ID: 1101419880

View in Genome Browser
Species Human (GRCh38)
Location 12:104541986-104542008
Sequence GTTGCTAGAAAGTAAAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101419880_1101419882 11 Left 1101419880 12:104541986-104542008 CCTGCATTTTACTTTCTAGCAAC 0: 1
1: 0
2: 2
3: 25
4: 202
Right 1101419882 12:104542020-104542042 CTATTTCATTTTTAACATCTTGG 0: 1
1: 0
2: 7
3: 68
4: 570
1101419880_1101419883 20 Left 1101419880 12:104541986-104542008 CCTGCATTTTACTTTCTAGCAAC 0: 1
1: 0
2: 2
3: 25
4: 202
Right 1101419883 12:104542029-104542051 TTTTAACATCTTGGATGTGTAGG 0: 1
1: 0
2: 3
3: 34
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101419880 Original CRISPR GTTGCTAGAAAGTAAAATGC AGG (reversed) Intronic
902353260 1:15874890-15874912 GTTGCTACTAAGTGAAATGATGG + Intronic
902951512 1:19886809-19886831 GTTGTTAGAAATGAAAATGCTGG - Intronic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
908477817 1:64506028-64506050 CTTGGTTGAAAATAAAATGCAGG - Intronic
909261477 1:73494739-73494761 GTTGCAGGTAAGTAATATGCCGG - Intergenic
909872437 1:80759615-80759637 GTTGCTAGGAAGTAAAATTCTGG + Intergenic
911717690 1:101153104-101153126 GTGGCTAGAGAATAAAATGCAGG - Intergenic
912742221 1:112210959-112210981 GGTGATAGAAAGTAGAATGATGG + Intergenic
913038386 1:114998058-114998080 GGTTCTAGAAAGTGAAATGTGGG - Intergenic
915398703 1:155606687-155606709 GTTGCTACAAAAAAAAAGGCTGG - Intergenic
917669848 1:177263128-177263150 GATGCTAGAAAGTGAAAAGTTGG + Intronic
917773591 1:178308353-178308375 GATGGTATAAAGTAAAAGGCTGG - Intronic
918129093 1:181609202-181609224 GTGGAAAGAAAGTGAAATGCTGG + Intronic
918871978 1:189986430-189986452 GGAGATAGAAAGTAAAATGATGG - Intergenic
920114733 1:203612359-203612381 GTGGCTAGAATATAAAAAGCAGG - Intergenic
921805065 1:219444804-219444826 GTTGTTGGAAAGTAAAATTCTGG - Intergenic
921967053 1:221101411-221101433 CTTGCTAAAAAGTAAAGTGTGGG + Intergenic
923590776 1:235317571-235317593 TTTACTAGAAAATAAAAAGCAGG - Intronic
1063198643 10:3766446-3766468 GTGGCTTGCAAGTAAAAAGCAGG + Intergenic
1063767937 10:9163848-9163870 TTTGCTAGAGAGTAAATGGCAGG + Intergenic
1063783316 10:9351513-9351535 GTGGCTAGAATGTAGGATGCAGG - Intergenic
1065759946 10:28973125-28973147 GGTGCTAGAAGTTAAAAGGCGGG - Intergenic
1068000164 10:51324280-51324302 GTTGGTTGAAAGTAGAATGGTGG - Intronic
1068325099 10:55475048-55475070 GTTGCTATAAAGGAAGGTGCAGG + Intronic
1069353151 10:67553548-67553570 GCTGCTAATAAGTAAAATGCAGG - Intronic
1071084244 10:81849654-81849676 GTTTCTCAAATGTAAAATGCAGG + Intergenic
1071511463 10:86264991-86265013 GTGGCTAGGAAGGAAAAGGCTGG - Intronic
1071753875 10:88513713-88513735 TTTCCTAGAAATTAAATTGCTGG + Intronic
1071798995 10:89036931-89036953 GTAGATAGAAAGTAGAATGATGG - Intergenic
1072170896 10:92860644-92860666 AGAGATAGAAAGTAAAATGCTGG - Intronic
