ID: 1101427405

View in Genome Browser
Species Human (GRCh38)
Location 12:104599313-104599335
Sequence ATTAAAAGTCTGCTTTTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 1, 2: 5, 3: 25, 4: 378}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101427405_1101427412 7 Left 1101427405 12:104599313-104599335 CCCCATAAAAGCAGACTTTTAAT 0: 1
1: 1
2: 5
3: 25
4: 378
Right 1101427412 12:104599343-104599365 ATGGTAGGCTTTTCACCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 27
1101427405_1101427416 22 Left 1101427405 12:104599313-104599335 CCCCATAAAAGCAGACTTTTAAT 0: 1
1: 1
2: 5
3: 25
4: 378
Right 1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1101427405_1101427413 13 Left 1101427405 12:104599313-104599335 CCCCATAAAAGCAGACTTTTAAT 0: 1
1: 1
2: 5
3: 25
4: 378
Right 1101427413 12:104599349-104599371 GGCTTTTCACCGCGCGGTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 52
1101427405_1101427414 21 Left 1101427405 12:104599313-104599335 CCCCATAAAAGCAGACTTTTAAT 0: 1
1: 1
2: 5
3: 25
4: 378
Right 1101427414 12:104599357-104599379 ACCGCGCGGTCCCGGAGCCATGG 0: 1
1: 0
2: 0
3: 5
4: 84
1101427405_1101427410 -8 Left 1101427405 12:104599313-104599335 CCCCATAAAAGCAGACTTTTAAT 0: 1
1: 1
2: 5
3: 25
4: 378
Right 1101427410 12:104599328-104599350 CTTTTAATGGATTCCATGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101427405 Original CRISPR ATTAAAAGTCTGCTTTTATG GGG (reversed) Intronic
903102760 1:21047351-21047373 ATGAAAAGTCTGTCTTGATGTGG - Intronic
904150837 1:28438323-28438345 ATGAAAAGTTTGCTTTTGTCCGG + Exonic
906378344 1:45315423-45315445 ATAAAAAGTCTGGTTTGATAGGG + Intergenic
908275343 1:62464817-62464839 TGTGAAAGTCTGCTTATATGTGG + Intronic
908325475 1:63019237-63019259 AGTCAAAGTCTGCTTTTCTGAGG - Intergenic
909272393 1:73640250-73640272 ATTAAAACTTTTCTTTTTTGGGG - Intergenic
909880720 1:80874034-80874056 ATTAAATGTCGCCTTTTTTGAGG + Intergenic
910123010 1:83811044-83811066 ATTAAGCATCAGCTTTTATGTGG - Intergenic
910173718 1:84405290-84405312 ATTAAAATGCAGCTTTTATATGG - Intronic
910711575 1:90187434-90187456 ATTAAAAGTGGCCTTTTTTGTGG - Intergenic
911445762 1:97989943-97989965 TTTAAAAATCTGCTTTTAGTAGG - Intergenic
912905914 1:113707049-113707071 ACTAAATGTCTTCTGTTATGAGG + Intronic
913478296 1:119260237-119260259 ATTACAAGTCTCCTTTAAAGGGG - Intergenic
916613946 1:166420789-166420811 ATTAAAATTTGCCTTTTATGAGG - Intergenic
917049339 1:170901533-170901555 ATTAATTTTCTGCTTTTTTGGGG - Intergenic
917681091 1:177368439-177368461 ATTTCAATTCTGCTTTGATGGGG - Intergenic
917786075 1:178458646-178458668 ATTTAAAGGTTGCTTTTAAGAGG - Intronic
918293916 1:183136859-183136881 AGAAAAAGTCTGATTTTTTGTGG - Intronic
918990324 1:191690648-191690670 AATAAATGTTTGCTTTTATGTGG + Intergenic
919037784 1:192337772-192337794 TTTAAAAGTCAGCTTTTGGGAGG - Intronic
920887926 1:209951014-209951036 ATTCAAAGTATGTATTTATGGGG + Intronic
921477098 1:215624561-215624583 TTTAAATATCTGATTTTATGTGG + Exonic
921512692 1:216051560-216051582 ATTAAAAGTCTTATTCTCTGGGG - Intronic
922492228 1:226027212-226027234 ATTAAAAATATGCATATATGTGG - Intergenic
923746605 1:236706727-236706749 ATCAAAAAGCTGCTTTTATTAGG - Intronic
924036957 1:239947423-239947445 GTAAAATGTCTGATTTTATGTGG - Intergenic
1064770499 10:18717840-18717862 ATTAAAAGTCTGTTTTTATTGGG + Intergenic
1066344209 10:34566601-34566623 ATTTAAAACCTGCTTTTTTGCGG - Intronic
1067390461 10:45858430-45858452 TTTACAAATCTGCTTTTTTGTGG + Intergenic
1067501004 10:46805390-46805412 TTTACAAATCTGCTTTTTTGTGG - Intergenic
1067593578 10:47534525-47534547 TTTACAAATCTGCTTTTTTGTGG + Intronic
1067640687 10:48042629-48042651 TTTACAAATCTGCTTTTTTGTGG + Intergenic
1067872815 10:49977637-49977659 TTTACAAATCTGCTTTTTTGTGG - Intergenic
