ID: 1101414774

View in Genome Browser
Species Human (GRCh38)
Location 12:104499507-104499529
Sequence CTTGCTGAGGCCAAGGTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 265}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101414774_1101414780 0 Left 1101414774 12:104499507-104499529 CCTATAACCTTGGCCTCAGCAAG 0: 1
1: 0
2: 0
3: 14
4: 265
Right 1101414780 12:104499530-104499552 AAAACATTAAAGGGGAGACCTGG 0: 1
1: 0
2: 3
3: 20
4: 479
1101414774_1101414778 -9 Left 1101414774 12:104499507-104499529 CCTATAACCTTGGCCTCAGCAAG 0: 1
1: 0
2: 0
3: 14
4: 265
Right 1101414778 12:104499521-104499543 CTCAGCAAGAAAACATTAAAGGG 0: 1
1: 0
2: 2
3: 32
4: 408
1101414774_1101414779 -8 Left 1101414774 12:104499507-104499529 CCTATAACCTTGGCCTCAGCAAG 0: 1
1: 0
2: 0
3: 14
4: 265
Right 1101414779 12:104499522-104499544 TCAGCAAGAAAACATTAAAGGGG 0: 1
1: 0
2: 1
3: 41
4: 613
1101414774_1101414777 -10 Left 1101414774 12:104499507-104499529 CCTATAACCTTGGCCTCAGCAAG 0: 1
1: 0
2: 0
3: 14
4: 265
Right 1101414777 12:104499520-104499542 CCTCAGCAAGAAAACATTAAAGG 0: 1
1: 0
2: 1
3: 17
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101414774 Original CRISPR CTTGCTGAGGCCAAGGTTAT AGG (reversed) Intronic
900537319 1:3185336-3185358 CCTGCTGAGGTCATGGATATCGG - Intronic
900860848 1:5229042-5229064 CTTTGGGAGGCCAAGGTGATTGG + Intergenic
901009059 1:6188444-6188466 CTTTGTGAGGCCAAGGTGAGAGG + Intronic
903414247 1:23170708-23170730 CTTACGGAGGCCAAGGTGAGTGG - Intronic
903430062 1:23289948-23289970 CTTTCTGAGGCCAAGGTGAGAGG - Intergenic
903449805 1:23445244-23445266 CTTTGTGAGGCCAAGGTGAGAGG + Intronic
904524667 1:31123980-31124002 CTTTCGGAGGCCAAGGTGAACGG - Intergenic
904657838 1:32062675-32062697 CTGGCTGTTGCCAAGGTGATGGG + Intergenic
906733037 1:48099591-48099613 CTTGTTGAGGTCAAGGTGAAGGG - Intergenic
907039266 1:51243680-51243702 CTTACGGAGGCCAAGGTGAGTGG - Intronic
907446844 1:54513642-54513664 CTTTCTGCAGCCAAGGATATGGG - Intergenic
917100845 1:171443544-171443566 CTTTGGGAGGCCAAGGTAATAGG + Intergenic
917657967 1:177145899-177145921 ATTGCAGAGGCCAAGATTTTTGG - Intronic
918062424 1:181073559-181073581 CTTTCGGAGGCCAAGGTGAGAGG - Intergenic
920411045 1:205761178-205761200 CTTTGGGAGGCCAAGGTTAGAGG + Intergenic
923281671 1:232448991-232449013 CATTCTGAGGCCAAGTTTAGAGG - Intronic
924283388 1:242460894-242460916 CTTTGTGAGGCCAAGGTGAGTGG + Intronic
924528175 1:244870427-244870449 CTTGGGGAGGCCAAGGTGAGTGG + Intergenic
924584766 1:245352505-245352527 CTTGGCGAGGCCAAGGTTGATGG - Intronic
1062787579 10:278253-278275 CGTGCGGAGGCCAAGGGCATGGG + Intronic
