ID: 1101421067

View in Genome Browser
Species Human (GRCh38)
Location 12:104551566-104551588
Sequence CTGTGCCAGTGTAACTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101421063_1101421067 -2 Left 1101421063 12:104551545-104551567 CCTCCTCCTTTCCGACTTGCGCT 0: 1
1: 0
2: 0
3: 4
4: 113
Right 1101421067 12:104551566-104551588 CTGTGCCAGTGTAACTTAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1101421064_1101421067 -5 Left 1101421064 12:104551548-104551570 CCTCCTTTCCGACTTGCGCTGTG 0: 1
1: 0
2: 1
3: 3
4: 60
Right 1101421067 12:104551566-104551588 CTGTGCCAGTGTAACTTAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1101421062_1101421067 -1 Left 1101421062 12:104551544-104551566 CCCTCCTCCTTTCCGACTTGCGC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1101421067 12:104551566-104551588 CTGTGCCAGTGTAACTTAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 103
1101421065_1101421067 -8 Left 1101421065 12:104551551-104551573 CCTTTCCGACTTGCGCTGTGCCA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1101421067 12:104551566-104551588 CTGTGCCAGTGTAACTTAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101421067 Original CRISPR CTGTGCCAGTGTAACTTAGA AGG Intronic
901408172 1:9064126-9064148 CTGGGCCTGTGTACTTTAGAGGG + Intronic
902107476 1:14049878-14049900 CTGTGACAGTGTCACCCAGAGGG + Intergenic
904535049 1:31193882-31193904 CTGTGTCTTTGTTACTTAGAAGG + Intronic
909112083 1:71492025-71492047 CTGTGTCCTTGTACCTTAGAAGG - Intronic
910031106 1:82724812-82724834 CTGTGGCAGTGTAACAAAGTTGG + Intergenic
911483402 1:98474194-98474216 CTCTGCCTCTGCAACTTAGAAGG + Intergenic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
921617479 1:217286998-217287020 CTGTGCCAATGGAACTTTTAAGG + Intergenic
1063534862 10:6873427-6873449 CTGTGCGAGTGCAAGTTAAAAGG + Intergenic
1064800042 10:19060285-19060307 CTGTGCCGGTGTTTCTTTGAAGG + Intronic
1064972929 10:21084315-21084337 CTGTTACAGTGTAACTGAGGAGG - Intronic
1069586226 10:69604494-69604516 TTGAGCCAGTGCAAATTAGATGG + Intergenic
1071202233 10:83231905-83231927 CTTTGACACTGTAACTAAGAAGG + Intergenic
1071723000 10:88166174-88166196 CTGTGCCCATGTAAATTAGATGG - Intergenic
1078721264 11:13885316-13885338 AAGTGCCTGTGTACCTTAGAAGG + Intergenic
1080934334 11:36846397-36846419 CTTTGCCAGAGAAACTTAGTAGG - Intergenic
1084004646 11:66316543-66316565 CTGTGCCAGTTTGGCTTCGAGGG - Exonic
1092775411 12:11941138-11941160 CTGTGTCAGTCTAACTAAGCAGG + Intergenic
1095242798 12:39880668-39880690 ATGTGCCAATGGAACTTATAAGG + Intronic
1101042408 12:100770175-100770197 CAGTGTCAGTGTTTCTTAGAGGG + Intronic
1101421067 12:104551566-104551588 CTGTGCCAGTGTAACTTAGAAGG + Intronic
1102660637 12:114524581-114524603 CTGTGGTAGTGTAACAAAGATGG - Intergenic
1104287401 12:127436991-127437013 CTCTGCCAGTGTAAACAAGAAGG - Intergenic
1105291974 13:19059011-19059033 CTGTGCCAGTGTAGCTGGAAGGG - Intergenic
1108356376 13:49631933-49631955 ATGTGCCACTGTCACTCAGAAGG + Exonic