1068190327 10:53643273-53643295 ATGAAAAGTTAGCTTGTATGTGG - Intergenic
1068411180 10:56657336-56657358 TATAAATGTCTTCTTTTATGAGG + Intergenic
1068546368 10:58350660-58350682 GTTAAATCTCTGCCTTTATGGGG + Intronic
1068546904 10:58357586-58357608 ATTTAAAGTCTGTATTTTTGTGG + Intronic
1069328827 10:67265543-67265565 GTTTAAAGTCTGTTTCTATGGGG + Intronic
1069732805 10:70630259-70630281 TTTAAAATGCAGCTTTTATGTGG + Intergenic
1070137650 10:73708658-73708680 TTTACAAATCTGCTTTTTTGTGG + Intergenic
1070239438 10:74663335-74663357 ATAAAAACTCTGCTTTTATGAGG - Intronic
1070575701 10:77676931-77676953 ATTAAGGCTCTTCTTTTATGAGG - Intergenic
1071270944 10:84006810-84006832 ACTCAGAGTCTGCTTTTCTGGGG - Intergenic
1072028606 10:91492707-91492729 ATTAAAAGTAAACATTTATGAGG + Intronic
1072368501 10:94740030-94740052 CTTAAAAGCCTGCTTTGTTGAGG + Intronic
1073768964 10:106714348-106714370 ATTAAAATCTTGCTTTTATGAGG + Intronic
1074124650 10:110518395-110518417 TTTAAAAATCTGCTTTATTGAGG + Intergenic
1074155406 10:110794414-110794436 GTTAATAGTTTGCTTTTGTGTGG - Intronic
1074545226 10:114397085-114397107 TTTAAAAGTCAGCTTTATTGAGG + Intronic
1075063514 10:119273311-119273333 ATTAAAAGGGGGCTTTGATGGGG + Intronic
1075182984 10:120228539-120228561 TTTAAAAGACTGCTTTCCTGAGG + Intergenic
1076777457 10:132705651-132705673 TTTAAAAGTCTGCTTACCTGGGG + Intronic
1078590605 11:12637610-12637632 TTTAACAGGCTGCTTTTATGTGG + Intergenic
1079519244 11:21305342-21305364 AGTAAAAGTCTGCTATTTAGAGG + Intronic
1080078246 11:28178575-28178597 ATTAATAGTCTGGTTTTTTTTGG + Intronic
1080243726 11:30156310-30156332 ATTAAAAGTGTGTGTGTATGGGG - Intergenic
1080722229 11:34861197-34861219 ATGAAATTGCTGCTTTTATGAGG + Intronic
1080804562 11:35640746-35640768 GTTAAGAATCTGCTTTTTTGTGG + Intergenic
1082281136 11:50272604-50272626 ATTAAAAGTAAGCTTTTCTCTGG + Intergenic
1082752598 11:57035511-57035533 ATTAAATGTATGCCTTTCTGTGG - Intergenic
1083492916 11:63026335-63026357 ATTAAAAGTCTGATTCTTTTAGG + Intergenic
1084852456 11:71953331-71953353 ATTTAAAGTGTGCTATTCTGAGG - Intronic
1085489581 11:76902366-76902388 ATTGAAATGCAGCTTTTATGTGG - Intronic
1085774032 11:79349584-79349606 AAAAAACCTCTGCTTTTATGGGG + Intronic
1085886057 11:80523489-80523511 ATAAAAAGTCTGACTGTATGAGG + Intergenic
1086223473 11:84478930-84478952 ATTAAAACTCTTCATTTATGTGG - Intronic
1086587369 11:88470418-88470440 TTTAAAAGTCTGCCTCTAAGTGG + Intergenic
1087161746 11:94954850-94954872 TTGAAAATGCTGCTTTTATGTGG - Intergenic
1087321670 11:96668205-96668227 CTTAAAATTATGCTTTTGTGTGG - Intergenic
1087361287 11:97162878-97162900 ATCAAAAGTCTCGTTTTATCTGG - Intergenic
1087372009 11:97296144-97296166 ATTAATAGTCTGTTTTTCAGAGG - Intergenic
1087372016 11:97296377-97296399 ATTAATAGTCTGTTTTTCAGAGG - Intergenic
1088201656 11:107342818-107342840 ATTAAAAGTTTCCTTATAAGAGG + Intronic
1092030829 12:5283450-5283472 CTTAAAACCCTGCCTTTATGTGG - Intergenic
1092653903 12:10664736-10664758 TTTCTAAGTCTGCTTTTTTGGGG - Intronic
1093395347 12:18674515-18674537 ATTAAAATTCTGAGTTTAGGAGG - Intergenic
1094232805 12:28127407-28127429 ATTAAAGTTCTGTTTTTAGGGGG - Intergenic
1095738603 12:45584871-45584893 ATTAAAATTCTCCTTTACTGAGG - Intergenic
1097982305 12:65746918-65746940 ATAAGAAGTCTGCTGTGATGGGG - Intergenic
1098282813 12:68878880-68878902 ATTGCAATTCTGCTTTTTTGGGG - Intronic
1099048725 12:77757040-77757062 AATAAAACTTTGCTTTGATGGGG - Intergenic
1099182889 12:79487873-79487895 TTAAAAAGCCTGCTTTTCTGAGG + Intergenic
1099340948 12:81432981-81433003 ATTAAAGGTATGTTTTTGTGTGG - Intronic
1099578159 12:84406113-84406135 ATTAAACTTCTCTTTTTATGTGG - Intergenic
1099881784 12:88475870-88475892 TTTAAAAATAAGCTTTTATGAGG + Intergenic
1099982066 12:89615927-89615949 TTTAAATGTCTACCTTTATGAGG - Intronic
1100222236 12:92517689-92517711 TTTAAAAGTCTAGTTTTAAGTGG - Intergenic
