ID: 1101427403

View in Genome Browser
Species Human (GRCh38)
Location 12:104599311-104599333
Sequence TAAAAGTCTGCTTTTATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 226}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101427403_1101427413 15 Left 1101427403 12:104599311-104599333 CCCCCCATAAAAGCAGACTTTTA 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1101427413 12:104599349-104599371 GGCTTTTCACCGCGCGGTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 52
1101427403_1101427414 23 Left 1101427403 12:104599311-104599333 CCCCCCATAAAAGCAGACTTTTA 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1101427414 12:104599357-104599379 ACCGCGCGGTCCCGGAGCCATGG 0: 1
1: 0
2: 0
3: 5
4: 84
1101427403_1101427409 -10 Left 1101427403 12:104599311-104599333 CCCCCCATAAAAGCAGACTTTTA 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1101427409 12:104599324-104599346 CAGACTTTTAATGGATTCCATGG 0: 1
1: 0
2: 1
3: 18
4: 154
1101427403_1101427416 24 Left 1101427403 12:104599311-104599333 CCCCCCATAAAAGCAGACTTTTA 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1101427403_1101427412 9 Left 1101427403 12:104599311-104599333 CCCCCCATAAAAGCAGACTTTTA 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1101427412 12:104599343-104599365 ATGGTAGGCTTTTCACCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 27
1101427403_1101427410 -6 Left 1101427403 12:104599311-104599333 CCCCCCATAAAAGCAGACTTTTA 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1101427410 12:104599328-104599350 CTTTTAATGGATTCCATGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101427403 Original CRISPR TAAAAGTCTGCTTTTATGGG GGG (reversed) Intronic
902158974 1:14513728-14513750 TAAAATGCTGCTGTTATGGAGGG + Intergenic
902857148 1:19215982-19216004 TAAAATTTTGCTTTTAGGCGAGG - Exonic
903822793 1:26115900-26115922 TAAAAGTCTGCTTTTGGGCTGGG + Intronic
907527962 1:55064678-55064700 TAAATGTCTGCTTGCTTGGGTGG - Exonic
907564332 1:55420792-55420814 TAATTGTCTGCTTCTTTGGGTGG + Intergenic
907757556 1:57325448-57325470 TAAAAGTGTGCTTTGGTGTGAGG + Intronic
908489744 1:64631717-64631739 CAAAAGGCTGCTTTGATGGGAGG + Intronic
909039205 1:70629526-70629548 GAACAGTTTGCCTTTATGGGAGG + Intergenic
913180563 1:116317099-116317121 CAAAAGTCTGGGTTTATGAGAGG - Intergenic
914772095 1:150696904-150696926 TAAAATTATTATTTTATGGGAGG - Intronic
915226100 1:154412560-154412582 TAAAAGCCTATTTTGATGGGAGG + Intronic
916194405 1:162210110-162210132 TGAAAGACTGATTATATGGGAGG + Intronic
917494216 1:175525454-175525476 TAAATGTCTGCTTTCCTGCGTGG - Intronic
920393700 1:205628416-205628438 TATAAGACTGCTTATAGGGGTGG + Intronic
920630415 1:207646106-207646128 TAAGTGGCTGCTTTTTTGGGGGG + Intronic