1063670351 10:8095149-8095171 CTTGCGGAGGCCAAGGTGGGAGG + Intergenic
1064084342 10:12334016-12334038 CTTGAGGAGGCCGAGGTTCTAGG - Intergenic
1064171593 10:13038558-13038580 CTTGCTGAGGCTTAGCTTAGAGG + Intronic
1065383319 10:25111246-25111268 CTTTCGGAGGCCAAGGTATTTGG + Intergenic
1066634731 10:37489408-37489430 CTTGAGGAGGCCGAGGTTCTAGG - Intergenic
1072497687 10:95978613-95978635 CTTTGTGAGGCCAAGGTGAAAGG - Intronic
1074054509 10:109910299-109910321 CTTCGTGAGGCCAAGGCTAGTGG + Intronic
1074394954 10:113089859-113089881 CTTCCTGGGGCCAAGTTTAATGG - Intronic
1077704899 11:4475408-4475430 ATTGCTGTGGCCATGTTTATTGG + Intergenic
1078029163 11:7731268-7731290 CTTTGTGAGGCCAAGGTGAGTGG - Intergenic
1078931483 11:15915350-15915372 CTTGCTTTGGCCAATGGTATGGG - Intergenic
1078932982 11:15927397-15927419 ATTCCTGAGGCCATGGTGATTGG - Intergenic
1079091069 11:17480642-17480664 CTTTCAGAGGCCAAGGTTAGGGG - Intergenic
1079360006 11:19762545-19762567 GTTGCTGAGGCCAAGGCTCATGG - Intronic
1080287716 11:30635578-30635600 CTTGCTGAGTCGAAGCTGATTGG - Intergenic
1080545324 11:33311421-33311443 CTTTGGGAGGCCAAGGTTAAAGG - Intronic
1080693814 11:34583608-34583630 CTTGTTGACCCAAAGGTTATAGG + Intergenic
1084747716 11:71183842-71183864 GCTGATGAGGCCAAGTTTATTGG + Intronic
1087312675 11:96568008-96568030 CTTGTTGATGCCTAGGTTGTGGG + Intergenic
1088331872 11:108662990-108663012 CTTTCTGAGGCCAAGGTGGGAGG - Intergenic
1088639401 11:111856861-111856883 CTTTGTGAGGCCAAGGTGAGCGG + Intronic
1088691618 11:112333256-112333278 CTTGCTGTGGTCATGGCTATGGG + Intergenic
1089604520 11:119634213-119634235 CTTCCTCAGGCCAGGGTTGTTGG - Intronic
1092015978 12:5158847-5158869 CATGCTGAGGCCAAAATTGTAGG - Intergenic
1092048622 12:5451934-5451956 CTTTGGGAGGCCAAGGTGATAGG - Intronic
1092148374 12:6230412-6230434 CTGGCAGAGGCCAAGGGAATTGG - Intronic
1093069045 12:14689268-14689290 CTTGCTCAGGCCAAAAATATTGG - Intronic
1096470978 12:51875465-51875487 CTTGCTGAGGCTGGGGTGATTGG + Intergenic
1098552967 12:71784846-71784868 CTTTATGAGGCCAAGGCCATAGG + Intronic
1099245169 12:80185530-80185552 CTTTCGGAGGCCAAGGTGAGTGG - Intergenic
1099316734 12:81093204-81093226 CTTTGTGAGGCCAAGGTAAGCGG + Intronic
1099596591 12:84673942-84673964 CTTGGGGAGGCCAAGGTGAGAGG + Intergenic
1100551856 12:95653385-95653407 CTTGGTGAGGCCAAGGTGGGCGG - Intergenic
1100667103 12:96767084-96767106 CTTGCTGTGGCCAATGGGATGGG - Intronic
1101319248 12:103658784-103658806 CTTGCTGGGGACATGGTGATGGG + Intronic
1101414774 12:104499507-104499529 CTTGCTGAGGCCAAGGTTATAGG - Intronic
1101646780 12:106638249-106638271 CTTTCGGAGGCCAAGGTGAGTGG - Intronic