1108869848 13:54970592-54970614 ATGAGCCAGCATAACTTAGAAGG - Intergenic
1115429578 14:33300847-33300869 CTGAGCCAGGGCAGCTTAGAGGG - Intronic
1117590429 14:57262796-57262818 CTGTGACAGAGAAAATTAGAAGG - Intronic
1118457973 14:65961984-65962006 CTGTGCCTGAGAAACTTTGAAGG + Intronic
1123429827 15:20204653-20204675 CTCTGCCAGTCTGACTCAGAGGG - Intergenic
1123493017 15:20798129-20798151 CTCTTCCAGTGTCCCTTAGAAGG - Intergenic
1123549523 15:21367231-21367253 CTCTTCCAGTGTCCCTTAGAAGG - Intergenic
1127099434 15:55550274-55550296 CAGTTCCAGTGTCACTAAGAGGG - Intronic
1128058777 15:64720145-64720167 CTGTGCCACTGGAAGGTAGAAGG - Intergenic
1202957854 15_KI270727v1_random:94449-94471 CTCTTCCAGTGTCCCTTAGAAGG - Intergenic
1136854802 16:33646562-33646584 CTCTGCCAGTCTGACTCAGAGGG + Intergenic
1141145191 16:81524313-81524335 CTGTCCCACTGGAGCTTAGAGGG + Intronic
1141761857 16:86033775-86033797 CTGTGCCCATGCAGCTTAGAAGG - Intergenic
1203116377 16_KI270728v1_random:1495039-1495061 CTCTGCCAGTCTGACTCAGAGGG + Intergenic
1144677244 17:17169519-17169541 CTGGGCCAGTGTCACTAGGAGGG + Intronic
1144804019 17:17952053-17952075 CTGTTCCAGTATTACTTATAAGG + Intronic
1147639147 17:41983623-41983645 CTGTGTCCATGTAACTGAGAAGG + Exonic
1154450556 18:14472664-14472686 CTCTTCCAGTGTCCCTTAGAAGG - Intergenic
1157372031 18:47122693-47122715 CTGTGCCAGTGTGACATTGGAGG - Intronic
1164161334 19:22627360-22627382 CTGGGCCAGTGTCTCTCAGAAGG - Intergenic
925203908 2:1990761-1990783 CTGTTCCAGAGCACCTTAGAAGG - Intronic
925595043 2:5547317-5547339 CTGACCCAGTGTTTCTTAGAAGG + Intergenic
926351454 2:11999027-11999049 TTGTGCCAGTGTAGCTTGGCAGG + Intergenic
929801559 2:45108875-45108897 CTGTGGGAGTGCCACTTAGATGG - Intergenic
931833350 2:66074708-66074730 CTGTGCCAGGCTAACTTTGGGGG - Intergenic
932405556 2:71510722-71510744 CTGTGCCAGAGCCACTCAGAGGG + Intronic
935932774 2:108146816-108146838 CTTTGTCTGTGTTACTTAGAGGG - Intergenic
941537901 2:166744071-166744093 CTGAGCCAGTGCAACTCAGTCGG - Intergenic
943207286 2:184917169-184917191 GGGTGCCAGGTTAACTTAGAAGG - Intronic
943662015 2:190569178-190569200 CTGTGCATTTATAACTTAGATGG + Intergenic
943821176 2:192323610-192323632 CTGTGTCATTATAAATTAGACGG - Intergenic
945365732 2:208951117-208951139 CTTTGCCCGTGTAATTTATAAGG - Intergenic
1172809892 20:37639936-37639958 GTGTCCCAGTGTCACTTACATGG + Intergenic
1176445637 21:6817719-6817741 CTCTTCCAGTGTCCCTTAGAAGG + Intergenic
1176823804 21:13682752-13682774 CTCTTCCAGTGTCCCTTAGAAGG + Intergenic
1181859084 22:25804555-25804577 CTATGCTAATGTAACTAAGAAGG - Intronic
1182714464 22:32345864-32345886 CTGTGGCAATTTAAATTAGACGG - Intergenic
1183132322 22:35850518-35850540 CTGTTCCAGTCAAACTTGGAAGG + Intronic
949492887 3:4606286-4606308 CTTTGGCAGTGGAACTTTGAGGG + Intronic
951251892 3:20403640-20403662 CTATGACAGTGTAATTTGGAAGG - Intergenic
952906272 3:38141016-38141038 GTGTGCCAGGGGTACTTAGATGG + Intronic
