ID: 1101415051

View in Genome Browser
Species Human (GRCh38)
Location 12:104501583-104501605
Sequence GGGTGCTCAGAGTGTCGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101415051_1101415057 15 Left 1101415051 12:104501583-104501605 CCAAGCCGACACTCTGAGCACCC 0: 1
1: 0
2: 1
3: 6
4: 102
Right 1101415057 12:104501621-104501643 ATTATTAAATTCCATAATGCAGG 0: 1
1: 0
2: 2
3: 24
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101415051 Original CRISPR GGGTGCTCAGAGTGTCGGCT TGG (reversed) Intronic
900129206 1:1080474-1080496 GGCTGCTCAGAGGGTGGGCTGGG + Intergenic
900309679 1:2027705-2027727 GGGGGCTCAGACTGTCAGCCCGG + Intronic
900397230 1:2458092-2458114 GGGTGCCCACAGTGACGGCATGG - Intronic
900506484 1:3032027-3032049 GGGAGCTCAGGGAGCCGGCTGGG + Intergenic
902180738 1:14686627-14686649 GGGTGCCTAGAGTTTCTGCTAGG - Intronic
902700516 1:18168983-18169005 GGGGGCTCAGAGTGTCTGTCTGG + Intronic
902773822 1:18661665-18661687 AGGTGCTCAGAGTATGGGCCTGG + Intronic
903922785 1:26812893-26812915 GGGTGAACAGAGTGTCCTCTGGG - Intergenic
904497622 1:30895963-30895985 GGGTGGACAGACTGTGGGCTCGG - Intronic
906078216 1:43067609-43067631 GGGTGTCCAGAGTCTGGGCTTGG - Intergenic
906678320 1:47708927-47708949 TAGAGCTCAGAGGGTCGGCTGGG - Intergenic
907438001 1:54461929-54461951 GGGAGTTCAGAGTGGGGGCTGGG + Intergenic
912433148 1:109640325-109640347 GGGTGAGCAGAGTGTAGGCTGGG + Intergenic
920249738 1:204615620-204615642 GGGTGCTAGGAGTGTCTGCCAGG + Intergenic
924278629 1:242413176-242413198 GGCTGGTCAGAGTGTCAGCATGG - Intronic
1064018503 10:11791188-11791210 GAGTGATCAGAGTGCTGGCTGGG - Intergenic
1064646304 10:17463706-17463728 GGGTGCTCTGAGTATCAGCATGG - Intergenic
1065458459 10:25932495-25932517 TGGTTCTCAGAGTGTGGTCTAGG - Intergenic
1066455029 10:35565262-35565284 TGGTTCTCAGAGTGTGGGCCCGG + Intronic
1067569271 10:47359837-47359859 GGCTGCCCAGAGTGTGGCCTGGG - Intergenic
1069633548 10:69912128-69912150 GAGTGCTCAGGGTGGGGGCTGGG - Intronic
1070993841 10:80757437-80757459 TGGTTCTCAAAGTTTCGGCTGGG - Intergenic
1073325756 10:102643444-102643466 GGGCGCTGAGGGTGGCGGCTCGG + Intergenic
1082173738 11:49037611-49037633 GGGTGCTCAGACTTTCACCTCGG + Exonic
1084190294 11:67495585-67495607 GCGTCTGCAGAGTGTCGGCTGGG + Exonic
1085326805 11:75612578-75612600 GGCTGCTCAGGGTGCAGGCTGGG + Intronic
1096879085 12:54653004-54653026 TGGAGCTCATAGTCTCGGCTTGG + Intergenic
1100661879 12:96708324-96708346 TGGTGCTCAGAGTGAAGGATGGG - Intronic
1101415051 12:104501583-104501605 GGGTGCTCAGAGTGTCGGCTTGG - Intronic
1102062779 12:109946705-109946727 GTGTGCTCAGTGTGCCTGCTAGG - Intronic
1104727927 12:131089011-131089033 GGCTGCTCAGAGGGTGGTCTGGG - Intronic
1110563440 13:76934402-76934424 TGGTTCTCAGCGTGTCGTCTTGG + Intergenic