1100442648 12:94630645-94630667 ATTAATATTCTACTTGTATGTGG + Intronic
1101341537 12:103846232-103846254 TTTACAAGACTGCTTTTAAGGGG + Intergenic
1101427405 12:104599313-104599335 ATTAAAAGTCTGCTTTTATGGGG - Intronic
1101909763 12:108852621-108852643 ATTGAAAGTCTGCTTACCTGAGG + Exonic
1103270661 12:119670409-119670431 ACAAAGAGGCTGCTTTTATGTGG + Intronic
1105532179 13:21230052-21230074 ATTAGAAGTCTTTTTTAATGAGG - Intergenic
1106878149 13:34098628-34098650 ATCAAAGTTCTGGTTTTATGTGG + Intergenic
1107466524 13:40655581-40655603 ATAAAATGTCTGCTTCTATAGGG + Intronic
1107983482 13:45755241-45755263 ATTAAAATTCTCCTTTGCTGAGG + Intergenic
1108085766 13:46790661-46790683 ATTGAAAGTCTGTTTTTAAAAGG - Intronic
1108785007 13:53889230-53889252 ATTAAAATTGTGTGTTTATGGGG + Intergenic
1110042680 13:70784789-70784811 ATTCAAAGACTTATTTTATGGGG - Intergenic
1110419336 13:75287811-75287833 ACTAAAACTCTGCTTCTATATGG - Intronic
1110554081 13:76838902-76838924 AATCCAAGTCTGCTTCTATGTGG + Intergenic
1111448465 13:88381840-88381862 ATTAATAGTCTAATTTTAAGTGG + Intergenic
1111535295 13:89595892-89595914 ATTAAAATTCTCCTTTGCTGAGG - Intergenic
1111740171 13:92194898-92194920 ATTCAAAGACTTCTTTTATCAGG + Intronic
1111875991 13:93896358-93896380 CTTAAAACTCTACTTATATGGGG - Intronic
1111886313 13:94026322-94026344 ATTGAAAGTATCCATTTATGTGG + Intronic
1112037417 13:95509613-95509635 GTTAAAAATCTGCTTATATTCGG - Intronic
1112098622 13:96163129-96163151 AGTAACATGCTGCTTTTATGAGG + Intronic
1112440138 13:99419134-99419156 ATTAAAAATCTGCTTTTCTTTGG + Intergenic
1113584332 13:111453398-111453420 TTTAAAAGACAGCTTTTTTGAGG + Intergenic
1114995359 14:28344085-28344107 CTTAAAAGGCAGCTTATATGTGG + Intergenic
1115716471 14:36110613-36110635 AATAAAAATATGCTTTTAAGGGG + Intergenic
1115787876 14:36846680-36846702 ATTAAAAGTCTGGTTTGCTGTGG - Intronic
1116028669 14:39544276-39544298 ATTACAAGTGTACTTTTAAGAGG - Intergenic
1116628025 14:47291944-47291966 TTTAGAAGTTTGCTCTTATGTGG - Intronic
1116867855 14:50045722-50045744 ATGAAAATTCAGCTTTTCTGTGG - Intergenic
1117480000 14:56133303-56133325 AATACAAGTCTGCTTTTTTTCGG + Intronic
1117639474 14:57783098-57783120 TTAAAAATGCTGCTTTTATGTGG + Intronic
1118233978 14:63983521-63983543 ATAAAAAGTCTGCTTTTATGAGG - Intronic
1118568338 14:67167449-67167471 TTTAAGAGTCTGCTATTCTGTGG + Intronic
1125097999 15:35876693-35876715 ATTTAAGGCATGCTTTTATGAGG - Intergenic
1125165511 15:36700060-36700082 ATGAAGTGTCTGCTTTCATGGGG + Intronic
1126856885 15:52847521-52847543 ATTCAAGGTCAGATTTTATGTGG + Intergenic
1126943241 15:53788955-53788977 ATAATAAGACTGGTTTTATGTGG - Intergenic
1127084680 15:55413773-55413795 AAAAAAAGACTGTTTTTATGGGG + Intronic
1127588081 15:60397363-60397385 TTTTAATGTCTTCTTTTATGGGG + Intronic
1128123801 15:65175178-65175200 ATTTTAAGTCTGCATTTATTTGG - Intronic
1130074051 15:80673521-80673543 TTTAAAAGTCTGCTTGTGTTTGG - Intergenic
1130264674 15:82389573-82389595 ATTAACTGTCTGTTTTTCTGAGG - Intergenic
1134663958 16:16004843-16004865 ATAAAAATTATGTTTTTATGGGG + Intronic
1139011683 16:62642602-62642624 GCTAAAAGTCTACTTTTAGGGGG + Intergenic
1140079732 16:71734362-71734384 ATTAAAGGTCTGGTTTTTGGGGG - Intronic
1140430250 16:74896678-74896700 ATTAATAATATGCTTTTATTAGG - Intronic
1140791250 16:78393217-78393239 AATAACAGTATGTTTTTATGAGG + Intronic
1141562344 16:84877867-84877889 ATTAAAAATCAGCTTTATTGAGG + Intronic
1142950313 17:3472862-3472884 ATTCAAGGTCTGCTATTATCTGG - Intronic
1143604108 17:7971307-7971329 ATGAAAAGTCAGCTTTTGGGTGG - Intergenic
1143850077 17:9804354-9804376 AATAAAACTTTGCTTTTCTGGGG - Intronic
1146577991 17:34011739-34011761 CTTAAAAGTCTGGTAATATGAGG - Intronic
1148400363 17:47354336-47354358 ATTCATAGTCTGCATTTATTGGG + Intronic
