ID: 1101427404

View in Genome Browser
Species Human (GRCh38)
Location 12:104599312-104599334
Sequence TTAAAAGTCTGCTTTTATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 310}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101427404_1101427412 8 Left 1101427404 12:104599312-104599334 CCCCCATAAAAGCAGACTTTTAA 0: 1
1: 0
2: 2
3: 36
4: 310
Right 1101427412 12:104599343-104599365 ATGGTAGGCTTTTCACCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 27
1101427404_1101427416 23 Left 1101427404 12:104599312-104599334 CCCCCATAAAAGCAGACTTTTAA 0: 1
1: 0
2: 2
3: 36
4: 310
Right 1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1101427404_1101427410 -7 Left 1101427404 12:104599312-104599334 CCCCCATAAAAGCAGACTTTTAA 0: 1
1: 0
2: 2
3: 36
4: 310
Right 1101427410 12:104599328-104599350 CTTTTAATGGATTCCATGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 110
1101427404_1101427414 22 Left 1101427404 12:104599312-104599334 CCCCCATAAAAGCAGACTTTTAA 0: 1
1: 0
2: 2
3: 36
4: 310
Right 1101427414 12:104599357-104599379 ACCGCGCGGTCCCGGAGCCATGG 0: 1
1: 0
2: 0
3: 5
4: 84
1101427404_1101427413 14 Left 1101427404 12:104599312-104599334 CCCCCATAAAAGCAGACTTTTAA 0: 1
1: 0
2: 2
3: 36
4: 310
Right 1101427413 12:104599349-104599371 GGCTTTTCACCGCGCGGTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101427404 Original CRISPR TTAAAAGTCTGCTTTTATGG GGG (reversed) Intronic
902158973 1:14513727-14513749 CTAAAATGCTGCTGTTATGGAGG + Intergenic
903822792 1:26115899-26115921 TTAAAAGTCTGCTTTTGGGCTGG + Intronic
904927499 1:34060330-34060352 TTAAAAGTCAGCTGTCATGTTGG - Intronic
906012131 1:42537671-42537693 TTAAAAATCTGCATTTAGGTTGG + Intronic
906378345 1:45315424-45315446 TAAAAAGTCTGGTTTGATAGGGG + Intergenic
906967829 1:50476274-50476296 TTAAAACTTTTCTTTTATTGTGG - Intronic
909112705 1:71500012-71500034 TTAAAAGGCTTATTTAATGGAGG + Intronic
910353383 1:86325635-86325657 GTAAAAGTCTGATTTTATGGAGG - Intergenic
911226444 1:95310898-95310920 TTAAAAGGCTGATTTTTTTGTGG - Intergenic
911454115 1:98101833-98101855 TTAAATGTCTGCTTCTCTTGTGG + Intergenic
911702034 1:100964882-100964904 TTTAAAAACTGCTTTTATTGGGG - Intronic
913553152 1:119936478-119936500 CTAAAAATCTGCTTATTTGGGGG + Intronic
917049338 1:170901532-170901554 TTAATTTTCTGCTTTTTTGGGGG - Intergenic
919217945 1:194584449-194584471 ATAAAAGTTTACTTTTGTGGTGG + Intergenic
920119108 1:203642383-203642405 CTCACAGTCTGCTTTGATGGGGG + Intronic
920630414 1:207646105-207646127 TTAAGTGGCTGCTTTTTTGGGGG + Intronic
920641208 1:207753058-207753080 GTAAATGGCTGCTTTTTTGGGGG + Intronic
921512691 1:216051559-216051581 TTAAAAGTCTTATTCTCTGGGGG - Intronic
922617341 1:226969201-226969223 TAAAAAGTCTGCTATGATTGTGG + Intronic
924036956 1:239947422-239947444 TAAAATGTCTGATTTTATGTGGG - Intergenic
924133029 1:240932484-240932506 TTAAAACTTTGCTTTCATGTAGG + Intronic
924251971 1:242141811-242141833 TCAGAATTCTGCTTTTAAGGAGG + Intronic
924433652 1:244019778-244019800 TTAAAAATCTGCTTTTGGGCCGG + Intergenic
1063248342 10:4247502-4247524 TCAAAAATCTGCTTCTATGGAGG + Intergenic
1064562785 10:16609142-16609164 TTAAAAATCTGATTTTAGGCTGG - Intronic
1065542018 10:26780070-26780092 TTAGAAGTCTGCCTTAATGTAGG - Intronic
