ID: 1101419169

View in Genome Browser
Species Human (GRCh38)
Location 12:104535207-104535229
Sequence CTCTATGAGAATATCAAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 184}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101419169_1101419183 26 Left 1101419169 12:104535207-104535229 CCGTCCTTGATATTCTCATAGAG 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1101419183 12:104535256-104535278 GTGGAAGGAATGGGAATGGTAGG 0: 1
1: 0
2: 7
3: 46
4: 617
1101419169_1101419175 4 Left 1101419169 12:104535207-104535229 CCGTCCTTGATATTCTCATAGAG 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1101419175 12:104535234-104535256 CCTCGTCCTCCTGGATTTCAGGG 0: 1
1: 0
2: 2
3: 34
4: 532
1101419169_1101419181 17 Left 1101419169 12:104535207-104535229 CCGTCCTTGATATTCTCATAGAG 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1101419181 12:104535247-104535269 GATTTCAGGGTGGAAGGAATGGG 0: 1
1: 0
2: 1
3: 37
4: 316
1101419169_1101419180 16 Left 1101419169 12:104535207-104535229 CCGTCCTTGATATTCTCATAGAG 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1101419180 12:104535246-104535268 GGATTTCAGGGTGGAAGGAATGG 0: 1
1: 0
2: 9
3: 38
4: 493
1101419169_1101419176 7 Left 1101419169 12:104535207-104535229 CCGTCCTTGATATTCTCATAGAG 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1101419176 12:104535237-104535259 CGTCCTCCTGGATTTCAGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 167
1101419169_1101419171 -5 Left 1101419169 12:104535207-104535229 CCGTCCTTGATATTCTCATAGAG 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1101419171 12:104535225-104535247 TAGAGATGCCCTCGTCCTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 139
1101419169_1101419182 22 Left 1101419169 12:104535207-104535229 CCGTCCTTGATATTCTCATAGAG 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1101419182 12:104535252-104535274 CAGGGTGGAAGGAATGGGAATGG 0: 1
1: 1
2: 11
3: 129
4: 1084
1101419169_1101419173 3 Left 1101419169 12:104535207-104535229 CCGTCCTTGATATTCTCATAGAG 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1101419173 12:104535233-104535255 CCCTCGTCCTCCTGGATTTCAGG 0: 1
1: 0
2: 0
3: 18
4: 293
1101419169_1101419178 11 Left 1101419169 12:104535207-104535229 CCGTCCTTGATATTCTCATAGAG 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1101419178 12:104535241-104535263 CTCCTGGATTTCAGGGTGGAAGG 0: 1
1: 0
2: 6
3: 74
4: 756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101419169 Original CRISPR CTCTATGAGAATATCAAGGA CGG (reversed) Intronic
905755764 1:40507940-40507962 TTCTATGACAATATGAAGGCCGG - Intergenic
907604184 1:55799994-55800016 CCCTATCAAAATATCAATGACGG - Intergenic
907980390 1:59474589-59474611 CACTAGAAGAATGTCAAGGAGGG + Intronic
909856192 1:80535187-80535209 CTCTAAGAGAAGATCTAAGAAGG - Intergenic
910485278 1:87706289-87706311 TTCTATGAAAATAGCAAGGATGG - Intergenic
911846453 1:102758177-102758199 CTCTAGGAGAATTTAAATGAAGG - Intergenic
913380309 1:118203120-118203142 ATGTATGGGAATATCAAAGAAGG - Intergenic
918231521 1:182537681-182537703 ATCTAGTAGAATACCAAGGAAGG - Intronic
918309496 1:183275582-183275604 CTCTCTGAGCATAGCTAGGATGG + Intronic
920847929 1:209609023-209609045 CTTTTCGAGAAGATCAAGGAGGG + Exonic
