ID: 1101419354

View in Genome Browser
Species Human (GRCh38)
Location 12:104536996-104537018
Sequence GAAGCATTCTAGAAGCTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101419349_1101419354 0 Left 1101419349 12:104536973-104536995 CCTAATAACTTTAGCTCCCAGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1101419354 12:104536996-104537018 GAAGCATTCTAGAAGCTGTTAGG 0: 1
1: 0
2: 2
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101419354 Original CRISPR GAAGCATTCTAGAAGCTGTT AGG Intronic
902353413 1:15877046-15877068 GAAGATTTGTAAAAGCTGTTTGG + Intronic
904836744 1:33342566-33342588 GAAGCGTTCAAGCAGCTGTTTGG - Intronic
905337175 1:37253076-37253098 GAAGCATGCTAGGGGCAGTTGGG - Intergenic
908469266 1:64426930-64426952 GAAGCAATCTAGTTGGTGTTTGG - Intergenic
912043768 1:105426760-105426782 GAAACATTCTAGAAGTTTTAAGG + Intergenic
912975776 1:114328903-114328925 TAAGTATTCTAGATGCTGCTGGG - Intergenic
913718162 1:121560522-121560544 GAAGCATACTGGAAGCTGCAAGG - Intergenic
914673373 1:149888828-149888850 GAAGTATTCTGTAAGCAGTTAGG - Intronic
917235693 1:172889283-172889305 AAAGCATTCTAGAAGTGGTGTGG - Intergenic
918158319 1:181872545-181872567 GAAACATACTTGATGCTGTTGGG + Intergenic
922997658 1:229977959-229977981 TAACCATTCTAAAAGCTGTGTGG + Intergenic
1063135278 10:3210913-3210935 GCTGCATTCTAGAAACTCTTAGG + Intergenic
1063373001 10:5533785-5533807 GAAGCACGCTGGCAGCTGTTAGG + Intergenic
1063916863 10:10892217-10892239 AAAATAGTCTAGAAGCTGTTTGG - Intergenic
1064799537 10:19052934-19052956 GAAGTATCATAGAAGGTGTTGGG - Intronic
1065626581 10:27635475-27635497 GGAGCCTGGTAGAAGCTGTTTGG + Intergenic
1067672079 10:48332734-48332756 GAGGCTTTCTAAAACCTGTTTGG + Intronic
1068177925 10:53486203-53486225 AAAGCATTCAAGAGGCGGTTTGG - Intergenic
1070047182 10:72849700-72849722 GAAGCATCATAGAAGCTGGTGGG + Intronic
1072313345 10:94178363-94178385 GAGGCCTTGTAGAAGCTGCTGGG - Intronic
1072751595 10:97984490-97984512 GAAACAGTCAAGAAGCTTTTTGG + Intronic
1072792435 10:98327968-98327990 GAAGCTTTCCAGAAGCTTTTGGG - Intergenic
1073692717 10:105828384-105828406 GAAGCCTGCTAAAAGCTGCTTGG + Intergenic
1078620689 11:12904844-12904866 TGAGCATTCTAGCAGCAGTTTGG - Intronic
1079260779 11:18878208-18878230 GAAGCATTGAAGAAGCTGGAGGG + Intergenic
1080513725 11:33000950-33000972 GAAGCAGTCTAGCTGCTTTTTGG + Intergenic
1081034922 11:38132299-38132321 GAAGTATTTTAGCAACTGTTTGG - Intergenic
1082151154 11:48740376-48740398 GAACCATTCTTTAAGCAGTTTGG - Intergenic
1084782420 11:71418971-71418993 GTGGCTTTCTAGAAGCTGTAAGG - Intergenic
1087265518 11:96056325-96056347 GAAGCATTTTAGAATCCTTTGGG + Intronic
1088820499 11:113452558-113452580 GAAGAATTCCAGAAGATGTGTGG - Intronic
1088899926 11:114108027-114108049 GAAGCATTGTAAAAGATGCTGGG + Intronic
1093248176 12:16766395-16766417 TAAGCTTTATAGAAGCTGTGTGG - Intergenic