1148662483 17:49345977-49345999 AATAAAAGTCTGATATTTTGAGG - Intronic
1148740969 17:49892320-49892342 ATTAAATCTCTGCCTTTTTGGGG + Intergenic
1149018268 17:51933824-51933846 ATTATAAGACTGCTATTATGTGG + Intronic
1149044084 17:52224320-52224342 AGGAAAAGTCAGCTTTGATGGGG - Intergenic
1149269735 17:54965345-54965367 ATTAACATTCTGCTTTTCTAAGG + Intronic
1151642822 17:75408638-75408660 ATGAAAAGTCTGTTTGGATGTGG + Intergenic
1153080310 18:1215522-1215544 ATTAAAAGTCTTCATTTAAAAGG + Intergenic
1153180985 18:2432808-2432830 ATTTAAAATCTGCTTATCTGTGG + Intergenic
1153739500 18:8108664-8108686 ATGAAAAATCTGCATTTATATGG - Intronic
1154956830 18:21266761-21266783 ATTAATGTTCTGCTTTAATGTGG - Intronic
1155908518 18:31481847-31481869 ATTAAAAGTCTGGTTAAATAAGG - Intergenic
1156102153 18:33609350-33609372 TTCAAACGTCTGCTTTTAGGAGG - Intronic
1157009509 18:43629442-43629464 TTTAAAAATCTGTTTTTATCTGG - Intergenic
1157515982 18:48311778-48311800 ATTAAAAATTTGCTTTTATTTGG + Intronic
1158210607 18:55045399-55045421 ATGAAAAGTGTGCATTTATTTGG + Intergenic
1158744292 18:60180642-60180664 ATTAAAAGTCGGGTTTATTGTGG + Intergenic
1159069918 18:63612187-63612209 ATTAAAAGTTTACTTTTTTGTGG + Intergenic
1159381186 18:67661753-67661775 ATGACTAGTCTGCTTTTCTGTGG - Intergenic
1159758368 18:72393980-72394002 ATTAAAATTCTCCTCTGATGAGG - Intergenic
1159847662 18:73484450-73484472 ATTGCAAATCTGCATTTATGTGG + Intergenic
927048725 2:19305624-19305646 AGGAAAAGTTTGCTTTTATAAGG - Intergenic
928667892 2:33568993-33569015 ATTAAAATTTTGCTGTAATGTGG - Intergenic
928837150 2:35560291-35560313 ATTAAAAGTATGCTTTATTAAGG + Intergenic
929269730 2:39960081-39960103 ATTAAAATTCTCCTTTGCTGAGG + Intergenic
929927409 2:46226300-46226322 ATGAAAAGTATGCATGTATGTGG + Intergenic
931409752 2:62018055-62018077 AAAAAAAGTCTGACTTTATGTGG + Intronic
931504288 2:62907122-62907144 ATTAAAAGTTTTCTTTTCTCTGG + Intronic
931703841 2:64930599-64930621 AGTAAAAGCCAGCATTTATGAGG + Intergenic
932189152 2:69724420-69724442 AGAAAAAGTCTTCTTTTATATGG - Intronic
934039814 2:88118465-88118487 AATAAAAGGCTACTTTTGTGTGG + Intergenic
934961536 2:98679743-98679765 AATAAAAGTGGGCTTTGATGAGG + Intronic
935570636 2:104657203-104657225 ATAAAAAGTCTTCTTTTATGAGG - Intergenic
938171961 2:129086817-129086839 ATTAAAAGTCTGCTAGTATCTGG - Intergenic
939271205 2:139942538-139942560 ATTTAAAGTTTGATTTGATGTGG - Intergenic
939600532 2:144184022-144184044 TTTAAATGTCTCCTTTCATGTGG - Intronic
941000436 2:160197145-160197167 GTTAAAAGTCTGCTTTTTGCTGG + Intronic
941354773 2:164476954-164476976 AAAAAAAGTCTACTTTTAGGGGG + Intergenic
941928989 2:170922803-170922825 AATAAACTTCTGCTTTTTTGTGG - Intergenic
942006491 2:171706118-171706140 ATTAAAAGTCTGTGTTTTTTAGG - Intronic
942169696 2:173277748-173277770 ATTTAATGTCTATTTTTATGTGG + Intergenic
942203704 2:173598192-173598214 TTAAAAAGTCTGCTTTATTGTGG + Intergenic
943594578 2:189840858-189840880 ATAAATAATCTGCTTTTAGGAGG - Intronic
943807776 2:192144068-192144090 ATCATAAGTCTTCATTTATGTGG + Intronic
944583638 2:201154725-201154747 GATAAAAGTCTGGTTTTTTGAGG - Intronic
945492187 2:210469287-210469309 ATTAACACTGTGATTTTATGGGG + Intronic
945975766 2:216269490-216269512 ATTAAAAGTCTGCTCTTATTTGG - Intronic
946348419 2:219130112-219130134 ATTAAAAGCCTGATGTTTTGTGG - Intronic
947888904 2:233598267-233598289 ATAAAAATGCAGCTTTTATGTGG - Intergenic
948498440 2:238371124-238371146 ATTGAAAGTCTGTTTTTTAGAGG + Intronic
1170432022 20:16284565-16284587 AGAAAAACTCTGCTTTTATGGGG + Intronic
1170795739 20:19545454-19545476 ATTAAATGGCTGCTTTTTTTCGG + Intronic
1173877922 20:46387507-46387529 ATTAAAATTCATCTTTTTTGTGG - Intronic
1174099052 20:48113237-48113259 ATTAAATGACTGCCTTTATAGGG + Intergenic
1174725906 20:52861916-52861938 ATTAAATATCTACCTTTATGTGG + Intergenic
