ID: 1101422893

View in Genome Browser
Species Human (GRCh38)
Location 12:104564012-104564034
Sequence AGATCTACGTGGAGACACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101422891_1101422893 -6 Left 1101422891 12:104563995-104564017 CCTGGGACAGTTATTTGAGATCT 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1101422893 12:104564012-104564034 AGATCTACGTGGAGACACCCAGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101422893 Original CRISPR AGATCTACGTGGAGACACCC AGG Intronic
900195345 1:1373040-1373062 AGAGGAACGTGGAGACACCAGGG + Intergenic
900800811 1:4735885-4735907 AGATCACCGTGGAGACCCTCAGG - Intronic
901488682 1:9584207-9584229 AGGTTTACTTGCAGACACCCTGG + Exonic
902326651 1:15705147-15705169 ATATCTACGTGGAGACATCAAGG - Intronic
902491565 1:16786102-16786124 TGAGATAAGTGGAGACACCCTGG - Intronic
904393385 1:30200182-30200204 AGGTCTGGGTGGAGACACCAAGG - Intergenic
909488364 1:76198939-76198961 TGATCTACCTGGTGTCACCCAGG - Intronic
910589267 1:88912136-88912158 TGATCAACATGGAGAAACCCCGG - Intergenic
911189480 1:94933413-94933435 AAAGGTATGTGGAGACACCCTGG - Intergenic
923115773 1:230936115-230936137 ACAGCTAGGTGGAGACGCCCAGG + Intronic
923528882 1:234796440-234796462 TGAGATAAGTGGAGACACCCTGG + Intergenic
1068218059 10:54009600-54009622 AAATCCAGGTGGAGACACACTGG + Intronic
1090648509 11:128786237-128786259 AGATTTTCTTGGAGACACACTGG + Intronic
1091321958 11:134657915-134657937 AGATCTTCGTGCCCACACCCAGG - Intergenic
1092485687 12:8900512-8900534 TGACCAACGTGGAGAAACCCCGG - Intergenic
1095233570 12:39770890-39770912 AGATCTAGGCTGGGACACCCAGG + Intronic
1099621395 12:85006249-85006271 AGATTTAGGTGGAGACACAGAGG - Intergenic
1101422893 12:104564012-104564034 AGATCTACGTGGAGACACCCAGG + Intronic
1102162262 12:110779088-110779110 ATATCTACATGAAGACACGCAGG - Intergenic
1103552086 12:121745110-121745132 AGATCTTGGTGGACACACCTGGG - Intronic
1117653466 14:57930263-57930285 AGATTAACGTGGACAGACCCAGG + Intronic
1122079015 14:99254130-99254152 GGATCCAGGTGGGGACACCCAGG + Intronic
1129152215 15:73696306-73696328 AGAGCCACGTGGAGCCACGCAGG - Intronic
1130690930 15:86080770-86080792 AAATCTACATGGAGACCCCGGGG - Intergenic
1132630897 16:916862-916884 GGATCTGCGAGGGGACACCCGGG - Intronic
1136373554 16:29850940-29850962 AGGTCCACGTGGAGACATCAAGG - Intergenic
1142306318 16:89287914-89287936 AGAGCTCCGTGGAGAGCCCCTGG - Intronic
1142622669 17:1174915-1174937 AGATCTGCTTGGAGAATCCCAGG + Intronic
1145185135 17:20787493-20787515 AGGTGTAGGTGGAGACACTCCGG - Intergenic
1147238179 17:39072815-39072837 AGATCAGCCTGGAGACTCCCTGG + Intronic
1153807004 18:8717617-8717639 AGATGTAAGTGGAGACACACAGG - Intronic
1156088302 18:33435893-33435915 AGATCTACGTGAGGAAAACCAGG + Intronic
1156504356 18:37579660-37579682 AGCTCCACTTGGAGACAGCCAGG - Intergenic
1160418444 18:78727914-78727936 AGAGCTCCGTGGAGACAGGCAGG + Intergenic
1164069239 19:21750936-21750958 ACATCTACGAGGCGGCACCCGGG + Intronic
1167588324 19:50387711-50387733 TGATCTGCGAGGAGAGACCCGGG - Intronic
925246643 2:2389235-2389257 AAATCTAAGTGGAGGCTCCCAGG + Intergenic
926047642 2:9721527-9721549 ACATCAAAGTGGAGTCACCCAGG + Intergenic
933686636 2:85147054-85147076 AGTTCTAGGTGGAGATACACGGG + Intronic
935324114 2:101920497-101920519 AGATCTTCCTGGAGAAACTCAGG - Intergenic
