ID: 1101419627

View in Genome Browser
Species Human (GRCh38)
Location 12:104539595-104539617
Sequence CCAAGGGTCCTAACGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101419627_1101419637 26 Left 1101419627 12:104539595-104539617 CCAGGACACGTTAGGACCCTTGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1101419637 12:104539644-104539666 CCCAAAATTGTCAGCCACAATGG 0: 1
1: 0
2: 0
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101419627 Original CRISPR CCAAGGGTCCTAACGTGTCC TGG (reversed) Intronic
900095105 1:937062-937084 CTACGGGGCCTCACGTGTCCTGG + Intronic
904283440 1:29437501-29437523 CCAAAAGTCTTAACTTGTCCTGG - Intergenic
909740133 1:79018687-79018709 CCATGGGTCCCAACGTGCCCAGG + Intergenic
915914145 1:159931194-159931216 CCAAGGGTGCCAATGTCTCCTGG - Exonic
922769342 1:228173650-228173672 CCAAGGGTCCTAAGGTGGGCAGG - Intronic
1066078607 10:31906705-31906727 CCATGGCTCCTAACTTCTCCTGG - Intronic
1076431690 10:130408240-130408262 CGGAGGGTCCTAATGTGTGCAGG - Intergenic
1083000631 11:59287752-59287774 CCAAGTGTCCTACTGTGTCAAGG - Intergenic
1083771661 11:64871044-64871066 CCCATGGTCCTAATGTGTGCAGG - Intronic
1086332315 11:85766190-85766212 CCAAGAGGCCTAAAGTGTCAAGG + Intronic
1086763850 11:90669624-90669646 CCAAAGGTGCTAAGGTGTTCAGG + Intergenic
1094269646 12:28599096-28599118 TCAGGGGTCCTTACTTGTCCAGG + Intergenic
1094478410 12:30860325-30860347 GCCAGGGTCCTAAGATGTCCTGG - Intergenic
1098081136 12:66786714-66786736 CCAAGGGTCCTCACATGACTAGG + Intronic
1098236985 12:68426908-68426930 CCAAGGGGCCTACCGTGGACAGG + Intergenic
1101419627 12:104539595-104539617 CCAAGGGTCCTAACGTGTCCTGG - Intronic
1113246423 13:108401831-108401853 CGAAGGGTCCTGACTTGCCCTGG + Intergenic
1114673642 14:24427921-24427943 CCAATGATCCTGACGTGACCCGG - Exonic
1115985984 14:39103614-39103636 ACCAGGGTCCTAAGATGTCCTGG - Intronic
1132635963 16:946765-946787 TCAAGGGACCTCACGTGCCCTGG + Intronic
1133969403 16:10556755-10556777 CCAAGGGTCCTAATGGTTCTGGG + Intronic
1137465091 16:48700473-48700495 CCAAGGTTCCTGAAGTGTCTGGG - Intergenic
1142076437 16:88120685-88120707 CCACGTGTCCTGACGTGTCCCGG - Intergenic
1151495011 17:74453906-74453928 CCCAGCGTCCTAACCTGACCCGG + Intergenic
1155065579 18:22266266-22266288 CCTTGGGTCCTAAGGTCTCCAGG - Intergenic
1164403315 19:27918726-27918748 CCAATGGTCCCACCGTGTCCTGG - Intergenic
934232048 2:90192904-90192926 CCAATGGGCCTCACATGTCCAGG + Intergenic
937151863 2:119691709-119691731 CCAGAGGTCCTGACGTGTCAAGG + Intergenic
945470730 2:210225224-210225246 CCGAGGGTCCCTACGCGTCCTGG - Exonic
1171411434 20:24950934-24950956 CCAGCTGTCCTAGCGTGTCCTGG + Intronic
1172355673 20:34278000-34278022 CCAAGGGTCCTGCAGTATCCAGG - Intergenic
1175326057 20:58129279-58129301 CCCAGGGCCCTCCCGTGTCCCGG + Intergenic
1179810496 21:43866029-43866051 CCAAGGGTCCTGGGGTGGCCAGG - Intronic
1184499602 22:44863715-44863737 CCAAGCATCCTAACGCGTACCGG - Intergenic
950120904 3:10482054-10482076 CTAGGGGGACTAACGTGTCCAGG - Intronic
950160120 3:10754153-10754175 TCCAGGGTCCTGACGGGTCCTGG - Intergenic
959434840 3:106301860-106301882 ACAAGGATCCTAAAGTCTCCTGG - Intergenic
960330779 3:116357966-116357988 CCAAGTTTCCTAAAGTTTCCTGG - Intronic
983127334 4:163970331-163970353 CCATGGGTCCTAAAGTGCCTTGG + Intronic
985213192 4:187617793-187617815 CCAAGGGGCCTAACTTCTCTGGG - Intergenic
985725224 5:1512573-1512595 CCAAAGGTCACAAGGTGTCCAGG - Intronic
993503039 5:88683432-88683454 CCAAAGTCACTAACGTGTCCAGG + Intergenic
999264043 5:150255065-150255087 ACAATGTTCCTAACATGTCCTGG + Intronic
1010906252 6:81493685-81493707 TAAAGGATCCTCACGTGTCCTGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1057958919 9:99436174-99436196 CCAAGGGGCCTAACATCTCCAGG + Intergenic
1203784317 EBV:118941-118963 TCAAGGGTCCTAACTGGTCAGGG - Intergenic
1186683497 X:11900371-11900393 CCAAGAGTCCTATCCTGTCCTGG - Intergenic
1194216030 X:91131400-91131422 CCCACAGTTCTAACGTGTCCTGG + Intergenic
1196088079 X:111708022-111708044 CACAGGGTCCTGACTTGTCCTGG + Exonic
1197240618 X:124119165-124119187 CCCAGGGTCCTCACATGCCCAGG - Intronic