1102023384 12:109699321-109699343 CTTTCGGAGGCCAAGGTTGGAGG - Intergenic
1102127758 12:110499236-110499258 CCTGCTGATGACAAAGTTATGGG + Intronic
1103474639 12:121209841-121209863 CTTGCGGAGGCCGAGGTGAGAGG - Intronic
1103877464 12:124139714-124139736 CTTTGGGAGGCCAAGGTTAGTGG - Intronic
1103982140 12:124743420-124743442 CTGGATGAGGCCATGGTTCTGGG - Intergenic
1104840945 12:131825334-131825356 CTGGCTGTGGCCAAGGGCATGGG - Intergenic
1105916881 13:24925218-24925240 CTTTCAGAGGCCAAGGTGAGAGG - Intergenic
1108510430 13:51150939-51150961 CTTGCTGTGGCCAATTTTTTTGG - Intergenic
1111129542 13:83956774-83956796 CTTGATGAAGCCAAGTTTATGGG + Intergenic
1112282093 13:98072179-98072201 CTTTGGGAGGCCAAGGTTAGTGG + Intergenic
1113223757 13:108135882-108135904 CTTTCTGAGAACAAGGTCATAGG - Intergenic
1115417131 14:33148928-33148950 CTTGGGGAGGCCAAGGTGAGAGG - Intronic
1119207783 14:72807594-72807616 CTTGGGGAGGCCAAGGCTAGAGG + Intronic
1119689910 14:76663463-76663485 CTTGGGGAGGCCAAGGTGGTTGG + Intergenic
1119813387 14:77543294-77543316 CTTTCTGAGGCCAAGGTGGGCGG - Intronic
1122205810 14:100147436-100147458 CTGGCTGAGGCCAAGGTTGGCGG - Intronic
1122217200 14:100212395-100212417 TCTGCAGAGGCCAAGGTGATGGG - Intergenic
1124155779 15:27224160-27224182 CTTGCTGAGGCCAGGGGTTTGGG + Intronic
1125464342 15:39935572-39935594 CTTTCAGAGGCCAAGGTGAGAGG - Intronic
1125572333 15:40730264-40730286 CTTTGGGAGGCCAAGGTGATAGG + Intronic
1126315974 15:47370269-47370291 CTTTCAGAGGCCGAGGTTAGTGG + Intronic
1126782957 15:52154105-52154127 CTTGCTAAGGACCAGGTTCTGGG + Intronic
1126900763 15:53312251-53312273 CTTGGGGAGGCCAAGGTGGTTGG - Intergenic
1127473090 15:59307971-59307993 CTTGGGGAGGCCAAGGTGAGCGG + Intronic
1130707128 15:86243763-86243785 CTTGGGGAGGCCAAGGTGAGTGG + Intronic
1131337770 15:91566217-91566239 TATCCTGAGGCCAAGGTTGTTGG + Intergenic
1131796652 15:96024583-96024605 CTTCCTGAGGCCATGGTTGCAGG - Intergenic
1132766972 16:1539306-1539328 CTTGCTGAGGCCCAAGGCATGGG - Intronic
1135000314 16:18771613-18771635 CTTTGTGAGGCCAAGGTGGTTGG - Intergenic
1135857843 16:26028593-26028615 CTTGCTGAGTGCAATGTGATGGG + Intronic
1136401894 16:30023834-30023856 CTGGCTGTGGCCCAGTTTATTGG + Exonic
1136403155 16:30029303-30029325 CTTGCTCAGGCCCAAGTTAAGGG + Intronic
1136625117 16:31457699-31457721 CTTTGGGAGGCCAAGGTTAGCGG - Intergenic
1137314657 16:47303871-47303893 CTTTCAGAGGCCAAGGTGAGAGG - Intronic
1137565616 16:49530917-49530939 CTTGCTGGGTCCCAGGTTTTAGG - Intronic
1138125509 16:54435368-54435390 TTTGCTCAACCCAAGGTTATTGG - Intergenic
1138359935 16:56419547-56419569 CTTTGGGAGGCCAAGGTTAGTGG + Intronic