955081757 3:55664310-55664332 ATTTGCCAGTGGAACTTAGAAGG - Intronic
962436504 3:135371846-135371868 CAGGGCCAGTGTAACTGACAGGG - Intergenic
963478806 3:145841265-145841287 CAGTTCCACTGTAATTTAGAGGG - Intergenic
964460890 3:156926222-156926244 ATGGGCCAGTTTATCTTAGATGG - Intronic
966861730 3:184234329-184234351 CTCTGCCAGTGTGACACAGATGG - Exonic
968844399 4:3031887-3031909 CTGTGCCTGGGTAACTGACATGG + Intronic
971459344 4:26878057-26878079 CTGAGACAGTGTAATTTATAAGG - Intronic
988166528 5:27597105-27597127 CTGTGACAGTGAATCTTACATGG - Intergenic
988831799 5:34995036-34995058 CTTTGCCAGTGAAAATTACAGGG - Intergenic
991047058 5:62233608-62233630 CTCTGCCAGTCTGACTCAGAGGG - Intergenic
999653814 5:153793624-153793646 CTGTTCAAGTGTGACTTATAAGG - Intronic
999902127 5:156096013-156096035 TTGTACCAGTGAAACATAGAAGG + Intronic
1004292236 6:14378258-14378280 TTTTGCCAGTCTAACTTATAGGG - Intergenic
1005909295 6:30294187-30294209 CTGGGCCATGGTAACTTACAAGG - Intergenic
1008799906 6:55354268-55354290 CTGTGCCAGTCCATCTGAGAAGG - Intronic
1010755871 6:79665701-79665723 CTGTGCTAGTGATACATAGATGG + Intronic
1011671845 6:89691051-89691073 CTGTGTCATTGTAATTTTGAAGG + Intronic
1014553878 6:122821974-122821996 CTGTGCCAGTGGCAGATAGAGGG + Intergenic
1015435754 6:133185163-133185185 CTGTGCCCCTTTAACTTTGAGGG + Intergenic
1021998646 7:26203133-26203155 CTCTCCCAGTGTAAATTACAGGG + Intronic
1023122221 7:36921200-36921222 CTGTCACAGCGTACCTTAGACGG - Intronic
1028704292 7:93820091-93820113 CTCTGCCAGGATAACTTAAAAGG + Intronic
1031488150 7:122354706-122354728 CTGTTCAATAGTAACTTAGAAGG - Intronic
1032321993 7:130894268-130894290 CTGTGCCGGTCTACCTTGGATGG + Intergenic
1033775605 7:144606934-144606956 CTGTGCCAGTGTACCTCAAAGGG - Intronic
1035011114 7:155715663-155715685 CTGTGTCAGTGTACCTCTGAAGG - Intronic
1039987586 8:42460806-42460828 GTGTGCCAGTGTTACATTGATGG - Intronic
1042340086 8:67669670-67669692 CTGTGTTACAGTAACTTAGAAGG + Intronic
1052218729 9:25995936-25995958 CACTGCCAGTGTAAGATAGAGGG - Intergenic
1055311172 9:74982279-74982301 CTGTGGCAATTTAAATTAGATGG - Exonic
1055419845 9:76127707-76127729 CTGTACCATTATAACTCAGAAGG - Intronic
1056482040 9:87015803-87015825 CTGTGTCAGTCTCACTGAGAAGG + Intergenic
1060141626 9:121215254-121215276 CTTTGCAAATGCAACTTAGATGG - Intronic
1203523558 Un_GL000213v1:66806-66828 CTCTTCCAGTGTCCCTTAGAAGG - Intergenic
1186872788 X:13789030-13789052 CTGTGCCAGTGGAGCAAAGATGG - Intronic
1190907945 X:54746721-54746743 CTGTCCCATTGTAGCTTAGGTGG + Intergenic
1192769142 X:74168859-74168881 CTGAGCCTGGGTAACTTATAAGG - Intergenic
1197605751 X:128583136-128583158 CTGTGCCATTGTAACATGTATGG - Intergenic
1198697180 X:139354682-139354704 CTCTGCCTGTGGAAATTAGAAGG - Intergenic
1199325015 X:146489166-146489188 CTGTGCCACTGTACCTGAGATGG + Intergenic
1201183146 Y:11369675-11369697 ATTTGCCTTTGTAACTTAGATGG - Intergenic
1201533550 Y:15020018-15020040 CTGTCTCAGTGTAACTGAGCAGG - Intergenic