921530144 1:216272042-216272064 CTCTTTCAGAAAACCAAGGAAGG - Intronic
922678413 1:227568467-227568489 TTCTTTGAGAACATAAAGGATGG + Intronic
1064202563 10:13297343-13297365 TTGTATGAGAATATTTAGGAAGG + Intronic
1065434366 10:25692111-25692133 CTCTATCAAAGTAGCAAGGATGG + Intergenic
1065728082 10:28685473-28685495 TTCTATGACAATATTAAGCAAGG - Intergenic
1065910511 10:30299702-30299724 GTCTCTGAGAAGATCAGGGAAGG - Intergenic
1068721935 10:60255297-60255319 CTCTATTAATATGTCAAGGAAGG + Intronic
1068756067 10:60654813-60654835 CTCTTTGAGAAAATAGAGGAAGG - Intronic
1070339809 10:75487593-75487615 CTGTAAGAGAATAGGAAGGAGGG - Intronic
1070389599 10:75957928-75957950 CTCTTTGGGGATATCCAGGAGGG + Intronic
1072841564 10:98780060-98780082 CTCTATGACAATAAAATGGAGGG + Intronic
1073567007 10:104543538-104543560 CCCTCTGAGCATATCAAGCAGGG + Intergenic
1075395058 10:122121082-122121104 CTCTATGTGAATATCAACTGGGG - Intronic
1079730141 11:23930277-23930299 ATTTATGTGAATAACAAGGATGG + Intergenic
1080320738 11:31006354-31006376 CTCTATGGGAATCTATAGGAAGG - Intronic
1081973364 11:47215086-47215108 CTCTATGCGAAGATCATGGAGGG - Exonic
1082310191 11:50636520-50636542 ACCTATGTGAATATCAAGGCAGG - Intergenic
1082934032 11:58638230-58638252 TTCTATGGGAAAATGAAGGAGGG - Intergenic
1084710826 11:70842869-70842891 ATCTGTGAGAATAACACGGACGG + Intronic
1085565616 11:77510816-77510838 CTTTATGAGAATACTAAGGAGGG + Intergenic
1086030921 11:82354328-82354350 CTGTAGGAGACAATCAAGGATGG + Intergenic
1086046987 11:82544633-82544655 CTATATGAGAAATGCAAGGATGG + Intergenic
1087541152 11:99522030-99522052 TTCTATGAGAATGTCAACCATGG + Intronic
1088651789 11:111963920-111963942 CTCTTTGACAATATAAAGCATGG + Intronic
1095948767 12:47769354-47769376 CTCTCTGAGAATACCTTGGAAGG + Intronic
1099711841 12:86236638-86236660 CCATATGTGAATATCATGGATGG + Intronic
1100389293 12:94133612-94133634 CTTTATGAGAAGAACAGGGATGG + Intergenic
1101419169 12:104535207-104535229 CTCTATGAGAATATCAAGGACGG - Intronic
1101522467 12:105496659-105496681 CTCTATGAAAATCTAAAGGCAGG - Intergenic
1101646629 12:106636511-106636533 GACTAAGAGAGTATCAAGGAAGG + Intronic
1104019945 12:124985434-124985456 CTCTATGAAAAAATTAAGGTTGG + Intronic
1104341456 12:127953669-127953691 CTGTATGATAATATAATGGAGGG + Intergenic
1104419441 12:128622885-128622907 CTCTAAGAGAATTTTAAGGATGG + Intronic
1105979677 13:25505842-25505864 GTATAGGAGAATATAAAGGAAGG - Intronic
1106771853 13:32969056-32969078 CTCAATCAGAATATCTAGGGTGG - Intergenic
1108041374 13:46342274-46342296 CTGTCTGAGAAAATCAAGGTAGG + Exonic
1110244572 13:73307548-73307570 CTCTATGAGAAGCACAAAGATGG + Intergenic
1111792988 13:92882251-92882273 CTCTTTGAGAATTTCCTGGATGG + Intergenic
1112009226 13:95280001-95280023 CCCTGTGAGAATCTTAAGGATGG - Intronic
1112542821 13:100333935-100333957 CTCTAGAAGAAAATCAAAGATGG + Intronic
1113061500 13:106326917-106326939 CTCTTTGAGCACATCAAAGACGG + Intergenic
1113216553 13:108047804-108047826 CTATATAAGACTACCAAGGAGGG + Intergenic
1118130181 14:62954303-62954325 CTGTATGATAACATAAAGGAAGG - Intronic
1118526978 14:66656135-66656157 CTCTATCAGAAAATCAAAGGAGG - Intronic
1118556728 14:67031948-67031970 CTCTATGAGGATATGAGGGTTGG - Intronic
1120615526 14:86699327-86699349 CTCTTAGAGAATGTCAAGAAGGG - Intergenic
1128784933 15:70387981-70388003 CTAAATGAGAATATTGAGGAAGG + Intergenic