1176953748 21:15075414-15075436 ATTACAAGTCTTAATTTATGTGG - Intergenic
1177077161 21:16590228-16590250 AGGAAAAGTCTGGTTTGATGCGG - Intergenic
1177335009 21:19712474-19712496 ATTAAAAGACTGGTTTTGTTTGG + Intergenic
1177691007 21:24507432-24507454 ATCAAAAGAGTGCTTTTAAGAGG - Intergenic
1178340316 21:31780314-31780336 ATTAAATTACTGATTTTATGTGG + Intergenic
1179183696 21:39066979-39067001 ACTAACAGTCTGCTTTCCTGTGG - Intergenic
1181970389 22:26685370-26685392 ATTAAAAGTATCCTTTTATGAGG + Intergenic
951140829 3:19156817-19156839 ATTTTGAGTCTGCTTTTATTGGG + Intronic
951577953 3:24132761-24132783 ATTAAGAGCCTGGTTCTATGAGG + Intronic
951969391 3:28426880-28426902 ATTAAACTTCAGCTTCTATGGGG + Intronic
952012739 3:28919503-28919525 CTTAGAAATGTGCTTTTATGTGG + Intergenic
954043422 3:47908187-47908209 ATTAAATGTATACTTTTTTGGGG + Intronic
955984958 3:64563091-64563113 TTTAAAAGTCTGGTTTCTTGTGG - Intronic
956727845 3:72171102-72171124 AATAAAAGACAGCATTTATGAGG + Intergenic
956864999 3:73360908-73360930 ACAAAAAGACTGCTTTTGTGAGG + Intergenic
957307461 3:78476325-78476347 CTGAAAAGTCTTCTTTTGTGGGG - Intergenic
957408816 3:79809542-79809564 GTTAAAAATCTCCTTTTATTAGG + Intergenic
957728494 3:84100992-84101014 ATTGAATGTTTGCTTTTATAAGG - Intergenic
958142819 3:89585349-89585371 ATGAAAAGTCTTCAGTTATGTGG - Intergenic
958146031 3:89626147-89626169 TTTAACAATGTGCTTTTATGTGG - Intergenic
958535272 3:95394659-95394681 ATTAATAGTTTTCTTTTGTGTGG - Intergenic
958674245 3:97246454-97246476 ATTAAAAGTATGTTGTTATATGG + Intronic
958713128 3:97742306-97742328 AAGAAAAGCCTGCTTTTGTGAGG - Intronic
958930266 3:100200008-100200030 TTTTAAATTTTGCTTTTATGGGG - Intergenic
959678043 3:109059209-109059231 TTTCAAAGTCTGATCTTATGTGG + Intronic
959983981 3:112552427-112552449 ATTATAAATCTGCTTTTAAGAGG - Intronic
960689777 3:120333659-120333681 TTTAAAAGTAGTCTTTTATGAGG + Intronic
961689317 3:128657128-128657150 TTTGAAAGTCTTCTTTTTTGGGG + Intronic
961836878 3:129669186-129669208 TTTAAAAGTTTGCTTTTATAAGG - Intronic
962544532 3:136419218-136419240 AATAAAAGTTTGCTTTTCTAGGG + Intronic
962661198 3:137601989-137602011 ATTGAAACTCTCCTTTTATTAGG - Intergenic
964175278 3:153820389-153820411 ATGAAAAGTCTGCCTGTGTGTGG - Intergenic
966600377 3:181769252-181769274 ATTCAATGCCTGCTTTTCTGAGG - Intergenic
967406908 3:189126578-189126600 ATTAAGAGTGTGGTTTTTTGGGG + Intronic
967461779 3:189756371-189756393 AGAAACAGTCTGCTCTTATGGGG - Intronic
967469482 3:189845009-189845031 ATTAAAAATGTCCTTTTATAAGG - Intronic
969385249 4:6840812-6840834 ATTAAAAGTCTGCTTATGACTGG - Intronic
970269122 4:14324431-14324453 AATAAAATTCTCATTTTATGGGG + Intergenic
970488027 4:16544037-16544059 ATTAAATTCCTGCTTTTATGTGG + Intronic
971651842 4:29286376-29286398 ATTGAATGTCTACTTTCATGAGG + Intergenic
971773915 4:30935245-30935267 ATTGCAAGTCTGATTTAATGTGG - Intronic
972748581 4:41966103-41966125 ATTACAATTCTGTTTTTATTAGG + Intergenic
974046019 4:56899155-56899177 ATTAAAAGTCAGGTTTATTGGGG + Intergenic
975191241 4:71465135-71465157 ATTAAAAGGCTTATTTTATGTGG + Intronic
976188340 4:82465385-82465407 ATTTAAATTCTGCTGTTATTGGG + Intergenic
976368343 4:84257268-84257290 ATTATAAGACTGATTTAATGTGG + Intergenic
977544544 4:98361795-98361817 TTTAAAAATCTGCATTTAGGTGG - Intronic
977546736 4:98391649-98391671 ATTAAAAGCCTGCTTTTTAATGG + Intronic
979183865 4:117763242-117763264 ATTTAAAGGCTTATTTTATGTGG - Intergenic
979660968 4:123254885-123254907 ATTAGAACTCTGCTATTTTGAGG + Intronic
980293396 4:130874132-130874154 CTTTAAAATCTGTTTTTATGTGG - Intergenic
980986352 4:139698667-139698689 ATTGAAATGCAGCTTTTATGTGG - Intronic
981431428 4:144665698-144665720 AGTATAAGTGTGCATTTATGTGG + Intronic
982496013 4:156093050-156093072 ACTTAAAGTATGCTTTGATGTGG + Intergenic