1138448927 16:57081430-57081452 CTTCCTCAGGCCAAGGTCAGGGG - Intronic
1141182355 16:81762796-81762818 CTTGCTAATCCCAAGGTTTTGGG + Intronic
1142933711 17:3309982-3310004 TTTCCTGAGGCCAAAGTTCTGGG - Intergenic
1144802330 17:17938322-17938344 GTTGCTGAGGGCAAGGTCTTAGG - Intronic
1145845968 17:28039762-28039784 CTTGGTGAGGCCAAGGTACGTGG - Intergenic
1145969093 17:28945029-28945051 CTTTGTGAGGCCAAGGTGAGAGG + Intronic
1147800026 17:43078326-43078348 CTTTGTGAGGCCAAGGTTGGCGG - Intronic
1150245309 17:63670337-63670359 CTTGGTGAGGCCGAGGTGAGTGG + Intronic
1150775173 17:68075542-68075564 CTTGCAGAGGCCAAGGTGAGTGG + Intergenic
1151539513 17:74758024-74758046 CTGGCTGATGCCATGGTGATGGG - Intronic
1152848576 17:82617754-82617776 CTTCCTGAGGCCAGGATCATTGG - Intronic
1155226265 18:23732174-23732196 CTTGATGAGGTCAAGGTTGCTGG + Intronic
1155448209 18:25935103-25935125 CTTGCCGAGGCCAAGGTGGGTGG - Intergenic
1156047987 18:32898447-32898469 CTTTGGGAGGCCAAGGTTAGTGG + Intergenic
1157631007 18:49095593-49095615 CCTATTGAGGCCAAGGTCATGGG - Intronic
1157852422 18:51068673-51068695 CTTTCGGAGGCCAAGGTTGGAGG + Intronic
1158400419 18:57116715-57116737 CCAGCTGTGGCCAAGATTATGGG - Intergenic
1158488933 18:57892931-57892953 CTTTCGGAGGCCAAGGCTAGAGG - Intergenic
1158719473 18:59911271-59911293 CTTTCAGAGGCCAAGGTTGGGGG + Intergenic
1158723994 18:59951594-59951616 CTTGGGGAGGCCAAGGTGGTAGG - Intergenic
1160851787 19:1196200-1196222 CTTGCAGAGGCCCAGGTTCTAGG - Intronic
1160852211 19:1198014-1198036 CTTGCAGAGGCCCAGGTTCTAGG - Intronic
1161272296 19:3396710-3396732 CTTGCAGAGGCCAAGGTGGGTGG + Intronic
1161960096 19:7518365-7518387 CTTTCTGAGGCCAAGGCCAGAGG + Intronic
1163454996 19:17401362-17401384 CTTTGGGAGGCCAAGGTTGTTGG - Intergenic
1164132053 19:22372688-22372710 CTTTCGGAGGCCAAGGTGAGTGG + Intergenic
1164928691 19:32154152-32154174 CTTGCAGAGGCCAAGGTGGATGG - Intergenic
1165130880 19:33631191-33631213 CTTGCTGAGGCCAGAGCTCTTGG + Intronic
1165170534 19:33888794-33888816 CCTGCTGAGGCCAAGGCTCATGG - Intergenic
1167255304 19:48424170-48424192 CTTTGTGAGGCCAAGGTGAGAGG + Intronic
1167411365 19:49345919-49345941 CTTGGAGAGGCCAAGGTGAGCGG + Intronic
926154231 2:10442954-10442976 CTTGGGGAGGCCAAGGTGGTAGG - Intronic
927804527 2:26134358-26134380 CTTTCAGAGGCCAAGGTGAGAGG - Intronic
928105326 2:28467104-28467126 CTTTCAGAGGCCAAGGTGAGTGG + Intronic
928376965 2:30783280-30783302 CTTGCTGAGACCAGGGTTGTAGG + Intronic
928649147 2:33386579-33386601 CTTAGGGAGGCCAAGGTGATAGG + Intronic
930163863 2:48184398-48184420 CTTTAGGAGGCCAAGGTTAGAGG + Intergenic