920641209 1:207753059-207753081 TAAATGGCTGCTTTTTTGGGGGG + Intronic
1063064058 10:2590925-2590947 ATAAAGTCACCTTTTATGGGAGG + Intergenic
1063103177 10:2968907-2968929 TAATAGTCTGATTGAATGGGAGG + Intergenic
1064333952 10:14421555-14421577 TAAAAGGGTGCTTTTCTTGGAGG + Intronic
1064642804 10:17431438-17431460 TAAAAGTTTCGTTTTAAGGGGGG + Intronic
1066277002 10:33878976-33878998 TAATAGTCCACTTTTATGGGTGG - Intergenic
1070365755 10:75735277-75735299 TAAAAGTCTTTTGTTTTGGGGGG + Intronic
1070397554 10:76024735-76024757 TAAATGTCTCCTTTTCTGGTTGG + Intronic
1070674847 10:78405515-78405537 TGAGAGTCTGTTTTCATGGGAGG + Intergenic
1072368503 10:94740032-94740054 TAAAAGCCTGCTTTGTTGAGGGG + Intronic
1075128180 10:119717633-119717655 TAAAAATATGTTTTTATGTGTGG + Intergenic
1078590607 11:12637612-12637634 TAACAGGCTGCTTTTATGTGGGG + Intergenic
1080223155 11:29930370-29930392 GGAAAGTTTACTTTTATGGGAGG + Intergenic
1081446030 11:43132351-43132373 GAAATTTCTGCTTTCATGGGTGG - Intergenic
1085294983 11:75426392-75426414 GACAAGTCTCCTTTTTTGGGGGG + Intronic
1085521464 11:77141520-77141542 TAAAAGTATTCTTTTTTGGGTGG - Intronic
1085571470 11:77561461-77561483 TTAAAGTGTTCTTTCATGGGAGG + Intronic
1085908691 11:80795823-80795845 TTAAAGGCTGCTGTTATGGTGGG + Intergenic
1085945714 11:81269869-81269891 CACAAGTCTCCTTTTATTGGGGG + Intergenic
1091526261 12:1304364-1304386 TAAAAGTCTACTGTTGGGGGAGG - Intronic
1093938271 12:25024593-25024615 TTAAATTTTGCTTTTATGTGAGG + Intronic
1094337752 12:29380114-29380136 AAAAATTCTGATTTTTTGGGAGG - Intronic
1094747352 12:33360696-33360718 AAAAATTCTCCTTTTATGGAGGG - Intergenic
1097720384 12:63013492-63013514 AAGAAGTCTGCTTTTGTCGGTGG - Intergenic
1097969209 12:65614468-65614490 TGTAAGTCTGCATTTAAGGGAGG - Intergenic
1098832727 12:75382034-75382056 TCAAAGTTGGCTTTTATGTGTGG + Intronic
1098929169 12:76390396-76390418 TAAAAGTCTGCTATTTTTAGAGG - Intronic
1099474548 12:83092409-83092431 TAAGAGTTTCCTTTTATGGAAGG + Intronic
1099650708 12:85424487-85424509 TAAAATTCTATTTTTAGGGGAGG - Intergenic
1100188882 12:92168797-92168819 ACAAAGTCTGCTTTTCTGGGTGG - Intergenic
1100810975 12:98338026-98338048 TACAACTCTGATTTTATGGAAGG + Intergenic
1101427403 12:104599311-104599333 TAAAAGTCTGCTTTTATGGGGGG - Intronic
1102388502 12:112530913-112530935 TAAAAGCCTTCATTTTTGGGAGG + Intergenic
1104441724 12:128798691-128798713 CAAAACTCAGCTTTTATGAGTGG + Intronic
1105667011 13:22571063-22571085 GAAAACTCTGCATTTATAGGAGG - Intergenic
1106683315 13:32030935-32030957 GAAAAGACTGCATTTCTGGGAGG + Intergenic
1109683336 13:65782551-65782573 TGGAAGTCAGCTGTTATGGGGGG - Intergenic
1111323015 13:86655193-86655215 AAAAACTCTGCTTTTTTGGGGGG + Intergenic