1072683891 10:97525761-97525783 CCTGCTAGAATGTAAACTGCGGG + Intronic
1073710478 10:106031757-106031779 ATTGCTAAAAAATAAAAGGCAGG + Intergenic
1074117161 10:110464857-110464879 GTTGCAAAACAGGAAAATGCAGG + Intergenic
1076465688 10:130680082-130680104 CTTCCTAGAAAAGAAAATGCTGG + Intergenic
1078706481 11:13748600-13748622 GTTGCTGGTGTGTAAAATGCAGG - Intergenic
1078965954 11:16342915-16342937 GATACTAGAAAATAAAATGGGGG + Intronic
1079020325 11:16905613-16905635 ATTGCTAGAAGGTGAAAAGCTGG + Intronic
1080570928 11:33556679-33556701 GTATCTAGAAAGTAGAATGGTGG + Intronic
1082202296 11:49386654-49386676 GTTGTAAGAAAGTAAAACTCAGG + Intergenic
1082930291 11:58596008-58596030 GTTTCTGGGAAGTTAAATGCAGG - Intronic
1083067971 11:59945439-59945461 ATTGCTATAAAGAGAAATGCTGG + Intergenic
1085354588 11:75824214-75824236 GTATCTAAAAAGTAAAATGATGG + Intronic
1086054689 11:82632805-82632827 GTTGCTAGAAAATAAAAACTAGG - Intergenic
1089391495 11:118104950-118104972 GTTGCTTATAAGTGAAATGCTGG - Intronic
1091494850 12:963477-963499 AATGCTATAAAGAAAAATGCAGG + Intronic
1092216247 12:6685386-6685408 TTTGGTGGAAAGAAAAATGCTGG + Intronic
1092278023 12:7076902-7076924 GTTGCTAGAAGGAGAAATCCAGG - Intergenic
1092750234 12:11712135-11712157 ATTGCTAAAAAGTAAGATGGGGG - Intronic
1093940116 12:25043652-25043674 GCTGCTAGAAACAAAAATGGTGG + Intronic
1094717494 12:33027655-33027677 TTTGCCACAAACTAAAATGCAGG - Intergenic
1095284621 12:40393582-40393604 ATTGCTAGGAAGAAAAATGTTGG - Intronic
1097954058 12:65465130-65465152 GTTGCTACAAAGGGAAATTCTGG - Exonic
1101402104 12:104397459-104397481 GCTGCTATAAAGAAAAATGAGGG + Intergenic
1101419880 12:104541986-104542008 GTTGCTAGAAAGTAAAATGCAGG - Intronic
1102940597 12:116937884-116937906 GGTGCTATAAAGCAAAATGCTGG + Intronic
1103380785 12:120492710-120492732 GTGGCAAGAATGAAAAATGCAGG + Intronic
1104328455 12:127822201-127822223 GTAGTTAGAGAGTAAAATGGTGG + Intergenic
1104420968 12:128634775-128634797 GGTGCTAAAACCTAAAATGCAGG - Intronic
1104786295 12:131451289-131451311 GTTTCTACAAAGTAAATTACAGG - Intergenic
1105523624 13:21154049-21154071 GTTCCTTGAAAGTCAAATGGGGG - Exonic
1106968273 13:35101281-35101303 GTTGGTAGGATGTAAAATGCTGG - Intronic
1109227307 13:59712691-59712713 GTTTTAAGAAAGTAAAATGGGGG - Intronic
1109809663 13:67495575-67495597 GTTTTTAGAAATAAAAATGCTGG + Intergenic
1110386968 13:74923818-74923840 ATTGCCAGAAGGTAAAATGTTGG + Intergenic
1111377445 13:87399209-87399231 GCTGCTAGAGAGTATAATGAAGG - Intergenic
1111909627 13:94296113-94296135 TTTTTTAGAAAGTAAAATGAAGG + Intronic
1112561465 13:100518619-100518641 GTTAATACACAGTAAAATGCAGG + Intronic
1116291904 14:43053957-43053979 GTTGATAGAAAGTAAATTCATGG + Intergenic
1117399651 14:55347124-55347146 CTTGCAATAAAGTAAAATGCAGG - Intronic
1117937931 14:60927938-60927960 TTTGGTACAAAATAAAATGCAGG - Intronic