1120060357 14:79975536-79975558 GTGTGCTCAGAGTGGGAGCTCGG + Intergenic
1121398881 14:93654054-93654076 TGGGGCTTAGAGTTTCGGCTGGG - Intronic
1122445941 14:101768749-101768771 GGGTTCTCAAAGTGTGGTCTGGG - Intronic
1124252149 15:28113920-28113942 GGGTACTGAGAGTGGCGTCTTGG - Intronic
1129082205 15:73051810-73051832 GGGTGCGCAGTGGGTCGGCCCGG - Exonic
1129717843 15:77862413-77862435 GGGTGCTCAGAGCCCAGGCTGGG + Intergenic
1130303332 15:82696962-82696984 GGGTTATCAGAGTGTCATCTGGG - Intronic
1130460926 15:84157848-84157870 GGGTGCTCAGAGCCCAGGCTGGG - Intergenic
1132995915 16:2822362-2822384 GGGTGCTCAGAGCCTCACCTCGG - Intronic
1133868499 16:9666238-9666260 GGGTGCAAAGAGTGTGGGCTGGG + Intergenic
1140283642 16:73579308-73579330 GGGTGGTCAGAGTACCGTCTGGG - Intergenic
1141337728 16:83172942-83172964 GGGTGGGGAGAGTGTTGGCTTGG - Intronic
1141659027 16:85431712-85431734 GGGTGCTCAGAGTGCCAGACAGG - Intergenic
1142029969 16:87833617-87833639 CGGTGATCAGAGTGTGGGGTAGG + Intronic
1143941907 17:10551289-10551311 GGTTCCTCAGAGTGTTGACTGGG - Intergenic
1143977010 17:10837481-10837503 GGGTGCTCAGGAGGACGGCTGGG + Intronic
1146064191 17:29622343-29622365 GAGTGCTCAGTGTGTCCTCTAGG - Intronic
1156081615 18:33342540-33342562 TGCTGCTCAAAGTGTCAGCTTGG - Intronic
1160167231 18:76524938-76524960 GGGTACTCAGAGGGTTGGATAGG + Intergenic
1164854540 19:31511015-31511037 GGGTGCTCACAGCGTCAGGTGGG + Intergenic
1166962039 19:46502925-46502947 GGGTTCTCAAAGTGTGGTCTGGG + Intronic
925332876 2:3072283-3072305 GTGTGCTCAGTGTGTCCTCTGGG - Intergenic
927097347 2:19757575-19757597 GGGTACCCAGAGTGCCGGCTGGG - Intergenic
930052780 2:47229352-47229374 GGGTGATCAGAAAGTCTGCTGGG + Intergenic
937870104 2:126780533-126780555 GGGTGCTCAGACTGAAGGCTGGG - Intergenic
944267129 2:197740766-197740788 GGGTGCACAGAGTTTCAACTTGG + Intronic
948907017 2:240984431-240984453 GTGGGCCCAGAGTGACGGCTGGG - Intronic
1170695057 20:18650473-18650495 GGGTGCTCAGCGTGCAGGCCAGG - Intronic
1171275645 20:23854964-23854986 AGGTGCTCAGAGTGGTGACTGGG - Intergenic
1173906991 20:46636734-46636756 GGGAGCACAGAATGTGGGCTCGG - Intronic
1173924350 20:46769724-46769746 TGCTGCTCAGAGTGTGGCCTAGG + Intergenic
1175136247 20:56826439-56826461 GGGAGCTCAGAGTGTATTCTTGG + Intergenic
1175237119 20:57522495-57522517 GGGTGCTCAGAGAGGTGGATGGG - Intronic
1181898424 22:26131688-26131710 GTGTGCTCAGAATGGAGGCTGGG + Intergenic
1182571215 22:31239783-31239805 GGGTGCTCAGAGTGTTTGCTGGG + Intronic
1183608602 22:38882417-38882439 GGGTGCTCAGCATGGTGGCTGGG + Intergenic
1183724172 22:39579218-39579240 GAGTGCTCAGAGAGTCTGATGGG - Intronic
950200179 3:11036982-11037004 GGGGGGTGAGAGTGTCGGGTCGG - Exonic