1093665616 12:21809476-21809498 GAAGGATTGCAGGAGCTGTTAGG - Intronic
1097926248 12:65131132-65131154 GAAGCATTTTAGAAAATTTTTGG + Intergenic
1099385486 12:82007952-82007974 CTAGTATTCTAGAAGCTGTGGGG + Intergenic
1100039228 12:90292547-90292569 GAAGTAATTTAGCAGCTGTTAGG - Intergenic
1100228078 12:92579105-92579127 GAAGCTTTCCAGAAACTGGTAGG - Intergenic
1101225248 12:102681827-102681849 GAAGCATTCTAGAAAGTTCTAGG - Intergenic
1101419354 12:104536996-104537018 GAAGCATTCTAGAAGCTGTTAGG + Intronic
1104287039 12:127432828-127432850 GAAGGATTCAAGAAGCTGCCGGG - Intergenic
1106178412 13:27350671-27350693 GCAGCATTCTAAGAGCTGCTGGG + Intergenic
1106401527 13:29435906-29435928 GCATCCTTCTAGAAGCTGGTGGG + Intronic
1109232925 13:59781140-59781162 GCAGCATTCTAGAACCTTTTAGG - Intronic
1110331594 13:74279107-74279129 GAATGAGTCTAGAACCTGTTTGG - Intergenic
1110368468 13:74714586-74714608 GAAACATTCTACTAGGTGTTGGG + Intergenic
1110601270 13:77377237-77377259 GAAACATTCTAGTAGCAGCTTGG - Intergenic
1110745993 13:79053981-79054003 GAAGCCTTCTCCAATCTGTTTGG + Intergenic
1111287335 13:86112071-86112093 CAAGAATCCTAGCAGCTGTTTGG - Intergenic
1114174202 14:20304782-20304804 CAAACATTCAAGAAGTTGTTTGG + Intronic
1114385868 14:22253761-22253783 GATGCATTTTACAAGCTGTTTGG - Intergenic
1115385259 14:32789365-32789387 GAAGCAGTCTGGCTGCTGTTTGG - Intronic
1117649922 14:57893115-57893137 GAAACTTTCTAGAAGCTCTATGG + Intronic
1118656359 14:67954170-67954192 GAATCATCACAGAAGCTGTTAGG + Intronic
1121240553 14:92427126-92427148 GCAGCATCCAAGAAGCAGTTTGG + Intronic
1121676738 14:95759635-95759657 GAAGCATCCAAGAGGCTCTTAGG - Intergenic
1124491042 15:30155857-30155879 GGAACATTTTAGAAGCTCTTAGG + Intergenic
1124752495 15:32382474-32382496 GGAACATTTTAGAAGCTCTTAGG - Intergenic
1125256532 15:37770344-37770366 GATACATTCTTAAAGCTGTTAGG - Intergenic
1137378713 16:47977546-47977568 GCAGCATTTTAGAATCAGTTGGG - Intergenic
1138851743 16:60637386-60637408 GAAAATTTCTAGAAGCTGCTGGG - Intergenic
1139207732 16:65045391-65045413 GCACCATTCCAAAAGCTGTTAGG - Intronic
1141541430 16:84725773-84725795 GAAGAATTTTAGAAGTTGTCTGG + Intronic
1142498791 17:320978-321000 GAAGCCTCCCAGGAGCTGTTCGG - Intronic
1144586398 17:16490466-16490488 GCATCATTCTGGAAGTTGTTGGG + Intronic
1145781351 17:27566036-27566058 GAAGCATGCGAGAAGCTGCAGGG + Intronic
1146276039 17:31516323-31516345 GAAGCCTTCTAGAAGCCGTTTGG + Intronic
1148972573 17:51497315-51497337 GAAGTGTTCTAGAAGTTGTATGG - Intergenic
1149892767 17:60404873-60404895 GTCCCATTTTAGAAGCTGTTTGG + Intronic
1151583358 17:74992711-74992733 GAAACACAATAGAAGCTGTTTGG - Intronic
1153856041 18:9148159-9148181 GCAGCAATTTAGAACCTGTTAGG + Intronic
1157302445 18:46488825-46488847 GAAACATCCTAAATGCTGTTTGG - Intronic
1157426225 18:47586594-47586616 AAAACATTCTGGAATCTGTTTGG - Intergenic
1164548830 19:29190936-29190958 GAGGCCTTGTAGAAACTGTTTGG + Intergenic