1118275840 14:64385631-64385653 GTTGAAATAAAGTAAAATGTAGG - Intergenic
1120425293 14:84339920-84339942 GATGCAATAAAGAAAAATGCTGG - Intergenic
1120543569 14:85781777-85781799 GTTGCCAGAAAACAAAATACAGG - Intergenic
1122567944 14:102675464-102675486 GCTGTTAGTAAGTAAAATACAGG + Intronic
1127199969 15:56634923-56634945 CTTACTAGCAAGTAAAATGTTGG - Intronic
1134901074 16:17938600-17938622 CTGGATAGAAAGTAAAAAGCAGG - Intergenic
1135054299 16:19218292-19218314 GTTGATAGAAAGTAAAAAAGAGG - Intronic
1135905683 16:26509727-26509749 GTTGGGAGAAAATAAAATGATGG + Intergenic
1136360540 16:29776508-29776530 GTGGATAGAAAAAAAAATGCAGG + Intergenic
1138803907 16:60070415-60070437 GATGACAGAAAGTAAAAAGCAGG - Intergenic
1139111521 16:63897260-63897282 GTTGCTATAAAGTAGAATATAGG + Intergenic
1139543755 16:67638497-67638519 TTTGCAAGTAATTAAAATGCTGG - Exonic
1141735371 16:85848577-85848599 GTTGTGAGAAAGTAGAATGCTGG + Intergenic
1144173483 17:12682373-12682395 CTTCCTAGAAAGTAACAAGCAGG - Intronic
1144188182 17:12815947-12815969 GTTGGTGGAAGGTCAAATGCTGG + Intronic
1148171370 17:45523502-45523524 GTTGCTATATAACAAAATGCTGG - Intergenic
1148278302 17:46326299-46326321 GTTGCTATACAACAAAATGCTGG + Intronic
1148300513 17:46544154-46544176 GTTGCTATACAACAAAATGCTGG + Intronic
1149154641 17:53612394-53612416 GTTCCAAGAAAGTATGATGCTGG - Intergenic
1149983219 17:61327982-61328004 ATTCCTAGAAAATAAATTGCTGG - Intronic
1150401992 17:64865102-64865124 GTTGCTATATAACAAAATGCTGG - Intronic
1151981765 17:77515659-77515681 GTGGTTAGAAATAAAAATGCTGG + Intergenic
1153273971 18:3350111-3350133 GTTTCTAAAAAGAAAAATGAAGG + Intergenic
1153368351 18:4285172-4285194 GTTGCTAAAAAGTAGAATGAAGG + Intronic
1156790905 18:40972959-40972981 GTTGCTACAAAATAAAATCTAGG - Intergenic
1157426041 18:47585051-47585073 GTTGCTAGAAGGCAGAATCCAGG + Intergenic
1162939974 19:14003291-14003313 GTCACTAGAAAGAAAAATCCTGG - Intronic
1163401824 19:17098589-17098611 GTTGCAAGAAAAAGAAATGCTGG - Intronic
1164000601 19:21094808-21094830 GTTGTTAGAAAGTAACAGGCTGG - Intronic
1164589265 19:29497372-29497394 ATTGCTAGGAAGGAAAATTCTGG + Intergenic
1165582562 19:36880487-36880509 TTTGCTTAAAAATAAAATGCAGG + Intronic
1165656186 19:37534210-37534232 GTTCCTTGGAAGGAAAATGCTGG - Intronic
927089853 2:19702017-19702039 GTTGACTGAAAGGAAAATGCTGG + Intergenic
932013091 2:67998005-67998027 ATTGCTAGAAGGAAAAATACAGG - Intergenic
932446520 2:71785197-71785219 GTTGCTGGAAAGTTAAATTTTGG - Intergenic
932927881 2:75997670-75997692 TGTACTAGTAAGTAAAATGCTGG + Intergenic
935932831 2:108147834-108147856 GTTGAAATAAATTAAAATGCAGG + Intergenic
937487076 2:122326355-122326377 GAGGGCAGAAAGTAAAATGCTGG + Intergenic
938202428 2:129385430-129385452 GTAGGTTGAAAGTAAAATGAGGG - Intergenic
939412457 2:141846824-141846846 TTTTCTAGTAAGAAAAATGCTGG - Intronic