960973315 3:123154427-123154449 GGCTGCTCACAGTCTGGGCTGGG + Intronic
961319161 3:126061034-126061056 GGGTCCACAGAGTGTGGGCAGGG + Intronic
961573251 3:127815700-127815722 TGGTGAGCAGAGTGTGGGCTGGG - Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
968526161 4:1058578-1058600 GGCTTCTCAGAGTGTCGTGTTGG - Intronic
969059469 4:4423697-4423719 GGGGGCACACTGTGTCGGCTGGG + Intronic
969296732 4:6274674-6274696 GGGTGCTTAGGGTCTAGGCTGGG + Intronic
969515060 4:7642729-7642751 GGGTGCCCAGAGGCTCTGCTGGG + Intronic
985783246 5:1881641-1881663 GGGTTCTGAGGGTCTCGGCTGGG + Intronic
991510150 5:67367100-67367122 GGCTGCTTTGAGTGTTGGCTTGG - Intergenic
998166537 5:139847524-139847546 GGGTGCTGAGAGTGACAGCTGGG - Intronic
1006935852 6:37717121-37717143 GGGAGATCATAGTGTCGGTTGGG - Intergenic
1010616398 6:78017705-78017727 GGGTGCACAGAGGGTGGGATTGG + Intergenic
1019738988 7:2663537-2663559 GGGGGCTCAGAATGTCAGCCAGG - Exonic
1019888445 7:3925599-3925621 GGGTGCTCAGAGGGCAGCCTTGG + Intronic
1020208895 7:6142931-6142953 GGCTGCTCAGAGTGTCAACAAGG + Exonic
1020998687 7:15299382-15299404 AGGTGTTCAGAGAGTCTGCTCGG - Intronic
1023087383 7:36584989-36585011 GGATGCTCAGAGTCTGGGCATGG + Intronic
1027708793 7:81570700-81570722 GGGAGCACAGAGTGCAGGCTAGG + Intergenic
1028273783 7:88825427-88825449 GGGGTCTCAGAGTGTCTGATTGG - Intronic
1029520634 7:101059511-101059533 AGGTGCTCAGAGTGTCCAGTAGG - Intergenic
1032027857 7:128457530-128457552 CGGTGCTCAGCTTGTCTGCTAGG - Exonic
1049442573 8:142616068-142616090 GGGGGCTCAGAGGGTTGGCAGGG - Intergenic
1051481967 9:17571229-17571251 GTGTGCTCACAGTGTATGCTCGG + Intergenic
1060784464 9:126439250-126439272 GGGAGCTCACAGGGTCCGCTGGG + Intronic
1060784478 9:126439290-126439312 GGGAGCTCACAGGGTCTGCTGGG + Intronic
1061295032 9:129672314-129672336 GTGTGCTCTGCATGTCGGCTGGG + Intronic
1061880811 9:133568026-133568048 GGGTGCCCTGAGCGTGGGCTCGG - Intronic
1062210404 9:135360520-135360542 GGGTGCTCTGAGAGGTGGCTTGG - Intergenic
1062214691 9:135382896-135382918 GGGTGCTGAGAGCCTAGGCTGGG - Intergenic
1062320641 9:135989111-135989133 CGGAGCTCAGAGACTCGGCTGGG + Intergenic
1062536398 9:137022911-137022933 GGGTGCTCCGAGGGGCGGGTGGG + Intronic
1062663698 9:137654837-137654859 GGGTGGTCAGAGTTTGGGCCAGG + Intronic
1186394641 X:9195553-9195575 GGGTGCTCAGAGTGCCTGGGGGG - Intergenic
1186616069 X:11189339-11189361 AGGTGTTCAGAGTGTGGGTTGGG + Intronic
1193560982 X:83015164-83015186 GGGTGCTGTGAATGTCAGCTCGG - Intergenic
1195520164 X:105821398-105821420 GGGTGCGCAGAATGCCGTCTGGG + Intergenic
1198967617 X:142244401-142244423 GGATGTCCAGAGTGTTGGCTTGG - Intergenic
1202378328 Y:24257332-24257354 GGGTGCTCAGAGCCCAGGCTGGG + Intergenic
1202492454 Y:25412789-25412811 GGGTGCTCAGAGCCCAGGCTGGG - Intergenic