1164932840 19:32188594-32188616 GCATCTTTCTAGAAGCTGTAGGG - Intergenic
1165610843 19:37150839-37150861 GAAGCTTTCTTGAAGGTGATGGG + Exonic
1167524216 19:49973487-49973509 GAAGCAGTCTGGAGTCTGTTGGG - Intergenic
926957125 2:18313801-18313823 CAAACTTTCTAGAAGTTGTTAGG + Intronic
928346065 2:30497273-30497295 GCAACATTCTAGAAGTTATTGGG - Intronic
930029223 2:47048167-47048189 GAAGCATTTTAGAGGCTGGGTGG - Intronic
932452746 2:71825176-71825198 GAAGCTTTCCAGAAGGTGATAGG + Intergenic
933194272 2:79371104-79371126 GAACCATGCTAGAAGTTATTCGG - Intronic
933436490 2:82256791-82256813 GAAGCAGTCTAGCTGCTTTTTGG + Intergenic
934686242 2:96324180-96324202 GAAGTATTGTACAAGTTGTTTGG + Intergenic
934875695 2:97917780-97917802 GAAGCTTGCTAGAACCTGCTGGG - Intronic
937156240 2:119721391-119721413 TCTGCATTCTAGAAGCTCTTAGG + Intergenic
937703875 2:124895533-124895555 GAAGCATTCTTGAACCTGGGAGG + Intronic
938386284 2:130869601-130869623 GAAGGAGTGTAGAAGCTGCTGGG + Intronic
938597460 2:132802403-132802425 GAAGCTTTCTAGAAGCTGTGAGG - Intronic
939208637 2:139141988-139142010 GAATAATTCTAGAATGTGTTAGG - Intergenic
941515550 2:166471707-166471729 GAAGCATTCCAGAAAATGTGGGG + Intronic
941533995 2:166700776-166700798 GAAGAATTCTAGAATGTGTTGGG - Intergenic
944103761 2:196056642-196056664 GAAGCATTCTATAAGCTCAGAGG + Intronic
945038685 2:205726366-205726388 GGAACATTATATAAGCTGTTTGG + Intronic
947092972 2:226533778-226533800 GAAGCATTTTTGAAAATGTTTGG + Intergenic
947950476 2:234142780-234142802 GGAGCATTCTCCAAGCTGATAGG - Intergenic
1171080621 20:22179386-22179408 GAAGCTCTCTACAAGCTTTTGGG + Intergenic
1171132491 20:22666502-22666524 AAAGCATTCAAGCAGCTGTGTGG - Intergenic
1171168966 20:22998524-22998546 GAAACATTCTAGAAAGTGTGTGG + Intergenic
1172093443 20:32449099-32449121 AAAGCATTCTACAAGGTGTTCGG + Intronic
1178737578 21:35166826-35166848 GAAACATTATAGAAGCTGTGAGG - Intronic
1181981198 22:26767867-26767889 GAAGCATTCTAAAACATCTTGGG + Intergenic
949347015 3:3085774-3085796 GACACATCCTAGAATCTGTTAGG - Intronic
949454796 3:4227138-4227160 GAAGCATTCTAGAGCTTCTTTGG + Intronic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
955578234 3:60389498-60389520 CACTCATTTTAGAAGCTGTTAGG - Intronic
956341068 3:68224736-68224758 AAAGTATTTTAGAAGTTGTTTGG - Intronic
957790018 3:84928649-84928671 ACATCATTCTATAAGCTGTTTGG + Intergenic
957988388 3:87599225-87599247 GGAGTATTCTAGAAGGTATTGGG + Intergenic
958441504 3:94161711-94161733 GAAGGATTCCAGAAACTGTTGGG - Intergenic
959163458 3:102746806-102746828 GAAGCTGTATAGAAGGTGTTTGG + Intergenic
959263922 3:104114103-104114125 GAAGCATTCTGGCTGCTTTTTGG - Intergenic
960423552 3:117478394-117478416 GAGCCATTTTAGAAGCAGTTTGG - Intergenic
960789570 3:121413469-121413491 GAACCATACTAGAAGTTGGTAGG - Intronic
960860988 3:122153721-122153743 GAAGCATTCTAATAGATATTGGG - Intergenic