940510573 2:154609099-154609121 GTTGCTAGTACCTAAAATGGTGG + Intergenic
942147545 2:173041593-173041615 GATGTCAGAAAGCAAAATGCAGG + Intronic
942573077 2:177333120-177333142 CTTGCAAGAGAGGAAAATGCTGG + Intronic
943050650 2:182909384-182909406 ATTGATAGAAAGTAGAATGTTGG - Intronic
944709616 2:202324039-202324061 GTAGCTAGAAAGCAAAAAGCTGG + Intergenic
945018380 2:205544903-205544925 GTTGCAAGGAAGGAAAATGTAGG + Intronic
945904457 2:215575530-215575552 GATGCTGGAATATAAAATGCAGG - Intergenic
947425577 2:229980360-229980382 GTGGTTAGAAAATAAAATGGAGG - Intronic
948398508 2:237664805-237664827 GTTGCTAGAAGGGAAATTGCTGG + Intronic
948502948 2:238408291-238408313 GTTGGTAGAAAGTGCAATGGGGG - Intergenic
1169106259 20:2997697-2997719 ATTCCTAGAAAGACAAATGCTGG - Intronic
1169856821 20:10112063-10112085 GGTGCCAGAAATTAAAATGAAGG + Intergenic
1170335019 20:15260312-15260334 GGAGATAGAAAGTAAAATGATGG - Intronic
1172258553 20:33541044-33541066 GACGCTAGAAAGTAATTTGCAGG + Intronic
1172544114 20:35746128-35746150 GTTTCAAGAAAGAAAAAGGCCGG - Intergenic
1172558308 20:35862755-35862777 GTCACTAGAAAATAAAATTCTGG - Intronic
1174788002 20:53450822-53450844 GGTACTAGAAAGAAAAATGTGGG - Intronic
1174847582 20:53958082-53958104 CTTGCTAGAAAGGCAAATTCTGG + Intronic
1177090919 21:16767264-16767286 ATTCATAGAAAGTAAAATGGTGG + Intergenic
1180885123 22:19237531-19237553 ATTCCTAGAAATTAAACTGCTGG - Intronic
1181838375 22:25629994-25630016 GATACTAGAATGTAAAATGAAGG - Intronic
1183002345 22:34871706-34871728 GTTGCAAGAAAGCAAAATAGTGG - Intergenic
1183310667 22:37107838-37107860 ATTGCTATAAAGAAAAATGCAGG - Intronic
1183771987 22:39934606-39934628 GTTTCTTGAAACCAAAATGCAGG - Intronic
1184423971 22:44398215-44398237 GTTGCCAGCAAGTATAAAGCAGG - Intergenic
949356441 3:3185052-3185074 TTTGCAAGAAAGTAAAATGTTGG + Intergenic
949753382 3:7380129-7380151 GTTGCTAGAAAAAAAAATGCTGG + Intronic
949836240 3:8273455-8273477 GCTGCTAGATAATAAAATACTGG + Intergenic
956136534 3:66104767-66104789 ATTGCTAGAAAGGGAATTGCTGG + Intergenic
957588031 3:82158083-82158105 GTTGCCAGAATGCAAAATTCTGG - Intergenic
958454736 3:94316268-94316290 GTTTTAAGAAAGTAAAAAGCTGG + Intergenic
959805470 3:110547365-110547387 GTTTCTAGAAATGGAAATGCAGG - Intergenic
960328545 3:116327282-116327304 CTTACTAGAAGGTAAAATGCAGG - Intronic
963655209 3:148039703-148039725 AATACTAGAAAGAAAAATGCTGG + Intergenic
963708905 3:148723630-148723652 GTTGCTAGCAAGAACAATGAGGG + Intronic
965544876 3:169904985-169905007 GCTTATAGAAAGTAAAATGGCGG + Intergenic
966462189 3:180189102-180189124 TTTGCTATACAGTACAATGCAGG + Intergenic
967003939 3:185365762-185365784 GAATCTAGAAAGGAAAATGCCGG + Intronic
967675852 3:192298412-192298434 GTTGCTATAAAGGAAAATCTGGG + Intronic
970547367 4:17143495-17143517 GTTGCTAGAAAGAGCAATCCCGG + Intergenic