982546751 4:156742930-156742952 ATTGAAAATGAGCTTTTATGTGG - Intergenic
982930417 4:161398508-161398530 AAGAAAAGTCTCCTTTTATAAGG - Intronic
983408485 4:167364664-167364686 TTTCAATGTCTGCTTTGATGTGG + Intergenic
984102749 4:175505542-175505564 ATTAAAATTATGATTTTAAGTGG + Intergenic
984124546 4:175790955-175790977 AATTAAAGTTTGCTTTAATGGGG + Intronic
984626597 4:182014506-182014528 ATTAAAATTCAGATTTTATGAGG + Intergenic
984741646 4:183170006-183170028 ATTCAAAGGATGCTTTTATTTGG + Intronic
986009993 5:3705316-3705338 ATTAAAAGTCTTCTTTAGTTAGG - Intergenic
986507285 5:8465231-8465253 AATAAAAGTCTTCTTATATATGG + Intergenic
988732856 5:33990569-33990591 TTTAAAAGCCCGCTTATATGGGG - Intronic
990940170 5:61194320-61194342 ATTAAAAGTGTGTATTTATGTGG + Intergenic
991179969 5:63738717-63738739 CAGAAAATTCTGCTTTTATGTGG + Intergenic
991277680 5:64869355-64869377 ATTAAAAATATGTTTTTATTAGG + Intronic
991646125 5:68802239-68802261 AATGAAAGTTTGCTTTTATGTGG - Intergenic
991915623 5:71602094-71602116 CTTCAAAGTCTCCTTTTAGGAGG - Intronic
991968757 5:72118067-72118089 ATTTGAAGTCTGTTTTTAAGTGG + Intronic
992109569 5:73480313-73480335 ATTAATATTCAGATTTTATGTGG - Intergenic
993145615 5:84090023-84090045 ATTTAAAGCCTGGTCTTATGAGG + Intronic
993166694 5:84364622-84364644 ATTACAATTGTTCTTTTATGGGG + Intronic
993511750 5:88779297-88779319 GTTCAAAGTCTGCTTCCATGAGG + Intronic
993794405 5:92249126-92249148 AAAAACAGTCTGCTTTTCTGTGG - Intergenic
993977385 5:94499050-94499072 GTTTAAAGCCTGATTTTATGTGG - Intronic
994400164 5:99269157-99269179 ATTTGAATTCTGCTTTTGTGGGG + Intergenic
994676326 5:102827570-102827592 ATTCCAAGTCTGTTTTCATGAGG + Intronic
994767362 5:103935600-103935622 ATTACAATTCTGCTTTTACTAGG + Intergenic
995069304 5:107899610-107899632 ATCAAAAATCTTCTTTTAAGAGG - Intronic
995773511 5:115699280-115699302 AATAAAAGTACCCTTTTATGAGG - Intergenic
996366460 5:122706475-122706497 AGGAAAAGTCTGCTTTTCTGGGG - Intergenic
997820001 5:137056576-137056598 AATAAAAGTCCTTTTTTATGAGG - Intronic
997888730 5:137656468-137656490 ATAAAAAATCTGCTATTATTTGG - Intronic
998304133 5:141056071-141056093 AAAAAAAGTGTGCTTTAATGAGG + Intergenic
998597395 5:143547154-143547176 GTAAAAAGACTGCATTTATGGGG - Intergenic
999741060 5:154552918-154552940 ATTAATAATATGCTTATATGTGG - Intergenic
999954985 5:156690667-156690689 AGTAAATGTCTACTTTTAAGAGG + Intronic
1003082510 6:3032865-3032887 ATGAAAAGTCTGATATAATGTGG - Intergenic
1003390514 6:5709107-5709129 ATTAGAAGTCTTTTTTAATGAGG + Intronic
1004155600 6:13165093-13165115 ATTTAAAATTTCCTTTTATGTGG - Intronic
1004494193 6:16148084-16148106 ATTAAAACTCTACTTTTTTATGG + Intronic
1004707164 6:18135192-18135214 TTCAAAAGTTTGCTTTGATGTGG - Intronic
1006567880 6:34974915-34974937 ATTCAGAGTTTTCTTTTATGGGG + Intronic
1008309658 6:49951297-49951319 ATTCAAACTCTGCTTGTTTGGGG - Intergenic
1009463308 6:63940416-63940438 TTGAAAATTCAGCTTTTATGTGG + Intronic
1009955803 6:70451143-70451165 AACAAAAGTCTGCATTTATCTGG - Intronic
1010117435 6:72330906-72330928 CTTAAAAGCATTCTTTTATGAGG - Intronic
1010463000 6:76134308-76134330 AATAAAAGGCTGCATTTATCTGG - Intergenic
1012035197 6:94128139-94128161 ATTAGGATTCTGCTTTTATTGGG - Intergenic
1013617296 6:111856877-111856899 TTTAAAAGTGTGCCTTTATTGGG - Intronic
1013934347 6:115575355-115575377 ATCAAAAGACAGTTTTTATGAGG - Intergenic
1014540574 6:122670839-122670861 TTTAAAAGTCTACTCTTAAGAGG - Intronic
1014611122 6:123547835-123547857 ATTCAATGGCAGCTTTTATGTGG + Intronic
1014876049 6:126661387-126661409 GATAAAAGTCTGCCTTCATGAGG - Intergenic
1015118906 6:129680039-129680061 ATTACAAGTATCCTTTTAGGTGG - Intronic
1015791669 6:136969705-136969727 TAGAAAAGGCTGCTTTTATGTGG + Intergenic
1016773387 6:147876971-147876993 ATTAAGAGTCTGCATTTTGGAGG + Intergenic
1017340816 6:153319915-153319937 TTTAAAAGTCAGCTTCTGTGTGG + Intergenic