964145353 3:153454879-153454901 AAAAAAATCTAGAAGCTGTTAGG - Intergenic
967357098 3:188583838-188583860 GAAGCTCTCTAGAAGCAGTCTGG - Intronic
967483908 3:190007891-190007913 GAAGCAGACTAGAAGGTTTTTGG - Intronic
969096790 4:4738772-4738794 GGAACATTCTAGAAGCAGATAGG - Intergenic
970615464 4:17764658-17764680 GCAGTATGCTAGAAGCTGTTGGG + Intronic
974124056 4:57674081-57674103 GAAGCATTTTGAAAGCTGTGAGG + Intergenic
974464426 4:62236112-62236134 GAAGCAATACAGCAGCTGTTGGG + Intergenic
976980995 4:91229000-91229022 GGAGCATTCTATAACCAGTTTGG + Intronic
978408714 4:108406243-108406265 GAAGCATTCAAGAAGCAGTGTGG - Intergenic
979601572 4:122591546-122591568 AAAGCACTCAAGAAGCTGTGTGG - Intergenic
981251491 4:142608070-142608092 CAAGCATTAAAGAAGTTGTTTGG + Intronic
982397181 4:154925391-154925413 GAAGCAGTCTAGCTGCTTTTTGG + Intergenic
986310540 5:6547645-6547667 GAAGCAATTTAGGAGCTCTTAGG - Intergenic
986846357 5:11760232-11760254 CACGTATTCTAGAAGCTCTTGGG + Intronic
987277050 5:16373526-16373548 GAAGCATAGGAGAAGATGTTAGG + Intergenic
988354227 5:30151954-30151976 AAAGCAATCAAGAAGCTGTGTGG - Intergenic
988818801 5:34860779-34860801 GAAACATTCGAGAAGATGTAGGG - Intronic
991295856 5:65079859-65079881 GAAGCAGTCTAGATCCTTTTGGG + Intergenic
992115986 5:73539048-73539070 GGACCCTTCTAGAAGCTGTGGGG + Intergenic
996637881 5:125716653-125716675 GATGCATTGTAGTAGATGTTAGG - Intergenic
996867335 5:128140419-128140441 GAAGCATGCTAGGAACTTTTAGG - Intronic
997614422 5:135236764-135236786 GAAGCATGCAGGAAGCTGATGGG + Intronic
998556531 5:143130305-143130327 TAAGCCTTCTGGAAGCTATTGGG - Intronic
998621603 5:143800702-143800724 CAAACAGTCTAGAACCTGTTTGG + Intergenic
1000395318 5:160768767-160768789 GATGCATTCAGGAAGCTGATGGG + Intronic
1002781942 6:373724-373746 GAAGCATTCTCGCTGCTGCTGGG - Intergenic
1002782048 6:374450-374472 GAAGCATTCTCGCTGCTGCTGGG - Intergenic
1004074783 6:12335209-12335231 GGAGCTTTCTGGTAGCTGTTTGG - Intergenic
1005869869 6:29966886-29966908 GAAACACTATAGAAGCTGTAGGG + Intergenic
1007523671 6:42472261-42472283 GTACCATTCTTGAAGCTATTAGG - Intergenic
1007647860 6:43396651-43396673 GAAACACTATAGAAGCTGTAGGG + Intergenic
1008789880 6:55217446-55217468 AAAGCATTCATGATGCTGTTTGG - Intronic
1008869761 6:56259260-56259282 GAAGCATTGAAGAAGCAGTGGGG - Intronic
1008970196 6:57358103-57358125 TAAGCACCCTAGAAACTGTTTGG + Intronic
1009159163 6:60259927-60259949 TAAGCACCCTAGAAACTGTTTGG + Intergenic
1009499931 6:64398905-64398927 GAAGCAAACTAGAAGCTTTCTGG + Intronic
1010373863 6:75143454-75143476 CAAGCTTTCAAGAAGTTGTTTGG + Intronic
1013041004 6:106433342-106433364 AAAGGAGACTAGAAGCTGTTTGG + Intergenic
1015396974 6:132745520-132745542 GATCCATTCTTGAAGCTGGTGGG + Intronic
1015646289 6:135392270-135392292 GAAGCATTCTAGAAATTGTGAGG + Intronic
1015993579 6:138974641-138974663 GAAACTTTCTTGAAACTGTTAGG - Intronic