970909085 4:21253339-21253361 ATTGCTAGAAAGTAATCTTCTGG + Intronic
972827615 4:42778918-42778940 GTTGCAAGATAGTAAAACTCAGG - Intergenic
974045540 4:56895415-56895437 GTGGCTAGAAATCAAAATACTGG + Intergenic
974307822 4:60163768-60163790 GTTACCAGAAAGTAAAATATAGG + Intergenic
975656704 4:76648501-76648523 GCTGCTAAAAAAAAAAATGCAGG - Intronic
976471023 4:85429341-85429363 GTAGCTTGAAAGCAAAATGAGGG + Intergenic
976627396 4:87201092-87201114 ATTCATAGAAAGTAAAATGGTGG + Intronic
977040365 4:92009050-92009072 GTTGCTAGCAAATATAAAGCTGG + Intergenic
977663467 4:99617463-99617485 CTTGCTAGAAAGTTAAATCATGG + Intronic
977672011 4:99706192-99706214 TTTGCTATTAAGTAAAATGTTGG - Intergenic
979856688 4:125641535-125641557 ATTGCTAGAAAGAAAAATCCTGG + Intergenic
980424687 4:132612581-132612603 GTTGGAAGAAAGAAAATTGCAGG + Intergenic
980766403 4:137311439-137311461 GTTGATAGCCAGCAAAATGCTGG - Intergenic
982744728 4:159094767-159094789 GTCTCTAGAAAAAAAAATGCAGG - Intergenic
982744751 4:159094899-159094921 GTCTCTAGAAAAAAAAATGCAGG - Intergenic
983105157 4:163677629-163677651 GTTGCTGAAAAATAAAATGTTGG - Intronic
983697123 4:170546037-170546059 GTTGTTTAAAATTAAAATGCAGG + Intergenic
983739525 4:171111594-171111616 GTGGCTAGAAAGTAAGATAAAGG + Intergenic
984725876 4:183020119-183020141 GTCACTAGAAAGTAAAATAACGG + Intergenic
986025774 5:3849266-3849288 GTTGCTCTAAATTAAACTGCTGG + Intergenic
989419581 5:41221101-41221123 GGTACTAGAAAGAAAACTGCAGG - Intronic
989523369 5:42425487-42425509 CTTTCCAGAAATTAAAATGCTGG + Intronic
989712095 5:44411500-44411522 GTTGCTGGAAGCAAAAATGCGGG - Intergenic
990189835 5:53247409-53247431 TTTGCTATAAAGAAAATTGCTGG + Intergenic
990661575 5:58021492-58021514 GATGCTAGAAAGGAAAATATTGG - Intergenic
991405263 5:66295032-66295054 AAAGCTAGAAAATAAAATGCAGG + Intergenic
993232556 5:85255501-85255523 TGTACTAGAAAATAAAATGCGGG + Intergenic
994156771 5:96512603-96512625 GATGCTAGAAAATCAAATGATGG - Intergenic
996922520 5:128785432-128785454 GTTGCTAGCAAATATAAAGCAGG - Intronic
998544736 5:143017131-143017153 TTTCCTAGAAAAGAAAATGCCGG - Intronic
998659311 5:144218904-144218926 GTGATTAGAAAGTAAAATGCGGG - Intronic
1001211782 5:169816556-169816578 TGTGCTAGAATGTAAACTGCAGG - Intronic
1002883685 6:1274958-1274980 GTAGCTAGAAACAAAATTGCTGG - Intergenic
1003021303 6:2511864-2511886 GTTGCGGGAAAGTAAAAGGCAGG - Intergenic
1005712331 6:28514104-28514126 GTAGCAAGAAAGACAAATGCTGG - Intronic
1009590217 6:65659392-65659414 TATCCTAGAAAGTAAAATGTTGG + Intronic
1009639072 6:66306747-66306769 GTAGCTTAAAAGTAAAATGATGG - Intergenic
1009865718 6:69395296-69395318 GTTGCTAGAAAATAATAGGAAGG + Intergenic
1011740714 6:90356874-90356896 GTTGATAAAAGGTACAATGCAGG + Intergenic
1013683258 6:112548331-112548353 ATTTCTAGAAAATAAAATGCTGG + Intergenic