1112609454 13:100941714-100941736 TAGAAGTCTGATTGTAGGGGAGG + Intergenic
1112732092 13:102375588-102375610 AATAAGACTGCTTATATGGGAGG + Intronic
1113479668 13:110611203-110611225 TAAAAGTCTGTGGTAATGGGGGG + Intergenic
1117189526 14:53276732-53276754 GAACAGTTTGCCTTTATGGGAGG - Intergenic
1117776909 14:59192213-59192235 TAAAAGGCTGCTTTTAGTGTTGG + Intronic
1117863577 14:60120462-60120484 AAAAGGTCTGCTTATATGGTTGG - Intronic
1118500432 14:66357141-66357163 TAAAAGTCAGTTGTTATTGGAGG + Intergenic
1118619080 14:67598332-67598354 CAAAAGCCTGCTTTTATGCCAGG - Intronic
1119520794 14:75283687-75283709 TAAATGTCCATTTTTATGGGAGG - Intergenic
1123631142 15:22260223-22260245 TAAGACTTTGCTTTTATGAGTGG + Intergenic
1125161212 15:36646714-36646736 TAAAAGTATGATTTTATGTCTGG + Intronic
1125762714 15:42108137-42108159 TAAGAGTCTGCTGTTGGGGGTGG + Intergenic
1127444743 15:59049457-59049479 ACAAAGTGTGCTTTTCTGGGTGG + Intronic
1127588083 15:60397365-60397387 TTAATGTCTTCTTTTATGGGGGG + Intronic
1128009464 15:64278720-64278742 TAAAAATCTACTTTTATGGCTGG - Intronic
1128237985 15:66080432-66080454 AAAGGCTCTGCTTTTATGGGAGG - Intronic
1128974004 15:72135035-72135057 AAAAAGTGTGCTTCTCTGGGTGG - Intronic
1132573780 16:655675-655697 TGAAGGTCTGCTTCTGTGGGTGG - Exonic
1133708952 16:8382575-8382597 TATAAGTTTGCTTTTATTGCAGG - Intergenic
1134663960 16:16004845-16004867 AAAAATTATGTTTTTATGGGGGG + Intronic
1138922631 16:61550823-61550845 TAAAAGTCTGCTTTTAACAAAGG + Intergenic
1140591125 16:76353899-76353921 TAAATGTTTGCTGTTATGGTAGG - Intronic
1141971871 16:87490287-87490309 TAAGACTTTGCTTTTATGAGTGG - Intronic
1142045411 16:87922202-87922224 TAAAATGCTAATTTTATGGGGGG - Intronic
1143384327 17:6518393-6518415 TAAAAGTAAGCTTTTTTGGGGGG - Intronic
1144001842 17:11062704-11062726 TAAAAGTCTGATGTGTTGGGAGG + Intergenic
1150316048 17:64170145-64170167 TTTATGTCTGCTTTTGTGGGTGG - Intronic
1152669759 17:81595838-81595860 TAAAAGTCCACTTTTTTGGCCGG - Intronic
1154179141 18:12115236-12115258 TAAAAGGGTGCTTTTATGAATGG - Intronic
1156597067 18:38559738-38559760 TTCAAGTCTGCTTTTCTGGAGGG - Intergenic
1159121467 18:64176324-64176346 TAAAAAACTGATTATATGGGGGG - Intergenic
1159999714 18:75005099-75005121 TAGAAGTTTATTTTTATGGGAGG - Intronic
1160178902 18:76617771-76617793 TAAAAATCTGGTTTTATGCTTGG + Intergenic
1160752712 19:742046-742068 TAAAATTCCGCCTTAATGGGAGG + Intronic
1162243967 19:9383328-9383350 AAAAACTCTCCTTTTTTGGGGGG + Intergenic
1166156828 19:40919682-40919704 TAAAAGTATGCGTTCCTGGGGGG + Intergenic
1166220796 19:41363342-41363364 TAAGAGTCTGCGTTAAGGGGTGG + Intronic
1166462622 19:43002652-43002674 TAAAAGCTAGCTTTTATGGAGGG + Intronic
925047757 2:787348-787370 TAAAAGGTTACTTTTATGTGTGG - Intergenic