931450298 2:62362634-62362656 CTGGCTGAGGGCCAGGTGATGGG + Intergenic
933663723 2:84947805-84947827 CTTTGTGAGGCCAAGGTGAGAGG - Intergenic
935760462 2:106315873-106315895 CCTGCTGAGGTCAGGGTCATAGG + Intergenic
936120058 2:109733607-109733629 CTTTGTGAGGCCAAGGTGGTTGG + Intergenic
936972401 2:118187930-118187952 CTGGCTGAGGCTAAGGTTGCTGG - Intergenic
937607794 2:123822838-123822860 CATGATGAGGTCAAGGCTATAGG - Intergenic
937754687 2:125522476-125522498 CTTGCAGAGGCCAAGGCAAGAGG + Intergenic
938659512 2:133471241-133471263 CGTGCTGAGGCCAAGATGACAGG - Intronic
939889571 2:147720644-147720666 ATTGCTGAGGACTAGGTTTTAGG - Intergenic
942540538 2:177010566-177010588 CTTGCTGAGGCCAGTGGCATGGG - Intergenic
945246836 2:207725712-207725734 CTTGCTGAGGCTAACCTTCTGGG - Intronic
945944368 2:215980684-215980706 CTTGGGGAGGCCAAGGTACTCGG + Intronic
946056548 2:216907523-216907545 CTTTGTGAGGCCAAGGTGAGAGG - Intergenic
946149660 2:217755693-217755715 CTTGCTGAGGCCAGGGCAACAGG + Intronic
947497348 2:230647552-230647574 CTTTCGGAGGCCAAGGTGAGTGG + Intergenic
947728034 2:232411989-232412011 CTTTCTGAGGCCAAGGCGAGCGG - Intergenic
948400930 2:237684841-237684863 CTTTGGGAGGCCAAGGTTAGTGG + Intronic
948441485 2:237993467-237993489 CTTTCAGAGGCCAAGGTGAGTGG + Intronic
948475702 2:238217694-238217716 CTTTGGGAGGCCAAGGTTAGTGG + Intergenic
949057007 2:241933115-241933137 CCTGCTGAGGCCAAGGCACTGGG - Intergenic
1169608860 20:7355855-7355877 CTTGCTAAGACCTAAGTTATTGG + Intergenic
1170639503 20:18138906-18138928 CTTGCTGAGAACAGGGTCATTGG + Intronic
1170745974 20:19099215-19099237 CTGGCTGAGGCCAAGGTAGATGG + Intergenic
1172369346 20:34375767-34375789 CTTTGGGAGGCCAAGGTGATAGG + Intronic
1172505747 20:35461247-35461269 CTTCCTCTGGCCCAGGTTATGGG + Intronic
1173727784 20:45309025-45309047 CATCCTGAGGACAAGGTTTTGGG + Intronic
1175420199 20:58827205-58827227 ATTGATGAAGCCAAGGTCATGGG + Intergenic
1176224839 20:63991027-63991049 CTTTGGGAGGCCAAGGTTAGGGG - Intronic
1177501521 21:21962908-21962930 CTTTCGGAGGCCAAGGTGAGCGG + Intergenic
1181318597 22:21987493-21987515 CTTTCAGAGGCCAAGGTGAGGGG + Intergenic
1182346254 22:29667627-29667649 CTTTCGGAGGCCAAGGTGAGAGG - Intronic
1182400545 22:30073287-30073309 CTTTGTGAGGCCAAGGTTGGTGG - Intergenic
1183849183 22:40569836-40569858 CAGGCTGAGGCCCAGGGTATAGG - Intronic
1184516917 22:44967927-44967949 CTTGATGAGGCTGGGGTTATGGG + Intronic
954340884 3:49952989-49953011 CTTTTTGAGGCCAAGGTCAGAGG - Intronic
954925611 3:54231760-54231782 CTTGTCAAGGCCAAGGTTATTGG + Intronic
955561261 3:60193586-60193608 CTTGTCAAGGCCATGGTTATAGG - Intronic