1014728417 6:125002091-125002113 ATTGTTAGAGAGTAAAATACTGG + Intronic
1016077123 6:139809193-139809215 GTTAATTGAAAGTAAAATGATGG - Intergenic
1017230833 6:152071869-152071891 GTTGCTAGAAATTGATTTGCTGG + Intronic
1022488487 7:30798797-30798819 CCTGATAGAAAGTAAGATGCAGG - Intronic
1023535886 7:41209708-41209730 TTTACAAGAAAGGAAAATGCAGG - Intergenic
1025070615 7:55895053-55895075 TTTGCCAAAAAGTAAAATGAGGG + Intronic
1030424829 7:109362264-109362286 TTTGCTTGAAAGTAAAAGGCAGG - Intergenic
1030456894 7:109785924-109785946 GTTGGAAGAAAGTAAAAGGATGG - Intergenic
1033728900 7:144153502-144153524 GTTACTAGAAAATAAAATTCTGG + Intergenic
1034281423 7:149857357-149857379 ATTGTTAGAAAATAAAATGGAGG - Intronic
1035251075 7:157597582-157597604 GGTGATTGAAAGTAAAATGCTGG + Intronic
1035883680 8:3269123-3269145 ATTGATTGAAAGTAAGATGCTGG - Intronic
1037507816 8:19549883-19549905 GTTGCTAAGAAGTCAGATGCTGG + Intronic
1039535038 8:38302405-38302427 AATGCTAGAAAATAAAATGAAGG + Intronic
1040707561 8:50147963-50147985 AATGCTAGAAAGTAGAATACTGG + Intronic
1042775014 8:72420439-72420461 GTTGCTGGAGAGGAAGATGCGGG - Intergenic
1043233058 8:77826615-77826637 GGTGGTAGAAAGTAAAATGATGG - Intergenic
1044877635 8:96686186-96686208 ATAACTAGACAGTAAAATGCAGG - Intronic
1047703376 8:127472823-127472845 CTTGATAGAAAAAAAAATGCTGG + Intergenic
1048491261 8:134895957-134895979 GGTGCTGGTAAGTAAAATGGAGG - Intergenic
1050807845 9:9704271-9704293 GCTGCAATAAAGTAGAATGCTGG - Intronic
1052611411 9:30779679-30779701 GGTGCTAGAAAATATAATCCAGG + Intergenic
1056155303 9:83829156-83829178 GTTGATAGAAAATATAAAGCAGG + Intronic
1056355182 9:85793956-85793978 GTTGATAGAAAATATAAAGCAGG - Intergenic
1057960276 9:99448973-99448995 ATTGTTAGAAAGAAAAATGATGG - Intergenic
1058858754 9:109093405-109093427 GTACATAGAAAGTAAAATTCAGG - Intronic
1058858939 9:109095382-109095404 GTTGCTATAAAAAGAAATGCTGG + Intronic
1059896630 9:118873330-118873352 GTTCCTAGAAATTAAAATACAGG - Intergenic
1060910879 9:127349335-127349357 GTTGATTTAAAGTAAAATGTTGG - Intronic
1186063128 X:5732141-5732163 GGTGTTAAAAAGTAAAATGTGGG + Intergenic
1186413468 X:9363431-9363453 CTTCAAAGAAAGTAAAATGCAGG + Intergenic
1188455895 X:30365238-30365260 GTTGCTTAAAAGTAAACTGTGGG - Intergenic
1189424762 X:40888829-40888851 GTCTCTAGAAAATAAATTGCTGG + Intergenic
1190952108 X:55156251-55156273 CTTGAAAGAAAGTAAAATACTGG - Intronic
1192886499 X:75340582-75340604 GTGGATAGAAAGTAAAACGATGG - Intergenic
1195029536 X:100912895-100912917 CTTGTTATAAAGTAAAATCCTGG + Intergenic
1195131549 X:101858777-101858799 GTTGGTAGAAAGTGAAGTGGAGG - Intergenic
1195281153 X:103334304-103334326 GCTCCTAAAAAGTAAAATGGGGG + Intergenic
1197563171 X:128048757-128048779 ATTACTAGGAAGTAAAAAGCAGG - Intergenic
1198522042 X:137462853-137462875 GTTGCTATAAAGTAGAAGGCTGG + Intergenic