1018479698 6:164177745-164177767 ATTAAAAATCCGCCCTTATGTGG - Intergenic
1020371240 7:7434129-7434151 TCTAAAAGGCTGTTTTTATGTGG + Intronic
1020395359 7:7709932-7709954 CTTTAAATTCTGCTTTTTTGGGG + Intronic
1020556871 7:9681508-9681530 ATTAATACTATGCTTGTATGTGG - Intergenic
1020631467 7:10645514-10645536 ATTAAACTTCTATTTTTATGGGG - Intergenic
1021041767 7:15871731-15871753 ATTAGTAGTCTGCTTTCATGAGG + Intergenic
1021828361 7:24576548-24576570 ATTAACAGTCTACTGTTAAGTGG + Intronic
1022849302 7:34243932-34243954 CTTAAAAGTCTGCCTGTAGGTGG + Intergenic
1023386559 7:39663727-39663749 TTGAAAATTCAGCTTTTATGAGG + Intronic
1025930812 7:65992483-65992505 ATTAACTGGCTGCTTTTCTGTGG + Intergenic
1026842296 7:73676678-73676700 ATTAGAAATCTGTTTTTATGGGG + Intergenic
1027756885 7:82224807-82224829 ATGAAATTTCTGCTTTTATTTGG + Intronic
1027825646 7:83111829-83111851 ACTTAATGTCTGCTTTTAAGGGG + Intronic
1027924356 7:84441425-84441447 ATTAAAAGTGTGATTTTAGCAGG + Intronic
1028215043 7:88121297-88121319 ATTAAAAGTATGGGTTAATGGGG + Intronic
1028665587 7:93340167-93340189 ATTAAAAGTCTCTTTCTCTGAGG + Intronic
1028920391 7:96304451-96304473 ATTAAAATTCTGATATTAAGAGG + Intronic
1029165559 7:98587250-98587272 AAAAAAAATCTGCTTTTAAGTGG + Intergenic
1030700265 7:112630531-112630553 ATTAACAGTTTGCACTTATGAGG + Intergenic
1030851927 7:114498586-114498608 ATTAACAGTCTGTTTATATGAGG + Intronic
1030929533 7:115504809-115504831 CTTTGAAGTCTGCTCTTATGGGG + Intergenic
1031901891 7:127419842-127419864 CTTAAAAGTGTGCTTGTATTTGG + Intronic
1032156361 7:129472195-129472217 ATTAAAATTCTGCTATTAGTAGG + Intronic
1032313925 7:130816174-130816196 AATAAAAGTACTCTTTTATGAGG + Intergenic
1032627990 7:133613804-133613826 TTGAAAAGGCAGCTTTTATGTGG + Intronic
1032653332 7:133902474-133902496 ATTAAATATCTGCTTTCATGGGG + Intronic
1033609936 7:142955287-142955309 ACTAAAAGTATGTTTTTTTGGGG - Intronic
1034855821 7:154545729-154545751 TTTCAAACTCTTCTTTTATGAGG + Intronic
1034952542 7:155309590-155309612 ATTAAAAGACTCCTTTTAAATGG + Exonic
1036487247 8:9190376-9190398 TCTAAAAATCTGCTTTTATTTGG + Intergenic
1036625328 8:10466435-10466457 TTTCAAAGTCTGCTATTAAGAGG - Intergenic
1036973324 8:13380467-13380489 ATATAAACTCTGCTTTTATCAGG + Intronic
1037128724 8:15382562-15382584 ATTAAAAGGCAGCTGTTAAGGGG - Intergenic
1038855830 8:31332240-31332262 ATTAAAAGGCAGATTTTAGGAGG - Intergenic
1039160214 8:34610553-34610575 ATTACAGGGCTTCTTTTATGAGG - Intergenic
1039209898 8:35202120-35202142 AGATAGAGTCTGCTTTTATGGGG + Intergenic
1040098786 8:43477778-43477800 ATTAACTGCCTGCTTTTCTGTGG - Intergenic
1040402634 8:47067690-47067712 ATAAAAAGCTTTCTTTTATGTGG - Intergenic
1040409442 8:47139372-47139394 ATTAAAATTGTGATTTTTTGGGG + Intergenic
1040453611 8:47573948-47573970 ATTAAAAGTCTGTTTTACAGAGG - Intronic
1040819250 8:51536987-51537009 ATCTAAAGTCTGCCTTTATCTGG - Intronic
1041261918 8:56028327-56028349 ATTAACAGTCATCTGTTATGTGG + Intergenic
1041905601 8:63030302-63030324 ATTAAAAATTTGTTTTTATTTGG - Intronic
1042076259 8:64998318-64998340 ATTAAAAGTCCTCTTTTAGTGGG + Intergenic
1042286263 8:67114728-67114750 ATCAAAAGTTTCCTTTTAAGAGG + Intronic
1043112736 8:76208458-76208480 ATTAAAAGAGTCATTTTATGGGG - Intergenic
1043888956 8:85634935-85634957 ATTAAAAGTCTGGTTGAAAGAGG + Intergenic
1044174154 8:89096496-89096518 ATTATAAGACTGATTTAATGTGG - Intergenic
1044209300 8:89532055-89532077 GAGAAAATTCTGCTTTTATGGGG - Intergenic
1045903294 8:107311601-107311623 ATTTAAAGTCTGTTTTAAAGTGG + Intronic
1046657829 8:116914112-116914134 AGTAAAAATCTGTTTTTATTGGG - Intergenic
1047557005 8:125942530-125942552 GTTAAAAGATTGCTTTTATTTGG - Intergenic
1047580556 8:126210269-126210291 CTTAAATGCCTGGTTTTATGAGG + Intergenic