956063161 3:65369183-65369205 CTTGGTCAGGCCAAGGTTGGGGG - Intronic
957833614 3:85554957-85554979 CTTTGTGAGGCCAAGGTGAGAGG - Intronic
959805753 3:110551476-110551498 CTTCCAGAGGCCAATGTGATGGG + Intergenic
963312134 3:143720963-143720985 CTTGGGGAGGCCAAGGTAAGAGG + Intronic
963958072 3:151277145-151277167 CTTTGTGAGGCCAAGGTGAGTGG - Intronic
965919673 3:173896812-173896834 CTAGCTGAGGGAAAGGTGATTGG - Intronic
966788872 3:183646646-183646668 CTTCCTGAAGCCTAGGTGATAGG - Intronic
967385185 3:188904153-188904175 CTTGCTGTGGCCCAGGTACTTGG + Intergenic
967899870 3:194438691-194438713 CTTGGGGAGGCCAAGGTTGAGGG + Intronic
968442026 4:629004-629026 GTTCCTGAGCCCAAGGTTTTAGG - Intronic
968783988 4:2605050-2605072 CTTGGAGAGGCCAAGGTGGTAGG - Intronic
969380752 4:6795832-6795854 CTTGCGGAGGCCAAGGCAAGCGG - Intronic
970903227 4:21184574-21184596 ATTAATGAGGCCAAGGTGATAGG + Intronic
970998413 4:22294453-22294475 TCTGATGAGGCCAAGGTTATAGG + Intergenic
971708453 4:30079085-30079107 CTTGCAGATCCCAAAGTTATGGG + Intergenic
971757016 4:30719277-30719299 CTTGGTTAGGACATGGTTATCGG - Intergenic
971797240 4:31243862-31243884 CTTTGGGAGGCCAAGGTTAGTGG + Intergenic
972842960 4:42953160-42953182 CTTGCTGTGGCCATTGTTTTTGG - Intronic
973207215 4:47574444-47574466 CTTTCTGAGACCATGGTTCTTGG + Intronic
975777101 4:77799182-77799204 CTTTCGGAGGCCAAGGTGAGAGG + Intronic
975990367 4:80253564-80253586 CTCTCTGAGGCAGAGGTTATTGG + Intergenic
980175520 4:129339679-129339701 ATAGCTGAGGATAAGGTTATTGG + Intergenic
981499952 4:145439303-145439325 CTTGCAGAGGCCAGAGTTGTGGG - Intergenic
981923013 4:150107617-150107639 CTTTCAGAGGCCAAGGTAAGTGG - Intronic
984075039 4:175166332-175166354 CTGGCTGAGGCGAAGATTAAGGG + Intergenic
984232306 4:177114031-177114053 GTTGCTGATGACAAGGTTAATGG - Intergenic
984601828 4:181736665-181736687 CTAGTTGAGGCCAGGATTATTGG - Intergenic
987339423 5:16926456-16926478 CTTCCGGAGGCCAAGGCTAGTGG + Intronic
992493849 5:77272120-77272142 CCTGCTTAGGGTAAGGTTATTGG + Intronic
992951529 5:81862820-81862842 TTTGCTGACACCAAGGGTATTGG - Intergenic
993061398 5:83043033-83043055 CTTGAGGAGGCCAAGGCCATGGG - Intergenic
993266705 5:85734799-85734821 CTTTAGGAGGCCAAGGTTGTTGG + Intergenic
993903770 5:93602091-93602113 CATGCTGAGACCAATTTTATTGG + Intergenic
994499208 5:100553480-100553502 TTTGCTCAGTCCAAAGTTATAGG - Intronic
995094726 5:108222392-108222414 GATGTTCAGGCCAAGGTTATAGG + Intronic
995717793 5:115097309-115097331 CTTTCTGAGGCCAAGGTGGGTGG - Intergenic
998039927 5:138945459-138945481 CTGGATGAGGCCAAGGTCAAGGG - Intergenic
998844247 5:146291044-146291066 CTTTGGGAGGCCAAGGTTAGAGG - Intronic