1129022932 15:72539817-72539839 CTCTATATGAATATTGAGGAGGG + Intronic
1129387613 15:75204350-75204372 CTCTAAGACAAGACCAAGGAAGG - Intronic
1130997563 15:88912448-88912470 TTCTATGAGAAAATGATGGAGGG + Intronic
1132389960 15:101431350-101431372 CTCTATGCCATCATCAAGGATGG + Exonic
1134264971 16:12684934-12684956 CCCTTTGATAATATCAACGAAGG - Intronic
1134781867 16:16905531-16905553 AGCTATGGGAATATCAAGGAGGG - Intergenic
1136527164 16:30838974-30838996 CTCTATGACAATAGCCAGGGTGG + Intronic
1138365076 16:56468852-56468874 CTCTATGAGAAAGACAAGGCAGG - Intronic
1138978703 16:62240596-62240618 CTTTGTGAGAATACAAAGGAAGG - Intergenic
1143905669 17:10207344-10207366 CTGGATGAGAAAATCAAGGAAGG - Intergenic
1146232873 17:31129723-31129745 CTCTATAAGAATTTCATGGCCGG - Intronic
1148464116 17:47854698-47854720 CACTATGAGAATATCAAAGCTGG + Intronic
1150254285 17:63731562-63731584 TTCTATAAGAATATCAGGGCCGG - Intronic
1150515979 17:65809688-65809710 ATCTATTAGAATTTCAAGGAAGG + Intronic
1156310539 18:35918390-35918412 CTCTATCAGAATGTCATTGAGGG - Intergenic
1156904990 18:42341744-42341766 CTCTTTGAAAATAACAAGGCAGG - Intergenic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1159495195 18:69193801-69193823 CTCTATGATACTATAATGGAGGG + Intergenic
1159639790 18:70850081-70850103 CTCTGTGAGATTACCAAGAAAGG - Intergenic
1160082272 18:75739625-75739647 CTCTAGGATAATACCTAGGAGGG - Intergenic
1160328691 18:77972729-77972751 CTCTACTAGAATATCACTGAAGG - Intergenic
1161108192 19:2455007-2455029 CCCCAAGAGAATATGAAGGAAGG - Intronic
1164050225 19:21579655-21579677 CCCTATGGGAAGATCAAGGCAGG + Intergenic
1168453745 19:56487825-56487847 CCCAGTGAGAAGATCAAGGATGG - Intergenic
926555162 2:14349194-14349216 GTGTATTAGAATATCCAGGAGGG + Intergenic
927998466 2:27503458-27503480 GTCTATGAGGATCTCAAAGAAGG - Intronic
932334454 2:70922147-70922169 TTCTTTGACAATCTCAAGGAAGG - Intronic
933839061 2:86271635-86271657 CTCTATCAGAAAAACAAGGTAGG + Intronic
934572450 2:95381665-95381687 CTCTACGACATTAACAAGGATGG + Exonic
934760417 2:96852654-96852676 CTCCAGGAGAAAATCAAAGAAGG + Intronic
935060290 2:99601369-99601391 CTCTATGAGGATAGCAAGTCCGG - Intronic
935221651 2:101020561-101020583 GTCAATGAGAAGGTCAAGGAGGG + Intronic
939729506 2:145764680-145764702 CTGTAAGAGAAGATGAAGGAGGG - Intergenic
940917570 2:159274003-159274025 CCCCATGAAAATGTCAAGGAAGG + Intronic
941016461 2:160362988-160363010 TTCTAGCAGAATTTCAAGGATGG + Intronic
941496357 2:166209449-166209471 CACAATGAGGATATCAATGAAGG + Intronic
942906836 2:181193031-181193053 CCCTCTGGGAAAATCAAGGATGG + Intergenic
943199593 2:184803376-184803398 TGCTATGTGAATATAAAGGAAGG - Intronic
946520392 2:220458136-220458158 CTCCATGAGTAAATAAAGGAAGG - Intergenic
946684896 2:222257892-222257914 CTCTGTGAGAACATCCAGGCAGG + Intronic
947079989 2:226385396-226385418 CTCAATGAAAAGGTCAAGGAAGG - Intergenic
947911005 2:233800863-233800885 TACCATGAGAACATCAAGGAGGG + Intronic
1169586146 20:7087663-7087685 CTCTAAGAGAATTTCAAGTTAGG - Intergenic
1170144349 20:13155969-13155991 CTCTGTGATAATGTTAAGGAGGG + Intronic
1171436110 20:25125873-25125895 CTCTATGTGAATCACAGGGAAGG + Intergenic
1172485127 20:35293222-35293244 CTGGATGAGAATTTCCAGGAGGG - Intergenic