1066068062 10:31776864-31776886 TTTATACTCTGCTCTTATGGAGG - Intergenic
1066369679 10:34810043-34810065 TTGAAAATGTGCTTTTTTGGTGG - Intronic
1067390462 10:45858431-45858453 TTACAAATCTGCTTTTTTGTGGG + Intergenic
1067501003 10:46805389-46805411 TTACAAATCTGCTTTTTTGTGGG - Intergenic
1067593579 10:47534526-47534548 TTACAAATCTGCTTTTTTGTGGG + Intronic
1067640688 10:48042630-48042652 TTACAAATCTGCTTTTTTGTGGG + Intergenic
1067872814 10:49977636-49977658 TTACAAATCTGCTTTTTTGTGGG - Intergenic
1067908439 10:50318924-50318946 TTAAAAGTTTTTTTTGATGGAGG - Intronic
1068071822 10:52205522-52205544 TTAAAAGTGTGTTTTTTTGGTGG + Intronic
1068770172 10:60811961-60811983 TTAAAAGGCTCCTTTTTTGGAGG + Intergenic
1068932126 10:62602393-62602415 TTAAAAGTCAGATTTTATAAAGG - Intronic
1069277082 10:66605836-66605858 TTAAAAGTGTGTTTTTGTAGTGG - Intronic
1069732806 10:70630260-70630282 TTAAAATGCAGCTTTTATGTGGG + Intergenic
1070137651 10:73708659-73708681 TTACAAATCTGCTTTTTTGTGGG + Intergenic
1070577778 10:77692748-77692770 TTAAAATTTTACTTTTTTGGAGG - Intergenic
1071041857 10:81319140-81319162 TTAAAAGTTTTCTTTTAATGTGG + Intergenic
1071148507 10:82603738-82603760 TTAAAAAGTTGCTTTTATGTAGG + Intronic
1071987547 10:91067571-91067593 TTAAAATTCTGCCTTTTTTGAGG + Intergenic
1072037570 10:91577574-91577596 TTTAAAGTCTGCTCACATGGTGG - Intergenic
1072162590 10:92782285-92782307 TTAAAATCCTTCTTTTAGGGTGG + Intergenic
1072368502 10:94740031-94740053 TTAAAAGCCTGCTTTGTTGAGGG + Intronic
1077713158 11:4555762-4555784 TTTAAAGTCTTCTATTTTGGTGG - Intergenic
1078458607 11:11495600-11495622 TTTAAAGTCTGCTTGAATGGAGG - Intronic
1078521860 11:12070011-12070033 TTAAAAGGCTGGTTGTTTGGGGG + Intergenic
1078564713 11:12404493-12404515 TTCAAATTCTGCTTCTGTGGAGG - Intronic
1078590606 11:12637611-12637633 TTAACAGGCTGCTTTTATGTGGG + Intergenic
1079841670 11:25409085-25409107 TCAAAAGTCTTCTTTTCTAGAGG - Intergenic
1080243725 11:30156309-30156331 TTAAAAGTGTGTGTGTATGGGGG - Intergenic
1082194835 11:49290927-49290949 TTAAAAGTCTGTGATTCTGGAGG + Intergenic
1083894805 11:65614440-65614462 TCAAAAGCCTGCTGTGATGGGGG - Intronic
1083945915 11:65922493-65922515 TTAAAGGTCTGCTGGCATGGTGG + Intergenic
1085908690 11:80795822-80795844 TTTAAAGGCTGCTGTTATGGTGG + Intergenic
1085945713 11:81269868-81269890 TCACAAGTCTCCTTTTATTGGGG + Intergenic
1086296912 11:85379291-85379313 TTAAAAGTCAGCTGTTAGGGAGG - Intronic
1086661098 11:89418642-89418664 TTAAAAGTCTGTGATTCTGGAGG - Intronic
1087098873 11:94346579-94346601 TGGCAAGTCTGCTTTTCTGGGGG + Intergenic
1087161745 11:94954849-94954871 TGAAAATGCTGCTTTTATGTGGG - Intergenic
1089090289 11:115869158-115869180 TTAAAATTTTGCTTTTGTAGGGG + Intergenic
1092565520 12:9660997-9661019 TTTAAACTCTTCTTTTATAGGGG + Intergenic
1092653902 12:10664735-10664757 TTCTAAGTCTGCTTTTTTGGGGG - Intronic
1093976963 12:25433772-25433794 ATTAAAATCTGCTTTTATGGAGG - Intronic
1094704949 12:32905399-32905421 TGAATAGTATGCTTTTATTGTGG + Intergenic
1094747353 12:33360697-33360719 AAAAAATTCTCCTTTTATGGAGG - Intergenic
1094868124 12:34563987-34564009 TTAAAGCTTTCCTTTTATGGAGG - Intergenic
1095668117 12:44826228-44826250 TTATTAGTCTGGTTATATGGGGG - Intronic
1096174077 12:49500475-49500497 TTTAAAGTCTCCTTTTAGGCCGG + Intronic