1047795284 8:128248908-128248930 ATTAAAACTCAGCTTTCAGGTGG + Intergenic
1047867892 8:129048870-129048892 TTGAAAATGCTGCTTTTATGTGG + Intergenic
1048665219 8:136653637-136653659 ATTTCACATCTGCTTTTATGAGG + Intergenic
1051111247 9:13639357-13639379 ATTAAAAATCTTCATTCATGGGG + Intergenic
1051168990 9:14298942-14298964 GTTAAAAGCCTTGTTTTATGAGG - Intronic
1051602997 9:18892752-18892774 ATTAAAAGCCTGCTGCTCTGGGG - Intronic
1051921223 9:22268095-22268117 GTTAAAAGTCTCCTTTAATCTGG + Intergenic
1051986435 9:23094758-23094780 AATAAAAGTATGCTTTTGTAAGG - Intergenic
1052162625 9:25285217-25285239 GTTAAAACTCTGCTTTTTTATGG - Intergenic
1052195607 9:25709887-25709909 ATGAAAAGTCACATTTTATGTGG - Intergenic
1052361391 9:27564369-27564391 ACTAAAATTCTGCTTTTACTGGG - Intronic
1052371359 9:27668631-27668653 ATTAAATGTATCCTTTTATATGG + Intergenic
1054873730 9:70074004-70074026 ATTACATGTCTGTTTTTCTGGGG - Intronic
1055430865 9:76242037-76242059 ATAAAAAGTCTGCTTTATTCTGG - Intronic
1057115154 9:92513915-92513937 CTTAAAAATCAGCTTTAATGAGG - Intronic
1058126045 9:101196274-101196296 ATAGGAAGTCTGCTTTTAAGAGG + Intronic
1059092251 9:111372122-111372144 ATTAAGAGTGTGATTTTATGTGG - Intronic
1059776070 9:117476372-117476394 AATTAAAGTCTGATTTTATTGGG + Intergenic
1060136234 9:121157643-121157665 ATGAAAAGTTTGCTTCTAAGGGG + Intronic
1061634397 9:131897840-131897862 ATTACAAGTCTGCTCGTATCAGG + Intronic
1186569310 X:10697529-10697551 ATGAAAAATCTGCTCTAATGAGG + Intronic
1187375655 X:18751016-18751038 ATAAAAAGCCTGATTTTAAGTGG - Intronic
1187721139 X:22151903-22151925 ATTTTAAGTATGCTTTTAAGAGG - Intronic
1188889172 X:35588690-35588712 AAAAAAAGACTGCTTTGATGTGG - Intergenic
1189889521 X:45584613-45584635 ATAAAAAGTTTGCTTTTACCAGG - Intergenic
1190378840 X:49818282-49818304 ATTAAAACTTTTGTTTTATGTGG - Intergenic
1191600335 X:62997753-62997775 ATGAGTATTCTGCTTTTATGGGG - Intergenic
1192394804 X:70768782-70768804 ATTTATAGTCTGCTATTATTGGG - Intronic
1194890270 X:99370727-99370749 ATTAGAACTATTCTTTTATGGGG - Intergenic
1195308948 X:103611267-103611289 TTTAAAAGTCTGTTTTGATAAGG - Intronic
1196380078 X:115079881-115079903 ATTAAAAGTATGTTTTTAATTGG - Intergenic
1196562382 X:117165912-117165934 ATCAAGATTATGCTTTTATGGGG - Intergenic
1198141476 X:133808191-133808213 GTTTAATGTTTGCTTTTATGTGG - Intronic
1198201715 X:134426932-134426954 TTTAAAAATCTGCTTTATTGTGG - Exonic
1198347277 X:135770973-135770995 ATTAAAATTCTGCTCTGCTGAGG - Intergenic
1198349183 X:135788234-135788256 ATTAAAATTCTGCTCTGCTGAGG - Intergenic
1198351088 X:135805507-135805529 ATTAAAATTCTGCTCTGCTGAGG - Intergenic
1198352995 X:135822772-135822794 ATTAAAATTCTGCTCTGCTGAGG - Intergenic
1198354904 X:135840027-135840049 ATTAAAATTCTGCTCTGCTGAGG - Intergenic
1198356814 X:135857310-135857332 ATTAAAATTCTGCTCTGCTGAGG - Intergenic
1198358727 X:135874589-135874611 ATTAAAATTCTGCTCTGCTGAGG - Intergenic
1198412344 X:136383594-136383616 ATTAAAAGTCAGATATTATCAGG - Intronic
1198424358 X:136500462-136500484 ATTAAAATTATGCTTTCTTGAGG - Intronic
1198531560 X:137553469-137553491 TTTTAAAGTCTGTTTTAATGAGG + Intergenic
1199445776 X:147919212-147919234 ATTAACAGTTTGCTTTTTGGGGG - Intronic
1200319623 X:155173756-155173778 ATTAACTGTCTGTTTTTCTGTGG - Intergenic
1200824419 Y:7623103-7623125 ATTAAAAGTGTTCATTTTTGTGG + Intergenic
1200966239 Y:9041567-9041589 ATCTGAAGTCTGCTTTTATTTGG + Intergenic
1201573411 Y:15437290-15437312 ATTAACTGTCTGTTTTTCTGTGG + Intergenic
1202235636 Y:22707984-22708006 ATTAAAAGTGTTCATTTTTGTGG - Intergenic
1202307523 Y:23488184-23488206 ATTAAAAGTGTTCATTTTTGTGG + Intergenic
1202375679 Y:24234214-24234236 ATTAACTGTCTGTTTTTCTGAGG + Intergenic
1202495101 Y:25435904-25435926 ATTAACTGTCTGTTTTTCTGAGG - Intergenic
1202563278 Y:26182402-26182424 ATTAAAAGTGTTCATTTTTGTGG - Intergenic