928813606 2:35260476-35260498 TAAATGATTGCTTTTATGGAAGG - Intergenic
931466692 2:62494705-62494727 TAAAAGTCTACATTTTTGGCCGG + Intergenic
932189150 2:69724418-69724440 AAAAAGTCTTCTTTTATATGGGG - Intronic
935522439 2:104124218-104124240 CAAAAGTCATCTTTTCTGGGAGG + Intergenic
935708785 2:105879345-105879367 AAAAAGTTTGCTTTCATGGATGG + Intronic
936558866 2:113519259-113519281 GAAATTTCTGCTTTCATGGGTGG + Intergenic
936797150 2:116220604-116220626 TAAAATTATGCTTTTGTTGGTGG - Intergenic
939213131 2:139204044-139204066 TAAACCTGTGCTTCTATGGGTGG + Intergenic
939930880 2:148231270-148231292 TAAAATGCTCCTTTTTTGGGTGG + Intronic
940043293 2:149383364-149383386 TAAAATTCAGTTTTTTTGGGGGG + Intronic
940685326 2:156842421-156842443 TATATCTCTGCTATTATGGGTGG + Intergenic
940866172 2:158819651-158819673 TAAAAGTCTTCTTCAGTGGGTGG + Intronic
941000458 2:160197302-160197324 AAAAAGTCTGCTTTTCTGCGTGG + Intronic
941117986 2:161493697-161493719 TAAAATTGTTCTTTTTTGGGGGG - Intronic
941564728 2:167092496-167092518 TAAAAGTATTTTTTTCTGGGTGG + Intronic
943434578 2:187848619-187848641 TACCAGTCAGCTTTTATGGATGG + Intergenic
944096387 2:195973329-195973351 TGAAATTCTTGTTTTATGGGTGG + Intronic
944301839 2:198132440-198132462 TAAAAATGTGTTTTTTTGGGGGG + Intronic
944495517 2:200304252-200304274 TAAAACTCTGATTTTTTTGGGGG + Intergenic
946504337 2:220282783-220282805 TAAAAATGTGCCTGTATGGGAGG + Intergenic
946683444 2:222242123-222242145 TAAAAGACTAGTTTTATGAGGGG + Intronic
947050907 2:226042118-226042140 TAAAATTCTTCTTTGATGGATGG + Intergenic
947584677 2:231346972-231346994 TAAAACCCTGCTTTCATGAGAGG + Intronic
1174797576 20:53535112-53535134 TACAAGTCTGGTGTTTTGGGTGG + Intergenic
1177853031 21:26371238-26371260 GAAAAATCTGCTTTTATGTAGGG + Intergenic
1178140076 21:29672749-29672771 TAAATGTGTGTTTCTATGGGTGG - Intronic
1183797942 22:40135796-40135818 TAAAAGTCTGCTGCTTTGGTTGG - Intronic
1184713389 22:46266528-46266550 TAAAAGTAACCATTTATGGGAGG + Intergenic
949178844 3:1102028-1102050 TAAAAGTCTTCTTTTAAGGCGGG + Intronic
949603483 3:5628645-5628667 TAAAAATATGCTTTTCTGGCCGG + Intergenic
952172997 3:30830158-30830180 TAACAGCCTCCTTTTAGGGGAGG - Intronic
954913865 3:54132706-54132728 TAAAAATCTACTTTTAAGAGAGG + Intronic
955569162 3:60285381-60285403 TAAAAATGTACTTTTATGGGTGG - Intronic
955723436 3:61907498-61907520 TAAAAGTGTGTTTTTATGGAAGG + Intronic
956359568 3:68432546-68432568 TGAAAGTCTTGTTTTATGGTTGG - Intronic
956740511 3:72272108-72272130 TAAGAGCCGGCTTTTTTGGGAGG - Intergenic
956985674 3:74697136-74697158 TAAAAATCTGTCTTTATGGCAGG + Intergenic
957914711 3:86673534-86673556 AGAAAGTCTGCTTTCATGGAGGG - Intergenic
959159356 3:102705038-102705060 TACAGGTCTGCTTTTATGGGTGG + Intergenic