1099298104 12:80856363-80856385 TCAAATATCTGCTTTAATGGTGG - Intronic
1100222235 12:92517688-92517710 TTAAAAGTCTAGTTTTAAGTGGG - Intergenic
1100935076 12:99655044-99655066 GTAAAAGTTTGCTTTTATTAAGG - Intronic
1101427404 12:104599312-104599334 TTAAAAGTCTGCTTTTATGGGGG - Intronic
1102827996 12:115966873-115966895 TTAAAAGTCTCTGTTTATGCTGG + Intronic
1103708490 12:122894459-122894481 TTAAAAGAGAGCTTGTATGGAGG - Intronic
1104781957 12:131427742-131427764 TTAAAAGTTTGAATTTATAGTGG - Intergenic
1106361239 13:29032772-29032794 TTAACAGTATTCTTTAATGGGGG - Intronic
1108558624 13:51621142-51621164 TTAAAAGTATGCGTTTGTGTAGG - Intronic
1108617060 13:52143518-52143540 TTAAAAGTCTGTTTATACGATGG + Intronic
1109749791 13:66674133-66674155 TTAAACATCTGGTTTGATGGTGG - Intronic
1110898527 13:80789412-80789434 TTAAAAATCTGCTTTTAATTAGG - Intergenic
1111323014 13:86655192-86655214 GAAAAACTCTGCTTTTTTGGGGG + Intergenic
1111336554 13:86833089-86833111 TTATATGTCTGTTTTTATGCTGG - Intergenic
1111455225 13:88474087-88474109 TTAAAATTCTGGTTTTATTGTGG - Intergenic
1111647697 13:91051373-91051395 TTAAAAGCCTGCTTTTATCTAGG + Intergenic
1113055937 13:106268065-106268087 TTAAAAGACTGCCATTGTGGTGG + Intergenic
1113405379 13:110034012-110034034 TTAAAATTCTCCTTTTTTGGAGG + Intergenic
1114527166 14:23373677-23373699 GTAAAAGTCTGTATTTATGTTGG + Intronic
1115765456 14:36618391-36618413 TTCAAAGTCTGCTTCTCTGTTGG + Intergenic
1116268644 14:42730093-42730115 TTAAAAATTTGCTGTTATAGTGG - Intergenic
1116628024 14:47291943-47291965 TTAGAAGTTTGCTCTTATGTGGG - Intronic
1116647351 14:47546003-47546025 TTAAATGACTGGTTTAATGGTGG + Intronic
1117211393 14:53504212-53504234 TTAAAATTCCGTTTTAATGGAGG + Intergenic
1117317082 14:54581760-54581782 TTAAAATTCTGTTTTTAAAGAGG + Intronic
1117639475 14:57783099-57783121 TAAAAATGCTGCTTTTATGTGGG + Intronic
1118568339 14:67167450-67167472 TTAAGAGTCTGCTATTCTGTGGG + Intronic
1119945235 14:78686434-78686456 TTAATTGTCTGCTTTGATGGTGG + Intronic
1120177160 14:81306794-81306816 TTAATTGTCTGCTTTATTGGAGG - Intronic
1120811879 14:88812240-88812262 TTAGAAGTATGATTTTATAGTGG - Intergenic
1124112368 15:26803862-26803884 TTTAAAGTCAACTATTATGGAGG + Intronic
1124547633 15:30646324-30646346 TTAAATGTATGTTTTTATAGAGG + Intronic
1124810411 15:32931583-32931605 TTCACAGTTTGCTTTTTTGGGGG + Intronic
1126279959 15:46935139-46935161 TAAAAAGTCTGATTTTACTGTGG + Intergenic
1127588082 15:60397364-60397386 TTTAATGTCTTCTTTTATGGGGG + Intronic
1128504722 15:68259616-68259638 TTAAAAGTTTTTTTTTGTGGGGG - Intergenic
1129009256 15:72400327-72400349 TTAAAAATCTGTTAATATGGTGG - Intronic
1129204306 15:74026464-74026486 TTAAGAGTCAGCTTTTAGGCTGG - Intronic
1130074050 15:80673520-80673542 TTAAAAGTCTGCTTGTGTTTGGG - Intergenic
1132467688 16:85081-85103 TTAACAGTCTGGCTTTGTGGGGG + Intronic
1133364640 16:5201381-5201403 TTAACTGCCTACTTTTATGGAGG + Intergenic
1134381159 16:13727486-13727508 TTACCATTCTGCTTATATGGTGG - Intergenic
1134663959 16:16004844-16004866 TAAAAATTATGTTTTTATGGGGG + Intronic
1137013591 16:35349194-35349216 TTAAATGATAGCTTTTATGGAGG + Intergenic
1140896882 16:79332710-79332732 TTACAAGTCTCCTTTGATGGAGG + Intergenic
1141188647 16:81807506-81807528 ATAAATGTCAGCTCTTATGGTGG - Intronic