937441172 2:121917533-121917555 AGGTCGACCTGGAGTCACCCAGG + Intergenic
944669302 2:201981881-201981903 AGGTCTGGGTGGAGAAACCCAGG - Intergenic
1170555508 20:17511911-17511933 AGCTGTACCTGGAGACTCCCAGG - Intronic
1171523642 20:25793874-25793896 AGAGCCACGTGGAGGCACACTGG + Intronic
1171553185 20:26062009-26062031 AGAGCCACGTGGAGGCACACTGG - Intergenic
1175520992 20:59602866-59602888 AGACCCACTTGGAGAGACCCTGG + Intronic
1176005930 20:62862119-62862141 ATACCTACGCGGTGACACCCTGG + Intergenic
1176238764 20:64066318-64066340 TCCTCTACCTGGAGACACCCAGG - Intronic
1184658432 22:45953869-45953891 AGTTCAACCTGGAGTCACCCAGG + Intronic
954111743 3:48437403-48437425 ACATCTAAGTGGTGACATCCTGG - Intronic
960632041 3:119742250-119742272 AGCTGTACTTGGATACACCCTGG + Intronic
960810442 3:121622783-121622805 AGCTCCACGTGGAGTCCCCCTGG - Exonic
964947398 3:162243057-162243079 AGATCCATGTGTACACACCCTGG + Intergenic
967694586 3:192515525-192515547 AGATTGACGGGGAGACGCCCAGG - Intronic
968695847 4:2026060-2026082 ATATCTAGGTGGAGGCTCCCAGG + Intronic
971887945 4:32476968-32476990 AGACCAACATGGAGAAACCCTGG + Intergenic
980363261 4:131765010-131765032 AGATCTCCGGGGAGACAGCGCGG + Intergenic
981527416 4:145720386-145720408 AGCTATACGGGGAGATACCCAGG + Intronic
986702440 5:10424105-10424127 ATATATACATGGAGATACCCAGG + Intronic
987150855 5:15038206-15038228 AGATATACGTGGAGATAACCTGG - Intergenic
990507196 5:56456333-56456355 AAATGTACGTGAAGACAGCCTGG - Intergenic
993450662 5:88069420-88069442 AGAGCTACATGGAGCCACACAGG + Intergenic
995180090 5:109222919-109222941 AGCTCTAAGTGGAGACTCTCAGG + Intergenic
998828084 5:146126021-146126043 AGAGCTATGCTGAGACACCCTGG + Intronic
1001928557 5:175657233-175657255 AGATCTCCGTGGAGGGAGCCTGG - Intergenic
1005357533 6:24998985-24999007 AGTGCTATGTGGAGTCACCCTGG - Intronic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1007589584 6:43013345-43013367 AGTTCTAGGAGGAGACACCATGG - Exonic
1015295149 6:131582643-131582665 AGATATACAGGGAGTCACCCAGG - Exonic
1018026934 6:159814043-159814065 AGAAAGAGGTGGAGACACCCCGG - Intronic
1018181500 6:161227289-161227311 AGACCTACCTGGTGACACCTTGG + Intronic
1018244312 6:161807377-161807399 AGAGCTACATGGACACACACAGG + Intronic
1019159190 6:170057946-170057968 AGCTCCACGTGGAGGAACCCAGG + Intergenic
1028548695 7:92032305-92032327 TGACCAACGTGGAGAAACCCTGG + Intronic
1037411673 8:18604912-18604934 AAATCTAGGTGGAGACTCCCAGG - Intronic
1038152638 8:24956447-24956469 GGCGCTACGTGGAGACGCCCCGG - Exonic
1041192184 8:55365513-55365535 TGACCAACGTGGAGAAACCCCGG + Intronic
1041963410 8:63646822-63646844 AGATCTATGTTGAGAAACACAGG + Intergenic
1044866295 8:96574244-96574266 AGATCTTCATGGGGAAACCCTGG + Intronic
1046592854 8:116226836-116226858 AGATCTATGGGGAGACTCCTTGG + Intergenic
1048297538 8:133225472-133225494 AGATCCGAGTGGAGACCCCCAGG - Exonic
1048535365 8:135289307-135289329 AGATCTTCTTGGAGAAACACTGG + Intergenic
1054908074 9:70428210-70428232 TGACCAACGTGGAGAAACCCCGG - Intergenic
1056787976 9:89606102-89606124 TGATCGACGTGGTGACGCCCCGG + Exonic
1059723100 9:116980693-116980715 AGATCTTGCTAGAGACACCCAGG - Intronic
1061759207 9:132838369-132838391 AGATCTAAGAGGAGTCAACCTGG + Intronic
1186262326 X:7792458-7792480 AGAGCTCAGAGGAGACACCCAGG + Intergenic