959197649 3:103205977-103205999 TAAAAATCAGCTTTTAGTGGAGG + Intergenic
964702685 3:159586381-159586403 TAAAAATTTGCTTTTATTGTTGG - Intronic
965473492 3:169124827-169124849 TAAAAGAATGCTTTCATGGTTGG - Intronic
969240920 4:5896897-5896919 TAAATGTCTGCTTTTTTCTGTGG + Intergenic
969296856 4:6275434-6275456 TAAATGGCTGCTTTTGTGGAAGG + Intronic
969303438 4:6310823-6310845 TAAAGATCTGCTTTTCAGGGTGG + Intergenic
970337958 4:15071958-15071980 TAAAAGTTGCCTTTTATGAGTGG - Intergenic
971874660 4:32291229-32291251 AAAAAGTATGCATTTAGGGGTGG + Intergenic
972048247 4:34695568-34695590 TAAGAGTCTGCTTCTACTGGAGG + Intergenic
972913184 4:43844803-43844825 GAAAAGTCTACCTTTATGGTGGG + Intergenic
974010595 4:56603431-56603453 TAAAGGTCTCATTTTGTGGGAGG - Exonic
974625658 4:64425566-64425588 AAAAAGTATGCTTTTATGTACGG - Intergenic
975444632 4:74447836-74447858 TCAAAGTGTGCTTTTCTGTGAGG + Intronic
977342952 4:95783234-95783256 TAAAGGACTGAATTTATGGGTGG - Intergenic
977795990 4:101165292-101165314 AAAAAGACTGCCTTTATGGAAGG - Intronic
977796059 4:101166360-101166382 TAAAAATCTGCTTTTTGGGTTGG - Intronic
979016034 4:115434752-115434774 AAAAATGCAGCTTTTATGGGTGG + Intergenic
980382340 4:132039047-132039069 TAAAAGTCACCTTTTATAGTTGG - Intergenic
980469007 4:133226530-133226552 TTAAAGTCCACTTTTATGGAAGG + Intergenic
983614788 4:169690721-169690743 TAAAAGTTGGCTTTTCTGGAGGG + Intronic
984385529 4:179052187-179052209 TAAATGTCTGTTATTATGGGTGG - Intergenic
984525458 4:180853124-180853146 TAACAGTCTTCTTTTTTTGGGGG - Intergenic
985143479 4:186867200-186867222 TGAGAGTCTGATCTTATGGGAGG - Intergenic
986623888 5:9705860-9705882 TAAAAGTCTTTTTTTGGGGGGGG - Intronic
987358130 5:17083126-17083148 TAAAAGTTTGCTCTTCTGGTAGG - Intronic
988938232 5:36113013-36113035 TAAAAGTATTATTTTAAGGGAGG + Intronic
991595514 5:68301229-68301251 TAAAATACTGGTATTATGGGTGG + Exonic
991730772 5:69585471-69585493 TAAAAGTCTGTATTTTTGGCCGG - Intronic
991807208 5:70440633-70440655 TAAAAGTCTGTATTTTTGGCCGG - Intergenic
991864178 5:71042385-71042407 TAAAAGTCTGTATTTTTGGCCGG + Intronic
991994501 5:72374001-72374023 GAAAAGTCTTATTGTATGGGTGG - Intergenic
992004740 5:72466331-72466353 TAACAGTCTGCTTTGATGAATGG + Intronic
992843623 5:80721691-80721713 TTAAAGTCTCTTTTTATGGCAGG + Intronic
993681810 5:90887320-90887342 TAAATGTCGCCTTTTATGGAGGG + Intronic
993794403 5:92249124-92249146 AAACAGTCTGCTTTTCTGTGGGG - Intergenic
994234550 5:97346167-97346189 TACTAGTTTGCTTTTTTGGGGGG + Intergenic
994931480 5:106192061-106192083 TAAAAATCTGTTTTTTTGGTTGG + Intergenic
994939008 5:106295526-106295548 TAATAATATGCTTTTAAGGGTGG + Intergenic
995688097 5:114793460-114793482 TTATAGTCTGCTATTTTGGGAGG - Intergenic