1143384328 17:6518394-6518416 ATAAAAGTAAGCTTTTTTGGGGG - Intronic
1143850076 17:9804353-9804375 ATAAAACTTTGCTTTTCTGGGGG - Intronic
1143992878 17:10981598-10981620 TCTAAATTCTTCTTTTATGGTGG + Intergenic
1146125506 17:30228251-30228273 TTAACAGTCTGCTTTTACACAGG - Intronic
1146205495 17:30901703-30901725 TTAAAATTCTGTTTTTTTAGTGG - Intronic
1148409885 17:47457108-47457130 TTAAAAACCTCCTTTTATAGTGG - Intergenic
1149182142 17:53951637-53951659 TTTAAAATTTGCTTTTATAGGGG - Intergenic
1149874787 17:60221238-60221260 TTAAAAATTAGCTGTTATGGTGG + Intronic
1150868933 17:68883213-68883235 TTAAAGGTCTGCTTTCATCTTGG + Intronic
1151357442 17:73568576-73568598 TTTAAAGTCTTCTTTTCTGCTGG - Intronic
1154245873 18:12697459-12697481 ATAAAAGTATTCTTTTATGTTGG - Intronic
1156427616 18:37031868-37031890 TTAGAAGTCTATTTTTATGCTGG + Intronic
1156597068 18:38559739-38559761 ATTCAAGTCTGCTTTTCTGGAGG - Intergenic
1157009508 18:43629441-43629463 TTAAAAATCTGTTTTTATCTGGG - Intergenic
1158402708 18:57135238-57135260 TGAAAAGCCTGATTTTCTGGGGG - Intergenic
1158643725 18:59224716-59224738 TTAAAAAGCTGCTGTTAAGGAGG - Intronic
1159297677 18:66517353-66517375 TTAAATGTCTTTTTTTTTGGAGG - Intronic
1159657512 18:71050020-71050042 TTAAAAGTTTGATTATATGGTGG + Intergenic
1161187620 19:2932352-2932374 TTAAAAGTTTTATTTTATAGAGG - Intergenic
1164269558 19:23659616-23659638 TTAAAAGTCTTCTTTTCAGAAGG + Intronic
1164812895 19:31171982-31172004 TTATAGGTCTGTTTTAATGGAGG + Intergenic
1166462621 19:43002651-43002673 CTAAAAGCTAGCTTTTATGGAGG + Intronic
1166529929 19:43535951-43535973 TAAAAAGTCTGCTACTATCGTGG + Intronic
925079150 2:1047878-1047900 TAAAATCTCTGCTTTTATGCTGG - Intronic
925380609 2:3422907-3422929 TCAAAAGTGTGCTTTTTTGGAGG - Intronic
926276829 2:11410212-11410234 TTAAATGTTTGCTTTTTAGGGGG + Intergenic
926900392 2:17745164-17745186 TTTACAGTTTGCTTTTTTGGGGG + Intronic
926980983 2:18567843-18567865 TTAAATGTCTACTTTAAAGGTGG + Intronic
927767538 2:25826127-25826149 TTATAAGTCTACCTTTATGATGG + Intronic
928191611 2:29175715-29175737 TTAAAAATATACTTTTATTGAGG + Intronic
930555485 2:52889956-52889978 CTAAAAATCTGATCTTATGGAGG - Intergenic
931456310 2:62412100-62412122 TTTAAACACTGCTTTTATGGTGG - Intergenic
931548699 2:63418156-63418178 TTAAAAGTCTGGTTTTTTCTAGG - Intronic
932531186 2:72534944-72534966 TTAAAAGTGTGATTTGAGGGAGG - Intronic
933201879 2:79460666-79460688 TTAAAAGTCTGGTGTTGTGCTGG - Intronic
934750174 2:96788976-96788998 TGTAAAGTCTTTTTTTATGGAGG + Intronic
935517247 2:104055862-104055884 TTAGAAACCTGCTTTTATGCAGG - Intergenic
936417324 2:112328191-112328213 TTATGTGTCTGTTTTTATGGAGG + Intronic
937604190 2:123777201-123777223 TTAAAAGTATGCTTTTGTGCTGG - Intergenic
938630620 2:133162971-133162993 TTATACTTCTCCTTTTATGGAGG - Intronic
939385834 2:141496364-141496386 TTAAAATTCTGCATTTCTAGAGG + Intronic
939617455 2:144377197-144377219 TTAAAAGAGTACTTTTAAGGAGG + Intergenic
940043292 2:149383363-149383385 TTAAAATTCAGTTTTTTTGGGGG + Intronic
940344474 2:152615058-152615080 ATTAATGTCAGCTTTTATGGTGG + Intronic
940845900 2:158642008-158642030 TTAGAATTCTGTTTTTTTGGTGG + Intronic
943312251 2:186340599-186340621 TTAAAATTTTGCCATTATGGAGG - Intergenic