1017280406 6:152617895-152617917 GAAGGAATCTAGAAATTGTTCGG + Intronic
1018201846 6:161402507-161402529 GAGACATTCTGGAAGCTGTGGGG + Intronic
1018466281 6:164048449-164048471 CAAGCATTATGAAAGCTGTTGGG + Intergenic
1021119767 7:16785929-16785951 GAAGCATCACAGAAGGTGTTAGG - Intergenic
1022508138 7:30919342-30919364 GAAGGCTTCTAGGAGCTGGTGGG + Intronic
1022987627 7:35674522-35674544 CAAGGATTTTAGGAGCTGTTCGG - Intronic
1024396179 7:48870122-48870144 GAGGCATTCTAGGTGCAGTTTGG + Intergenic
1024676540 7:51642499-51642521 GCAGCCTTCTAGGAGCTGATGGG + Intergenic
1027154855 7:75759606-75759628 GGGGCATTCTGGAAGGTGTTTGG + Intergenic
1029971661 7:104795772-104795794 GAAATATTCTAGGGGCTGTTTGG - Intronic
1030875181 7:114805184-114805206 CCAGTATGCTAGAAGCTGTTGGG + Intergenic
1036635767 8:10548651-10548673 GAAGCAGACGAGGAGCTGTTGGG + Intronic
1038195652 8:25364721-25364743 CAAGAATTCTAGAAGCAGGTAGG - Intronic
1040022851 8:42756011-42756033 GAAGCATTCTTTAAGATGTCTGG + Exonic
1040839894 8:51773536-51773558 GTGGAATTCTAGAAGGTGTTTGG - Intronic
1040871393 8:52103101-52103123 GAAGCATTTTGGAAACTATTTGG + Intergenic
1043006992 8:74832037-74832059 GATGCAGTCAAGAGGCTGTTAGG + Intronic
1044555243 8:93556026-93556048 AAAGCCTTCTACAAGCTGTCTGG + Intergenic
1047038087 8:120961849-120961871 AAAGCAATATGGAAGCTGTTAGG + Intergenic
1048087615 8:131201231-131201253 AAAGCATTCAAGAAGCAGTCTGG + Intergenic
1048621054 8:136133355-136133377 GCAGCATTCCAGAATCTGATGGG - Intergenic
1048651272 8:136481060-136481082 GAAAGACTCTAGCAGCTGTTAGG - Intergenic
1051743119 9:20270198-20270220 GAAGCCTGGTGGAAGCTGTTTGG - Intergenic
1052886109 9:33649573-33649595 GAAGTAACCTAGAAGCTGTCTGG - Intergenic
1056151815 9:83798206-83798228 GTATCATTCTAGCAGATGTTAGG - Intronic
1057409083 9:94800788-94800810 GAAGCATTCTGGAAGCGGCAGGG - Exonic
1059845304 9:118269100-118269122 GAATCATTCTAGATGCTTTATGG - Intergenic
1187635606 X:21224704-21224726 GAAGCATTCTAAAAGAGTTTAGG + Intergenic
1187963997 X:24592780-24592802 GAAGCATTCAAGAAACTGCAAGG - Intronic
1190509043 X:51158238-51158260 GAAGTACTCAAGAAGCTGTTAGG + Intergenic
1190525397 X:51324607-51324629 AAAGTATTCTAGAAGCTGGTAGG + Intergenic
1190544082 X:51507016-51507038 AAAGTCTTCTAGAAGCTGGTAGG - Intergenic
1190774616 X:53542744-53542766 TAAGCATCCAAGGAGCTGTTGGG - Intronic
1191077145 X:56467488-56467510 AAAGAATTCTAAAAGCTGTGAGG - Intergenic
1192203612 X:69082290-69082312 GCAGCAATCTGGAAGCTATTGGG + Intergenic
1194385192 X:93243644-93243666 TAAAAATTCTAGAAGGTGTTGGG + Intergenic
1195141364 X:101963864-101963886 GAGGCATTATAGGAGCTGTAGGG - Intergenic
1195459177 X:105104310-105104332 GAAGCTTTATAGCAGATGTTGGG + Intronic
1198211540 X:134521110-134521132 GAAGCCTTCTAGCTTCTGTTTGG + Intergenic
1199595090 X:149500742-149500764 GCTTCATTCTAGAAGCTGGTGGG - Intronic
1200294181 X:154901607-154901629 GAATCATTCTAGCACCTGTTAGG - Intronic