996867050 5:128136725-128136747 TAAAATTCTGCATTTAAAGGGGG - Intronic
997705517 5:135948331-135948353 TCAAAGTCTCCTATTATTGGTGG - Intronic
998126971 5:139630837-139630859 TAAAAATCTGCTTTCTTGGCTGG - Intergenic
998242502 5:140460867-140460889 AAAAAGTCAGCATTTATGGTTGG - Intronic
999879126 5:155841546-155841568 TAAAACTCTGCCATTTTGGGGGG + Intergenic
1002960263 6:1907684-1907706 TGAAAGCCTGCTTCCATGGGAGG + Intronic
1004774153 6:18823500-18823522 AAAAAGGCTGCTTTTAGGAGTGG - Intergenic
1007075422 6:39063162-39063184 TAGCAGCCTGCTTTGATGGGAGG - Intronic
1007540482 6:42638854-42638876 AAAAAGTCTAATTTTATGGGAGG + Intronic
1008197989 6:48548997-48549019 AAAAAGTCTGCTTTTAAAGAGGG + Intergenic
1008525100 6:52399711-52399733 TACCAGTCTGATTTTATGGCTGG - Intronic
1009573466 6:65420730-65420752 TAAAAATATTCTTTTATTGGTGG + Intronic
1011262925 6:85487337-85487359 TTAATGTCTGCTTTTATGCTTGG - Exonic
1011581507 6:88871903-88871925 GAAATGTTTGTTTTTATGGGGGG - Intronic
1012615324 6:101270892-101270914 TTAAAGTCTGTTTTTATGATGGG - Intergenic
1013500694 6:110747802-110747824 AAAAAGTCTGGTTTTATGTCTGG - Intronic
1013617294 6:111856875-111856897 TAAAAGTGTGCCTTTATTGGGGG - Intronic
1014231336 6:118905802-118905824 GAAAAGTCTGGTTTTACTGGTGG - Exonic
1014720781 6:124915676-124915698 ATAATTTCTGCTTTTATGGGTGG + Intergenic
1014787143 6:125632209-125632231 AAAATGTCTGATTTTCTGGGCGG + Intergenic
1015272579 6:131352613-131352635 TAAACTTCTGATTTTATGGTCGG - Intergenic
1015356028 6:132277956-132277978 TTAAAGTATTCTTTTTTGGGGGG + Intergenic
1016896098 6:149054563-149054585 TAAAACTCTGCTATTGTCGGGGG + Intronic
1017066656 6:150535317-150535339 TAGCAGTCAGCATTTATGGGGGG - Intergenic
1020153000 7:5697809-5697831 GAAAAGTAGGTTTTTATGGGAGG + Intronic
1021450094 7:20777010-20777032 TTAAACTTGGCTTTTATGGGTGG - Intronic
1021477880 7:21083221-21083243 TAAAAGTATACTTTTAAGGTAGG - Intergenic
1021853496 7:24831456-24831478 TAAAGTTCTGCTTTTTTGGGAGG + Intronic
1023467297 7:40470075-40470097 TAAAGGCCTTCTTTTTTGGGAGG + Intronic
1029081406 7:97976693-97976715 AAAAAGTCAGCTTTTTTTGGTGG - Intergenic
1030319139 7:108145978-108146000 TTAAACTGTGCTTTTTTGGGGGG + Intergenic
1030828345 7:114189059-114189081 TAAAATTCTGATTTTCTGGGTGG - Intronic
1031515258 7:122691666-122691688 GAACAGTCTGCCTTCATGGGAGG - Intronic
1032254125 7:130283590-130283612 TAAAAGTCTGTTAGAATGGGTGG - Intronic
1032635601 7:133704647-133704669 TGTGAGTGTGCTTTTATGGGAGG + Intronic
1033018543 7:137697753-137697775 AAAGATTCTGCTTTTATTGGAGG + Intronic
1039954877 8:42199480-42199502 GAAAATTCTGCTCTGATGGGTGG - Intronic
1040409444 8:47139374-47139396 TAAAATTGTGATTTTTTGGGGGG + Intergenic