943791410 2:191936711-191936733 TTTATAGTCTTCTTTAATGGAGG - Intergenic
944301838 2:198132439-198132461 TTAAAAATGTGTTTTTTTGGGGG + Intronic
944415519 2:199475735-199475757 TTAAAAGACTGCTTTCATTTAGG + Intergenic
944495516 2:200304251-200304273 TTAAAACTCTGATTTTTTTGGGG + Intergenic
945327383 2:208498331-208498353 TTTAAAGACAGCTTTTATGTAGG + Intronic
946377308 2:219319735-219319757 GTAAAGGTGTGTTTTTATGGTGG + Intergenic
946525263 2:220511636-220511658 ATAAAAGTCTGCTCCTAAGGTGG + Intergenic
947604004 2:231472055-231472077 TTAAAAATCTGATTTTAAGCAGG - Intronic
948206548 2:236165741-236165763 TTAAAAGACTGCTTTTGAAGGGG - Exonic
948354387 2:237366253-237366275 TAAAAAGTCAGCTTTGTTGGTGG + Intronic
1170166703 20:13367030-13367052 TTGAAAGGCTCCTTTTATGGAGG + Intergenic
1177051931 21:16247469-16247491 TTAAAAATCTGAATTTCTGGGGG - Intergenic
1177525927 21:22289571-22289593 TTAAAAGCCTGCTTTAAAGTAGG + Intergenic
1177853030 21:26371237-26371259 TGAAAAATCTGCTTTTATGTAGG + Intergenic
1178125500 21:29511625-29511647 CTAAAAGTCTGCTATTAATGTGG + Intronic
1178215316 21:30590765-30590787 TTTAAGGACTGCATTTATGGAGG - Intergenic
1178512732 21:33219356-33219378 TTAATTTTCTGCTTTGATGGTGG - Intergenic
1179337935 21:40475236-40475258 TTCAAAATCTGCTTTTATTTAGG + Intronic
1181859399 22:25806415-25806437 TTAGAAGCCTGCTCTTGTGGTGG + Intronic
1181970390 22:26685371-26685393 TTAAAAGTATCCTTTTATGAGGG + Intergenic
1183026946 22:35072299-35072321 TTTAGGGTCTGCTTTTTTGGGGG - Intronic
949178843 3:1102027-1102049 TTAAAAGTCTTCTTTTAAGGCGG + Intronic
949238767 3:1843895-1843917 TTAAAAGTCTGTTATCATTGTGG + Intergenic
949378731 3:3420546-3420568 TTAAAGGTATGCATTGATGGAGG - Intergenic
950068169 3:10130297-10130319 TTTAAAAACTGCTTTTATAGAGG - Intergenic
950876627 3:16280761-16280783 TTAAAAAGCTGGTTTTATGTAGG - Intronic
951969392 3:28426881-28426903 TTAAACTTCAGCTTCTATGGGGG + Intronic
955915163 3:63900435-63900457 TTAAGAGGCTGTTTTTAAGGTGG - Intronic
955984957 3:64563090-64563112 TTAAAAGTCTGGTTTCTTGTGGG - Intronic
956410027 3:68969489-68969511 GTAAAAGTCTGCTTTCCTGTTGG - Intergenic
957333810 3:78800194-78800216 TTAAAATTCTGCATATTTGGGGG + Intronic
957383469 3:79465246-79465268 TTAATAGTCTGTTTTAACGGTGG + Intronic
957914712 3:86673535-86673557 TAGAAAGTCTGCTTTCATGGAGG - Intergenic
958146030 3:89626146-89626168 TTAACAATGTGCTTTTATGTGGG - Intergenic
958188983 3:90159906-90159928 TAAAAAGTCTGCTTTTTCTGCGG - Intergenic
958603837 3:96332817-96332839 TTAAAAGACTACTCTTATAGTGG + Intergenic
958930265 3:100200007-100200029 TTTAAATTTTGCTTTTATGGGGG - Intergenic
959160487 3:102718108-102718130 TTAAAAATTTGATCTTATGGAGG - Intergenic
959501481 3:107110879-107110901 TTAAGAGTCTGTTTTTTCGGAGG - Intergenic
959678044 3:109059210-109059232 TTCAAAGTCTGATCTTATGTGGG + Intronic
959750547 3:109830174-109830196 TTAGAAGTATGCTCTTCTGGGGG + Intergenic
960196928 3:114780054-114780076 TTTAAAGTCTGGTTTTATTCAGG - Intronic
960645021 3:119870554-119870576 TTAAAATCCAGCTTTTAGGGTGG - Intronic
960689778 3:120333660-120333682 TTAAAAGTAGTCTTTTATGAGGG + Intronic
963465343 3:145673318-145673340 TTAAATGTGTGATTTTCTGGAGG - Intergenic
967737241 3:192965635-192965657 TTAAAAATCTCCTTTCATGATGG - Intergenic