1176939087 21:14902114-14902136 CTCTATGCGTATATTAAGCAAGG - Intergenic
1177306394 21:19322665-19322687 TTCTTTGAGTATATCAAAGATGG + Intergenic
1178055547 21:28794571-28794593 ATATTTGAGAATTTCAAGGAAGG + Intergenic
1178400691 21:32282457-32282479 CACTTTGGGAATATAAAGGAAGG + Intergenic
1178752294 21:35316447-35316469 CTGTATGGGATAATCAAGGAAGG + Intronic
1184109213 22:42385156-42385178 GTCTATGAAAATCTCTAGGATGG - Exonic
949852679 3:8434677-8434699 CTCTAGAAAAATGTCAAGGAAGG - Intergenic
951147240 3:19242374-19242396 CTTTATGAGAATATGATAGAGGG + Intronic
952424498 3:33161073-33161095 CTCTATGAAAATGTCATAGATGG + Intronic
952542484 3:34380954-34380976 CTCTATGCAAATATCTAGAAAGG + Intergenic
955070487 3:55568687-55568709 CTCTGTGAGAATAAACAGGATGG - Intronic
957309962 3:78507010-78507032 CTCTCAGAGAATATAAAGGCTGG - Intergenic
958109886 3:89128877-89128899 ATCTATGAGAATAACAATGGGGG - Intronic
958891233 3:99785465-99785487 CTTTAGGAGAATAACAATGATGG + Intronic
959440849 3:106373750-106373772 ATCTATGAGCATATCAAGTCAGG + Intergenic
960978930 3:123203169-123203191 CTCTGTGAGACACTCAAGGAAGG - Intronic
961041633 3:123682474-123682496 CTCCATGAGAGCATCAAAGAAGG + Intronic
966193522 3:177292196-177292218 GTCTATGATACTATCTAGGATGG - Intergenic
967473056 3:189885340-189885362 CTCTATGAGTGTCTCAAAGATGG + Intronic
971120249 4:23696515-23696537 CTCTATGACAGTATCAACCAAGG + Intergenic
971504609 4:27352690-27352712 CTCTTGGAGAATATTAAGCATGG + Intergenic
971616601 4:28798470-28798492 CTTTATTATGATATCAAGGAAGG + Intergenic
972845825 4:42987981-42988003 CCCAATGAGAAGAGCAAGGAGGG - Intronic
973134362 4:46688245-46688267 ATCTATGAAAATATTAAGGTAGG + Intergenic
978866383 4:113517573-113517595 CTCTATCAGCAGATCAAGGCTGG - Exonic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981780604 4:148425407-148425429 TTCAATAAGAAGATCAAGGAAGG + Intronic
981909165 4:149958129-149958151 TTCTAGGAAAATTTCAAGGAGGG - Intergenic
984487536 4:180390100-180390122 CTCTATAATAAAATCAAGGCCGG - Intergenic
985430958 4:189879750-189879772 ATCTATGACAATATCAACGTTGG + Intergenic
985617213 5:930395-930417 CTCTATGAGAACATCAGCCAAGG - Intergenic
986865064 5:11976632-11976654 CTCTATGAGAACAGCCTGGAAGG + Intergenic
987858241 5:23449333-23449355 CTCTATGAGAACTTTAATGAAGG - Intergenic
989191276 5:38671984-38672006 CTCTATGATAACATCCTGGAGGG + Intergenic
990086943 5:51990263-51990285 CTCAATGAGAATGTAAAGAAAGG - Intergenic
990738698 5:58890808-58890830 CTCCATCAGAATAGCAAGTAGGG - Intergenic
991443034 5:66671250-66671272 CTCTAGGACATTATCGAGGATGG + Intronic
991897900 5:71424677-71424699 CTGTAAGAGAGTATAAAGGAAGG - Intergenic
992871426 5:81009184-81009206 CTCGATGAGAAAATGCAGGATGG + Intronic
994644806 5:102455047-102455069 ATCTATGAAAACATTAAGGAGGG + Intronic
994770313 5:103973421-103973443 CTCTAATAGAACATCTAGGATGG + Intergenic
994874336 5:105396810-105396832 CACTATAAACATATCAAGGAAGG - Intergenic
995903981 5:117101215-117101237 CTCTATGAGCAACTCATGGATGG + Intergenic
996041976 5:118824535-118824557 CTATATCATAATATCAAGTATGG - Intergenic
998298267 5:140992865-140992887 CTTGTTTAGAATATCAAGGAGGG - Intronic
998842784 5:146273776-146273798 CTATATGAGAAAATGATGGATGG + Intronic
999411351 5:151352706-151352728 CACTATGGGAATATCAGGGAAGG - Intergenic
1000258082 5:159559902-159559924 ATCTATGACTGTATCAAGGATGG + Intergenic
