134168841-134168863 CAGTTGAAGGATAAGGAGGGTGG + Intergenic
1048764568 8:137830268-137830290 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1048822231 8:138391119-138391141 CAGGGAAGGGAGCAGTCGGGTGG - Intronic
1049239581 8:141530419-141530441 CTGTGAAAGGAAGAGACGGGTGG - Intergenic
1049292493 8:141812001-141812023 AAGAGAAAGGAGATGGCAGGAGG + Intergenic
1049397704 8:142409276-142409298 GAGTGAAAAGAGAAGGAGAGAGG + Intergenic
1050083328 9:1938528-1938550 GAGTGAAAAGAGAAGACAGGAGG + Intergenic
1051211744 9:14752282-14752304 AAGTGAAAGGATTAGGAGGGAGG + Intronic
1051345183 9:16144971-16144993 CAGTGAAAGGAGGAGGCTGATGG - Intergenic
1051350302 9:16192474-16192496 AAGAGATAGGAGAAGGAGGGAGG - Intergenic
1051428835 9:16961551-16961573 CTTTGAAAGGCCAAGGCGGGAGG - Intergenic
1052869517 9:33490095-33490117 CATTGAGAGGCCAAGGCGGGAGG - Intergenic
1053263860 9:36696078-36696100 CAGGGACAGGAGAAGGGGTGAGG - Intergenic
1053330912 9:37206347-37206369 GCGGGAAAGGTGAAGGCGGGAGG - Intronic
1054807776 9:69410007-69410029 CAGCGAAAGGAGATGGGGTGGGG + Intergenic
1055051568 9:71986799-71986821 CACTGACAGGAGAAGGGGTGAGG - Intergenic
1055174350 9:73299220-73299242 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1056554455 9:87677158-87677180 CAATAAATGGAGAAGGAGGGAGG - Intronic
1056963501 9:91147039-91147061 CAGTCAAGAGAGGAGGCGGGAGG - Intergenic
1057307005 9:93918307-93918329 CATTGAGGGGAGGAGGCGGGTGG - Intergenic
1057350298 9:94291293-94291315 CTTTGAGAGGACAAGGCGGGTGG - Intronic
1058871556 9:109206424-109206446 CATTGGAAGGCCAAGGCGGGTGG - Intronic
1058890358 9:109355863-109355885 CTTTGGAAGGACAAGGCGGGCGG - Intergenic
1058944258 9:109841765-109841787 GAGAGAAAGGAGAGGGTGGGGGG + Intronic
1059448692 9:114356494-114356516 AAGGGAAGGGAGAAGGCGGAGGG - Intronic
1059542505 9:115144330-115144352 AAGGGAAAGGAGAAGGGGAGGGG - Intronic
1060673322 9:125489962-125489984 AAGGGAAAGGAGAAGGCACGTGG - Intronic
1060835353 9:126751563-126751585 CTGTGAAAGGAGAAAGGAGGAGG - Intergenic
1060997781 9:127884899-127884921 CAGTGAATGCAGAAGGGGTGAGG - Intergenic
1061286016 9:129623088-129623110 CTTTGAGAGGACAAGGCGGGTGG + Intronic
1061531986 9:131221601-131221623 AAGTGAAAGGAGAGGACTGGAGG - Intronic
1061652859 9:132065365-132065387 CAGGGAAAGGAGAAGAGCGGCGG + Intronic
1061759446 9:132840059-132840081 CTGTGGAAGGCCAAGGCGGGTGG - Intronic
1061879111 9:133559830-133559852 GAGTGAAGGGAGAAGGCATGGGG - Intronic
1062239128 9:135526470-135526492 CAGGGCAGGGGGAAGGCGGGGGG - Exonic
1062283454 9:135762198-135762220 CTTTGAAAGGCCAAGGCGGGAGG + Intronic
1062338871 9:136084703-136084725 CAGTCAAAGGAAATGGCGGCGGG + Intronic
1203545267 Un_KI270743v1:123547-123569 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
1185449515 X:275082-275104 CAGTGAAGGGAGGAGGGAGGAGG + Intergenic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187882869 X:23862838-23862860 AAGGGAAGGGAGAAGGAGGGAGG + Intronic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188078217 X:25805705-25805727 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1188422336 X:30005288-30005310 TAGTGAAAGATGAAGGGGGGAGG - Intergenic
1188470809 X:30537118-30537140 CTTTGAAAGGCCAAGGCGGGTGG + Intergenic
1189969752 X:46406127-46406149 CTGTGAGAGGCCAAGGCGGGTGG + Intergenic
1190853335 X:54267884-54267906 CAGTGAAAAGAGCAGGCTTGGGG + Intronic
1192232729 X:69277275-69277297 CAGTGTAAGGAGAAGAGGAGAGG + Intergenic
1193115733 X:77773508-77773530 CTTTGAAAGGCCAAGGCGGGCGG + Intronic
1194035360 X:88864072-88864094 CAGTGAGAGGTGAAGCCGGCTGG + Intergenic
1195666634 X:107437342-107437364 CAGAGAAAGCACAAGGCAGGAGG - Intergenic
1195703816 X:107724225-107724247 CAGTGGCAGGAGGAGGCAGGGGG + Intronic
1197169698 X:123418199-123418221 CATTGAAAGGAGAAGGTAGGAGG - Intronic
1197446038 X:126552885-126552907 CAGTGGGAGGAGCAGGCGGTCGG + Intergenic
1197628107 X:128826285-128826307 CTTTGAAAGGCCAAGGCGGGAGG + Intergenic
1198470342 X:136940349-136940371 CTTTGAAAGGCCAAGGCGGGTGG - Intergenic
1198520667 X:137449246-137449268 CAGTGAAAGGAAAAGGGAGAAGG - Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1198984002 X:142428651-142428673 CAGTGAAGGGAGATGGGGTGTGG + Intergenic
1198997411 X:142589666-142589688 CATTGAAAGGAGAATGCAAGTGG + Intergenic
1199378331 X:147138317-147138339 CAGTGAAGGGAGATGGGGTGGGG - Intergenic
1199556383 X:149113931-149113953 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1200152008 X:153955774-153955796 CAGGGCAAGGGGAAGGCAGGAGG + Intronic
1200942641 Y:8801665-8801687 CAGTGAAAGGAGATAGGGGTGGG - Intergenic
1200956894 Y:8958383-8958405 CTGTGAAAGGCTGAGGCGGGCGG + Intergenic
1201234517 Y:11896411-11896433 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1201473782 Y:14359738-14359760 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1201597859 Y:15692316-15692338 CAGTGAAGGGAGATGGGGTGGGG + Intergenic
1201864760 Y:18637886-18637908 CAGTTATAGGAGAAGGCTGGAGG - Intergenic
1201868562 Y:18682492-18682514 CAGTTATAGGAGAAGGCTGGAGG + Intergenic
1202075928 Y:21037934-21037956 CAGTGAAGGGAGATGGGGTGGGG - Intergenic