968183020 3:196611137-196611159 TGAAAAGTTTGCATTTATGGTGG + Intergenic
969351919 4:6603129-6603151 TTAAAGGGGTGCTTTAATGGAGG + Intronic
970173216 4:13309555-13309577 CTAAAAATATGCTTTTATGTTGG - Intergenic
970450258 4:16159325-16159347 TGAAAAGTTTGCTTATAGGGAGG - Intergenic
971520895 4:27549027-27549049 TTAAAAGTCAGCTTTTAAGTAGG + Intergenic
972061103 4:34874549-34874571 TTTAAAGTCTGTTTTATTGGAGG - Intergenic
972913183 4:43844802-43844824 TGAAAAGTCTACCTTTATGGTGG + Intergenic
972915139 4:43867756-43867778 TTAATAGTGCCCTTTTATGGGGG + Intergenic
972963273 4:44479639-44479661 CTCAGAGTCTGCTGTTATGGTGG - Intergenic
974358397 4:60842727-60842749 TTAATACTCTGTTTCTATGGTGG - Intergenic
974452711 4:62087602-62087624 TTAAAAGTCTGGATTTATTTTGG + Intergenic
974552053 4:63388865-63388887 AGAAAAGTCTACATTTATGGGGG + Intergenic
975111592 4:70634494-70634516 TTCAAAGGCCGCTTTTGTGGTGG - Exonic
975717529 4:77219190-77219212 TTTAAAGTCTGCTTCTATTCAGG - Intronic
975849981 4:78562190-78562212 TTGAAAGTCTATTTTTTTGGTGG + Intronic
977058802 4:92229544-92229566 TTCAAAGTTTGCTATTTTGGTGG + Intergenic
977544543 4:98361794-98361816 TTAAAAATCTGCATTTAGGTGGG - Intronic
977765433 4:100792124-100792146 TTAATATGCTGGTTTTATGGTGG + Intronic
977849314 4:101806404-101806426 TTAATAGTCGTCTTATATGGAGG - Intronic
977855695 4:101888664-101888686 CTAAATGTCTACTTTTATAGAGG - Intronic
978609745 4:110524517-110524539 TTATAAATCTGCTTCTTTGGTGG - Intronic
978915949 4:114126248-114126270 TTAAAACTTTGATTTTTTGGCGG - Intergenic
980293395 4:130874131-130874153 TTTAAAATCTGTTTTTATGTGGG - Intergenic
980694675 4:136339264-136339286 TCATAAGTCTGTTTTTGTGGTGG - Intergenic
982336561 4:154246043-154246065 TTAAAAGACTTCTTTTAGAGTGG - Intronic
983614787 4:169690720-169690742 ATAAAAGTTGGCTTTTCTGGAGG + Intronic
983886921 4:172989868-172989890 TTAAAAATTGGCTTTTCTGGAGG + Intronic
984125928 4:175810497-175810519 TGAAAAGCTTTCTTTTATGGGGG - Intronic
984525459 4:180853125-180853147 TTAACAGTCTTCTTTTTTTGGGG - Intergenic
985808051 5:2062361-2062383 TTTAAAGTCTGCTTTATCGGAGG + Intergenic
987003392 5:13684421-13684443 TTCCAAGTCTGCGTTTATGTTGG - Intergenic
988985094 5:36610667-36610689 TTAAAAGTCTGTTTTTCTCTAGG + Intronic
990181218 5:53162833-53162855 TTCAATGCCTGCTTTTATGCTGG + Intergenic
991915622 5:71602093-71602115 TTCAAAGTCTCCTTTTAGGAGGG - Intronic
992992959 5:82303999-82304021 TTAAAAGTCAACTTTTATTTTGG + Intronic
993681809 5:90887319-90887341 TTAAATGTCGCCTTTTATGGAGG + Intronic
993685999 5:90938423-90938445 TGAAAAGTATGGTTTTTTGGAGG + Intronic
993701982 5:91129447-91129469 TTTAAAGTCTGCCTTTATTTTGG + Intronic
993802947 5:92366773-92366795 TTAAAGGTCTACGTTTATGTAGG - Intergenic
994400165 5:99269158-99269180 TTTGAATTCTGCTTTTGTGGGGG + Intergenic
994624591 5:102202397-102202419 TTAAAATAATGCTTTTAAGGTGG - Intergenic
995688061 5:114792934-114792956 TTAAAATTCTTTTTTTATGTAGG - Intergenic
996005589 5:118417518-118417540 TTAAAAGTATGCTTGTTCGGTGG - Intergenic
996622432 5:125523993-125524015 TTAAAAGTCAACTTTTTTTGTGG + Intergenic
997026221 5:130065139-130065161 TTTAAAGTGTTTTTTTATGGTGG + Intronic
998036239 5:138919256-138919278 TTAAAAGTGTGCTGTGAAGGTGG - Intronic
999879125 5:155841545-155841567 TTAAAACTCTGCCATTTTGGGGG + Intergenic