1000810612 5:165857046-165857068 CTTGCTGTGGCCAAGGAAATAGG - Intergenic
1001599797 5:172921408-172921430 TTTGCTGAGGCCGAGGCTACAGG + Intronic
1006746271 6:36345026-36345048 CTTTGTGAGGCCAAGGTGAGCGG - Intergenic
1009949434 6:70378878-70378900 CTAGTGGAGGCCAAGGTCATGGG - Intergenic
1010462207 6:76126341-76126363 CTTACTGTGGGCAAGGTGATAGG + Intergenic
1010958396 6:82117767-82117789 ATTGTTGAAGCCAAGGTTGTGGG + Intergenic
1013661353 6:112300013-112300035 CTTGGTTAGGCAAAGGTGATAGG - Intergenic
1015584471 6:134761193-134761215 CTTTCTGAGGCCAAGGTGGGTGG + Intergenic
1017492144 6:154954082-154954104 CTTTGGGAGGCCAAGGTTAGAGG + Intronic
1018941704 6:168312772-168312794 TTCCCTGAGGCCTAGGTTATGGG - Intronic
1021040062 7:15850509-15850531 GTTGCTGAGGCCAAAGCAATTGG - Intergenic
1026432424 7:70360425-70360447 CTTGCTTAGGCCGAGCTTAGTGG - Intronic
1026689514 7:72539874-72539896 CTTTGAGAGGCCAAGGTTAGAGG + Intergenic
1027649984 7:80854526-80854548 CTGGGTGAGACCAAGGTTTTTGG + Intronic
1027862067 7:83596890-83596912 CTTCCTAAGGGCAAGGTTTTAGG + Intronic
1027949098 7:84790101-84790123 CTTTCAGAGGCCAAGGTTGGTGG + Intergenic
1028344283 7:89760937-89760959 CTTGCTGATGCCTAGGTCCTGGG - Intergenic
1030540115 7:110819570-110819592 GTTGCTGAGGTCATGGTTTTTGG - Intronic
1035120114 7:156559807-156559829 CTTGCTGAGGCCAAGGCAGGAGG + Intergenic
1035228098 7:157444565-157444587 CGTGCTGAGGCCAAGGGGATGGG + Intergenic
1036627634 8:10484539-10484561 CTTGCTGAGGTCAAGCTAAGTGG + Intergenic
1038174921 8:25173034-25173056 CTTTGAGAGGCCAAGGTTAGGGG + Intergenic
1038354466 8:26814503-26814525 CTTTGGGAGGCCAAGGTGATAGG - Intronic
1038362253 8:26892495-26892517 CTTACTGGGAACAAGGTTATTGG - Intergenic
1038376427 8:27044637-27044659 CTTTGTGAGGCCAAGGTGAGTGG + Intergenic
1038802529 8:30762317-30762339 CTTGGGGAGGCCAAGGTGAGAGG - Intronic
1039451172 8:37676216-37676238 CTTTGGGAGGCCAAGGTTAGAGG - Intergenic
1039681749 8:39746268-39746290 CTTTCTGAGGCCAAGGCGAGTGG - Intronic
1039799133 8:40939017-40939039 CTTGTTGATGCCGAGGTTCTGGG + Intergenic
1040498548 8:47988053-47988075 CTTGCTGAGGCCAAAATCCTTGG - Intergenic
1042767127 8:72334827-72334849 CTTTCTGAGGCCAAGGTGGGTGG - Intergenic
1044452984 8:92359882-92359904 CTTTGGGAGGCCAAGGTTGTTGG + Intergenic
1044489111 8:92791401-92791423 CTTTGGGAGGCCAAGGTTAGTGG + Intergenic
1045650394 8:104336920-104336942 CTTTGTGAGGCCAAGGTAAGAGG - Intronic
1045816680 8:106284426-106284448 CTTGGTGAGGCTAAGGATTTTGG + Intronic
1047296321 8:123573480-123573502 TTTGCTGAAGCCAAGCTTAGAGG + Intergenic
1049633552 8:143673053-143673075 CTTGGGGAGGCCAAGGTTGGAGG + Intergenic