1001763818 5:174229185-174229207 CACTCTGATAAAATCAAGGAGGG + Intronic
1002563105 5:180095977-180095999 CTGTATGAAAATATAAACGAAGG - Intergenic
1003511821 6:6787799-6787821 CTCCTTGAGATAATCAAGGAGGG + Intergenic
1004704343 6:18109869-18109891 TTCTATCAGAAAATAAAGGAGGG + Intergenic
1005111153 6:22283476-22283498 CTCTAAGAGAAAATCAAAAAGGG - Intergenic
1008371175 6:50732614-50732636 GTCTATGAAAATATCAACAATGG - Intronic
1009409852 6:63353394-63353416 ATCTGTGAGCATATCCAGGAAGG - Intergenic
1009879335 6:69545662-69545684 CTCTACAATAATCTCAAGGAGGG + Intergenic
1010673394 6:78713501-78713523 CTCTTTGTGAAAAACAAGGAAGG + Intergenic
1012605044 6:101147671-101147693 CAGTATTAAAATATCAAGGAAGG + Intergenic
1014830211 6:126094482-126094504 CTCTATGGCAAGATCAAGAATGG - Intergenic
1018309012 6:162489237-162489259 CTCTATGAAACAATCAAGGATGG + Intronic
1019168210 6:170113039-170113061 TCATGTGAGAATATCAAGGAGGG - Intergenic
1020472976 7:8560591-8560613 CCCTAAGGGAAAATCAAGGAAGG + Intronic
1022891814 7:34708835-34708857 TCCTATGTGAATATCAGGGAGGG - Intronic
1024464015 7:49690208-49690230 CTTTATGATAATTTCAGGGATGG + Intergenic
1025761746 7:64402239-64402261 TTCTAACAGAATATTAAGGATGG + Intergenic
1027485814 7:78760614-78760636 CTCCATAAGATTGTCAAGGAAGG - Intronic
1029974386 7:104819002-104819024 CTTTATGAGAATATAAATCATGG + Intronic
1031136336 7:117888262-117888284 ATCTTTGAGAATATAAAGGCAGG - Intergenic
1032350178 7:131155053-131155075 CTCTATAAGAACATCAAAAAGGG - Intronic
1033068650 7:138181005-138181027 CTCTTTGAGGATATCAATTACGG - Intergenic
1034879437 7:154752083-154752105 CTATATGAGAAAAACAAAGATGG - Intronic
1035630071 8:1100600-1100622 CTCTATAAGAAAATGAAGGTAGG + Intergenic
1039359303 8:36858153-36858175 GTCTAAGACAATTTCAAGGATGG + Intronic
1039409525 8:37340961-37340983 CTCTAGGAGAGAATCAAGGGTGG + Intergenic
1040025507 8:42778337-42778359 ACCTATGTGAATATCAAGGCAGG - Intronic
1041949386 8:63484197-63484219 CTATTTCAAAATATCAAGGAAGG - Intergenic
1045651221 8:104343122-104343144 CTCTATGATCATGTCAAAGAGGG + Intronic
1046967794 8:120186584-120186606 CATTAGGAAAATATCAAGGAAGG + Intronic
1047881540 8:129199875-129199897 TACTATGAGAATATGAAAGAAGG + Intergenic
1051560429 9:18435489-18435511 TACTATGAGAATATATAGGAGGG + Intergenic
1052711896 9:32067415-32067437 CTCTTTGAGAAGATTAAGCATGG + Intergenic
1058478366 9:105364534-105364556 GCCTAGGAAAATATCAAGGAAGG - Exonic
1059782271 9:117542456-117542478 GTCTCTGAGAAGGTCAAGGAAGG - Intergenic
1059926447 9:119214156-119214178 CTGTGTGAGAATAGCAAGAAGGG + Intronic
1060965486 9:127710327-127710349 TTTCATGAGAGTATCAAGGAAGG + Intronic
1062330025 9:136036280-136036302 CACTGTGAGAGAATCAAGGACGG + Intronic
1185528480 X:798392-798414 TTCGAGGAAAATATCAAGGAAGG - Intergenic
1187243239 X:17531888-17531910 CACTATGAGGATAAGAAGGAGGG - Intronic
1188502202 X:30839760-30839782 CTCTTTGAGAAAATACAGGAGGG - Intronic
1189497900 X:41526163-41526185 ATCTATGAGCATAGGAAGGAAGG - Intronic
1190725247 X:53185957-53185979 CTCTGTGAGGAAAGCAAGGAGGG - Intergenic
1194305213 X:92236893-92236915 CTCACTGAGACTATCAATGAGGG + Intronic
1196211215 X:112997765-112997787 CTATATGAGAATGTGAAGGAGGG + Intergenic
1197612383 X:128653813-128653835 CTCTGTTTAAATATCAAGGAAGG + Intergenic