1000479442 5:161753453-161753475 TTAAAAGTCTTTTCTTCTGGAGG + Intergenic
1000951717 5:167492177-167492199 GTAAATGTCTGTTTTTATAGAGG + Intronic
1001652439 5:173325424-173325446 ATAGAAGTCTGCTCTTTTGGAGG + Intronic
1003347186 6:5281418-5281440 TTAAAAGTCATGTTTCATGGTGG + Intronic
1004297626 6:14428217-14428239 TTAAAAGTCTGATAATATGAAGG + Intergenic
1006011866 6:31049037-31049059 TTAAAAGTCCTGTTTTAGGGAGG + Intergenic
1008197988 6:48548996-48549018 TAAAAAGTCTGCTTTTAAAGAGG + Intergenic
1008836978 6:55845636-55845658 TTCAAAGGCTTCTTTTATGGTGG - Intronic
1008908707 6:56709517-56709539 TTAAAAGTCTGACATTATAGTGG + Intronic
1009822225 6:68817614-68817636 TTACAAGACTGCTTTTACAGAGG - Intronic
1010095187 6:72034545-72034567 TTAAAACTCTGTTTTTAAAGTGG + Intronic
1011465944 6:87657093-87657115 TTAAAAGTCTGCTTTGTTCCTGG - Intronic
1012615325 6:101270893-101270915 CTTAAAGTCTGTTTTTATGATGG - Intergenic
1012704291 6:102501474-102501496 TTAAGAGTTTGTTTTTATGTAGG + Intergenic
1013617295 6:111856876-111856898 TTAAAAGTGTGCCTTTATTGGGG - Intronic
1014780884 6:125563341-125563363 TAAAAAGCCAGCTTTTCTGGAGG - Intergenic
1014876048 6:126661386-126661408 ATAAAAGTCTGCCTTCATGAGGG - Intergenic
1014964183 6:127726193-127726215 TTAAATGTCTGACTTTCTGGAGG - Intronic
1015334738 6:132023986-132024008 TTAATAGTCTACTTTTAAGCTGG + Intergenic
1015534132 6:134249787-134249809 TGAAAGGTCTGCTTTCATGCTGG + Intronic
1016608853 6:145964965-145964987 TTTAAAGTCTGTTTTTGAGGGGG - Intergenic
1016797683 6:148135408-148135430 TTGGAAGTTTGCTTTTAAGGGGG + Intergenic
1020234553 7:6345742-6345764 TTTAAAATCTGTTTTTTTGGTGG + Intronic
1021444899 7:20722409-20722431 ATAAAAGTCTCCCTTTAAGGAGG + Intronic
1022077631 7:26988727-26988749 TTAAAAAGCTGTTTTTCTGGGGG + Intronic
1022629616 7:32072304-32072326 TTAAAAGGCTGCCTTTAATGGGG - Intronic
1023008124 7:35897210-35897232 GTCAAAGCCTGTTTTTATGGAGG + Intronic
1023218990 7:37899064-37899086 TTAAAAGTAAGCCTTTATGTTGG + Intronic
1023386560 7:39663728-39663750 TGAAAATTCAGCTTTTATGAGGG + Intronic
1025096952 7:56103440-56103462 TTTAAATTCTTCTTTTTTGGAGG - Intronic
1025574825 7:62623208-62623230 TTAAAAGTTTCTTTTGATGGAGG - Intergenic
1026842297 7:73676679-73676701 TTAGAAATCTGTTTTTATGGGGG + Intergenic
1027825647 7:83111830-83111852 CTTAATGTCTGCTTTTAAGGGGG + Intronic
1028215044 7:88121298-88121320 TTAAAAGTATGGGTTAATGGGGG + Intronic
1028216830 7:88143272-88143294 TTCAAAGTCAGCTTTAATGTTGG + Intronic
1028274593 7:88838909-88838931 TTAAAAGACTTTATTTATGGAGG - Intronic
1028995665 7:97097431-97097453 GTCAAAGTCTTATTTTATGGGGG + Intergenic
1030126804 7:106161368-106161390 TAATAAGTCTGTATTTATGGAGG + Intergenic
1030793736 7:113761227-113761249 CTAAAAGTCAGCATTAATGGGGG - Intergenic
1031221272 7:118968648-118968670 TTAAAAGAATGCTATTGTGGGGG + Intergenic
1032627991 7:133613805-133613827 TGAAAAGGCAGCTTTTATGTGGG + Intronic
1032704953 7:134413575-134413597 TGAAAGGTCTACTTTTAAGGTGG + Intergenic
1032773076 7:135079435-135079457 TTCATAGTCTACTTTTATTGTGG + Intronic
1035837942 8:2775675-2775697 TTAAATGTCTGTGTTGATGGTGG + Intergenic
1036047719 8:5162515-5162537 TTAAAAGTCAGCTTTAATCTAGG - Intergenic
1036103657 8:5815738-5815760 TTAAAACATTGCTTTTTTGGAGG + Intergenic