1052963773 9:34322608-34322630 CTTGGGGAGGCCAAGGTGGTTGG + Intronic
1053623164 9:39841576-39841598 CTTGCTCAGGCCAAACTTACAGG - Intergenic
1053881707 9:42601652-42601674 CTTGCTCAGGCCAAACTTACAGG + Intergenic
1053890961 9:42692640-42692662 CTTGCTCAGGCCAAACTTACAGG - Intergenic
1054146484 9:61565403-61565425 CTTTTGGAGGCCAAGGTTGTAGG - Intergenic
1054220738 9:62409119-62409141 CTTGCTCAGGCCAAACTTACAGG + Intergenic
1054229976 9:62500053-62500075 CTTGCTCAGGCCAAACTTACAGG - Intergenic
1054711928 9:68519815-68519837 CTTTCAGAGGCCAAGGTGGTAGG + Intronic
1054845960 9:69798715-69798737 TTTGCTGTGGCCAAGGTCAAAGG - Intergenic
1055625948 9:78177805-78177827 CTTGCGGAGACCAAGGTGAGTGG - Intergenic
1056329891 9:85512366-85512388 CATGCTGGGACCAAGGTTTTGGG - Intergenic
1059419824 9:114183927-114183949 CTGGCAGAGGGCAAGGTTGTTGG + Intronic
1059498531 9:114730853-114730875 CTGGCTGAGGCCCAGGCTGTTGG + Intergenic
1060703270 9:125778203-125778225 CTTGGGGAGGCCAAGGTAAGTGG - Intronic
1061646343 9:132005255-132005277 CATTTTGAGGCCAAGGGTATGGG - Intronic
1062258171 9:135641013-135641035 CTTTCTGAGGTCAAGGTTAGAGG + Intergenic
1062730143 9:138104074-138104096 CTGGCTGACTCCAAGGTTCTGGG + Intronic
1187179464 X:16929829-16929851 CTTGGGGAGGCCAAGGTGAGCGG - Intergenic
1187569692 X:20488368-20488390 CTTCGTTAAGCCAAGGTTATGGG + Intergenic
1187862647 X:23696985-23697007 CTTGGAGAGGCCAAGGTTGGTGG - Intergenic
1188652293 X:32646371-32646393 TTTGCTGAGGTCAAGGACATAGG + Intronic
1189339999 X:40197740-40197762 CTTGCGGAGGCCAAGGTAGGAGG - Intergenic
1189397300 X:40634312-40634334 CTTTCAGAGGCCAAGGTGAGAGG - Intronic
1189520985 X:41767730-41767752 CTTGCCTAGGTCAGGGTTATGGG + Intronic
1189895053 X:45646758-45646780 CTTTCTGATGCCTAGATTATTGG - Intergenic
1190087568 X:47409089-47409111 CTAGCAGAGGCCAAGGTTTGGGG - Intronic
1191182169 X:57575610-57575632 GTTGCTGTGGCTAAGGCTATAGG + Intergenic
1191215391 X:57927907-57927929 GTTGCTGTGGCTAAGGCTATAGG - Intergenic
1193540554 X:82766760-82766782 CTTGGGGAGGCCAAGGCTTTTGG - Intergenic
1194979246 X:100423418-100423440 CTTGGGGAGGCCAAGGTGAGAGG + Intergenic
1196842009 X:119867803-119867825 CTTCATGAGGCCAAGATTAGAGG - Intergenic
1197605203 X:128577433-128577455 GTTGCTGAAGCCTGGGTTATGGG - Intergenic
1198122353 X:133606665-133606687 CTTTGTGAGGCCAAGGTGAGAGG - Intronic
1199394277 X:147316399-147316421 CTTGGGGAGGCCAAGGTGAGTGG - Intergenic
1200082559 X:153585649-153585671 CTTTAGGAGGCCAAGGTTAGAGG + Intergenic
1200419261 Y:2946191-2946213 CTTTGGGAGGCCAAGGTGATTGG - Intronic
1201567001 Y:15375740-15375762 CTTGCTGATGCCCTGGTGATTGG + Intergenic