1041004506 8:53485570-53485592 GAACAGTTTGCTTTCATGGGAGG + Intergenic
1041154544 8:54971864-54971886 AAAAAAACAGCTTTTATGGGTGG - Intergenic
1044536113 8:93357768-93357790 TTCAAGTCTACTTTTAAGGGTGG + Intergenic
1045997912 8:108384846-108384868 AAAAAATCCGCTTTTATGGTAGG - Intronic
1046189230 8:110768561-110768583 TAAAATGCTCCTTTTATGGCAGG - Intergenic
1047993718 8:130313626-130313648 GAAACGTCTGCTTTTCTGTGAGG - Intronic
1048610677 8:136019509-136019531 TCAAAGTGTGCTCTTATGAGTGG + Intergenic
1048639132 8:136333482-136333504 TAAAATTATGTTTTTATGGTAGG + Intergenic
1048874268 8:138824595-138824617 AAAATGTCAGCTTTTAAGGGTGG + Intronic
1049893984 9:96922-96944 GAAATTTCTGCTTTCATGGGTGG - Intergenic
1050355869 9:4782173-4782195 AAAAAGTCTGCTTTTGTGCTTGG - Intergenic
1051538409 9:18186539-18186561 GCAAAGTCTACTTTTATGGTGGG - Intergenic
1051736303 9:20202604-20202626 TAAAAGTTGGCTTTGATTGGTGG + Intergenic
1052116734 9:24657806-24657828 TAAAATTTTACTTTTATGGCTGG + Intergenic
1053735212 9:41097006-41097028 GAAATTTCTGCTTTCATGGGTGG - Intergenic
1054693168 9:68334391-68334413 GAAATTTCTGCTTTCATGGGTGG + Intronic
1055648440 9:78383082-78383104 TTAATGTCTGAGTTTATGGGTGG + Intergenic
1056649636 9:88447663-88447685 AAAAAGTCTGCATTTGGGGGAGG - Intronic
1056904495 9:90633408-90633430 CAAAAGACAGGTTTTATGGGAGG + Intronic
1057712463 9:97458960-97458982 TAAAATTCTGTTCTTCTGGGTGG + Intronic
1058323952 9:103672075-103672097 GAAAAATGTGCTTTTTTGGGGGG - Intergenic
1059926271 9:119212295-119212317 TAGAACTCTGCTTTTATCTGTGG + Intronic
1060679649 9:125550491-125550513 AAAATGTGTGCTTTTATGGTAGG + Intronic
1185789038 X:2914535-2914557 TAAAAGTCTGCATTTTCAGGTGG - Intronic
1188860549 X:35251035-35251057 GAAAAGTCTGATTTTCAGGGAGG - Intergenic
1190089616 X:47426410-47426432 GAAAATTCTGCTTTTATGATGGG + Intergenic
1191764668 X:64684396-64684418 TATAAGTCTGCTTTTCTGCATGG + Intergenic
1191844345 X:65535230-65535252 AAAAAATCTGCTTTTGTGGCAGG + Intergenic
1193231178 X:79048567-79048589 TAACAGTCTTTTTTTAGGGGTGG - Intergenic
1193369289 X:80674846-80674868 TAAAACTTTGCTTTTTTGGTAGG - Exonic
1194665457 X:96672872-96672894 TGAAAGTCTGCTTTAAGGGCTGG - Intergenic
1194780057 X:98013117-98013139 TGGAAGTCTGCTTTTACTGGGGG - Intergenic
1195995450 X:110727019-110727041 TAAAATCCTGCTTTCATTGGAGG + Intronic
1196381731 X:115098477-115098499 AAAAAGTCTGGTTTCCTGGGTGG - Intergenic
1197498246 X:127212226-127212248 TAAAAGACCAGTTTTATGGGTGG + Intergenic
1197651358 X:129068416-129068438 TAAAAGTCTCCTTTTAATTGTGG - Intergenic
1197829280 X:130624559-130624581 AAATAGTCTGCTTTTAAAGGAGG - Exonic
1199461562 X:148091142-148091164 TAAAGGTCTGCTTTTTGTGGTGG + Intergenic
1200916635 Y:8576882-8576904 TGAAAGTCTGCATGTATGCGTGG + Intergenic