1036625327 8:10466434-10466456 TTCAAAGTCTGCTATTAAGAGGG - Intergenic
1036908265 8:12726979-12727001 TTAAAAGTTTATTTTTATTGTGG - Intronic
1038207644 8:25482570-25482592 TTAAAAGTATTCTTTTAGGTTGG + Intronic
1039144532 8:34431957-34431979 TTGAAAATATGATTTTATGGAGG + Intergenic
1040409443 8:47139373-47139395 TTAAAATTGTGATTTTTTGGGGG + Intergenic
1043112735 8:76208457-76208479 TTAAAAGAGTCATTTTATGGGGG - Intergenic
1043145287 8:76646718-76646740 CTATATGTCTGCTTTTATGCCGG - Intergenic
1044570766 8:93715925-93715947 TTAAAAGTATGCTCTGAAGGAGG - Intronic
1045424271 8:102048259-102048281 GCAATAGTCTGCTTTTATGGAGG - Intronic
1046004982 8:108468309-108468331 TTAAAACTTTGCATTTATTGTGG + Intronic
1046762401 8:118034901-118034923 TTCCAATTCTGCTTTTCTGGTGG - Intronic
1047557004 8:125942529-125942551 TTAAAAGATTGCTTTTATTTGGG - Intergenic
1047580557 8:126210270-126210292 TTAAATGCCTGGTTTTATGAGGG + Intergenic
1047867893 8:129048871-129048893 TGAAAATGCTGCTTTTATGTGGG + Intergenic
1050138275 9:2491109-2491131 TTAAAAGTATTCTTAAATGGTGG - Intergenic
1050572159 9:6951538-6951560 TTAAGAGTGTGTATTTATGGTGG + Intronic
1051050525 9:12927231-12927253 TTAAAGGTCTGCGTTGATGTTGG - Intergenic
1051107952 9:13602824-13602846 TTAAAAATTTGCTTTCATAGGGG + Intergenic
1051538410 9:18186540-18186562 TGCAAAGTCTACTTTTATGGTGG - Intergenic
1051602996 9:18892751-18892773 TTAAAAGCCTGCTGCTCTGGGGG - Intronic
1052495306 9:29216179-29216201 TTTACATTTTGCTTTTATGGGGG + Intergenic
1053099826 9:35362510-35362532 TTAAAAATCTGCATCTAGGGCGG + Intronic
1053570343 9:39298388-39298410 TTTAAAGTATGTTTTTTTGGAGG - Intergenic
1053836298 9:42139318-42139340 TTTAAAGTATGTTTTTTTGGAGG - Intergenic
1054091965 9:60857397-60857419 TTTAAAGTATGTTTTTTTGGAGG - Intergenic
1054113378 9:61132987-61133009 TTTAAAGTATGTTTTTTTGGAGG - Intergenic
1054126805 9:61320619-61320641 TTTAAAGTATGTTTTTTTGGAGG + Intergenic
1054594321 9:67049181-67049203 TTTAAAGTATGTTTTTTTGGAGG + Intergenic
1059199840 9:112404365-112404387 TTAAAAATCTTATTTCATGGCGG + Intronic
1059776071 9:117476373-117476395 ATTAAAGTCTGATTTTATTGGGG + Intergenic
1187583731 X:20637314-20637336 TAAAAACTGTGCTTTTATTGAGG - Intergenic
1188731966 X:33659752-33659774 TTAAAGGTTTCCTTTTTTGGTGG - Intergenic
1188778111 X:34247295-34247317 TTATAAGGCTGCTAATATGGTGG - Intergenic
1189712874 X:43832833-43832855 ATAAAAGTCTGTTTTTAAGTAGG - Intronic
1189815151 X:44817370-44817392 ATAAAAGTGGGCTTTTATGACGG - Intergenic
1189815153 X:44817375-44817397 ATAAAAGCCCACTTTTATGGTGG + Intergenic
1190089615 X:47426409-47426431 AGAAAATTCTGCTTTTATGATGG + Intergenic
1191572845 X:62654231-62654253 TTGAAACTCTCCTTTTATTGAGG + Intergenic
1192299368 X:69883794-69883816 TTAAAAATATGCTTTTTAGGGGG + Intronic
1194890269 X:99370726-99370748 TTAGAACTATTCTTTTATGGGGG - Intergenic
1195308947 X:103611266-103611288 TTAAAAGTCTGTTTTGATAAGGG - Intronic
1197062720 X:122200422-122200444 TTGAATGTCTGCTTTTATGCTGG - Intergenic
1197832319 X:130656703-130656725 TAAAAAGTATGCTTTTTAGGTGG + Intronic
1199152024 X:144498431-144498453 TTTCATGTCTGCTTTTATGCTGG - Intergenic
1200283752 X:154801406-154801428 ATAAGAATCTGCTTTTATTGTGG - Intronic
1202031474 Y:20578662-20578684 TTAGATGTCTGGCTTTATGGTGG + Intronic