ID: 1101427406

View in Genome Browser
Species Human (GRCh38)
Location 12:104599314-104599336
Sequence CATTAAAAGTCTGCTTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 273}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101427406_1101427412 6 Left 1101427406 12:104599314-104599336 CCCATAAAAGCAGACTTTTAATG 0: 1
1: 0
2: 1
3: 27
4: 273
Right 1101427412 12:104599343-104599365 ATGGTAGGCTTTTCACCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 27
1101427406_1101427414 20 Left 1101427406 12:104599314-104599336 CCCATAAAAGCAGACTTTTAATG 0: 1
1: 0
2: 1
3: 27
4: 273
Right 1101427414 12:104599357-104599379 ACCGCGCGGTCCCGGAGCCATGG 0: 1
1: 0
2: 0
3: 5
4: 84
1101427406_1101427416 21 Left 1101427406 12:104599314-104599336 CCCATAAAAGCAGACTTTTAATG 0: 1
1: 0
2: 1
3: 27
4: 273
Right 1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1101427406_1101427410 -9 Left 1101427406 12:104599314-104599336 CCCATAAAAGCAGACTTTTAATG 0: 1
1: 0
2: 1
3: 27
4: 273
Right 1101427410 12:104599328-104599350 CTTTTAATGGATTCCATGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 110
1101427406_1101427413 12 Left 1101427406 12:104599314-104599336 CCCATAAAAGCAGACTTTTAATG 0: 1
1: 0
2: 1
3: 27
4: 273
Right 1101427413 12:104599349-104599371 GGCTTTTCACCGCGCGGTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101427406 Original CRISPR CATTAAAAGTCTGCTTTTAT GGG (reversed) Intronic
901732353 1:11289376-11289398 AATCAAAAGGCTGCTTTGATGGG + Intronic
905845223 1:41224644-41224666 CATTAATATTCTCATTTTATAGG + Intronic
906378343 1:45315422-45315444 GATAAAAAGTCTGGTTTGATAGG + Intergenic
906390786 1:45413870-45413892 CATTATAAGCTTTCTTTTATAGG - Intronic
906699238 1:47845678-47845700 TGTTTAAAGTCTGCTTTTAGGGG + Intronic
907460011 1:54599859-54599881 TATTTAAAGTCAGCTTTCATGGG - Intronic
909472345 1:76042597-76042619 CATCAGAAGTTTCCTTTTATTGG + Intergenic
909573321 1:77142861-77142883 CATTCAAATTTTGCTTTTTTTGG - Intronic
910280311 1:85493177-85493199 TTTTAAAAGACTGTTTTTATAGG + Intronic
912008022 1:104928383-104928405 CATTATAAGTCTCTTTTTATTGG + Intergenic
912048275 1:105489303-105489325 TATTAAAAATCTGTTTTTCTGGG + Intergenic
915985039 1:160456217-160456239 CATTAAAAGTCTGGCTTCAGTGG - Intergenic
916628299 1:166583554-166583576 CACTTAAAGTCTCTTTTTATAGG + Intergenic
916952078 1:169790655-169790677 CATTAAAAGTCTAATTCTCTTGG + Intronic
917543762 1:175940755-175940777 CTTTAAAAATCTGCTTCCATTGG + Intergenic
918256225 1:182750648-182750670 ACTTAAAAGTCTACATTTATTGG - Intergenic
919198673 1:194322551-194322573 CATTAAAAAGTTTCTTTTATTGG - Intergenic
919399760 1:197097927-197097949 CATTAAAACTTTGTTTTAATGGG - Intronic
920803456 1:209210554-209210576 AGTTAAAAGTCTGCTATTGTTGG + Intergenic
921380164 1:214516495-214516517 AATAAACTGTCTGCTTTTATAGG - Intronic
921464348 1:215468328-215468350 CAGTAAAACTCTGATTTTCTAGG - Intergenic
922126314 1:222728092-222728114 CATTAAAAGCCTGACTTGATTGG + Intronic
923349774 1:233092747-233092769 CATTTTAAGTGTGCTTTTAAAGG - Intronic
923967562 1:239158547-239158569 CATTAAGAGTTTGCTTCTTTAGG - Intergenic
1064333951 10:14421552-14421574 CCTTAAAAGGGTGCTTTTCTTGG + Intronic
1064494920 10:15899231-15899253 CATTAAAACTTGGCTTTTAAAGG - Intergenic
1064770498 10:18717839-18717861 TATTAAAAGTCTGTTTTTATTGG + Intergenic
1065149735 10:22810736-22810758 CATTAACGATCTGCTTTCATGGG + Intergenic
1068680972 10:59819546-59819568 CATTGAAAATCTGTTTTAATTGG - Intronic
1069113488 10:64475306-64475328 GATTAAAAGTTTCATTTTATTGG - Intergenic
1070545666 10:77450568-77450590 TAATAAAATTATGCTTTTATGGG - Intronic
1071391740 10:85182090-85182112 CACTAAAACTCTTCCTTTATTGG - Intergenic
1072127224 10:92457582-92457604 CAGTAGAAGTCTGCTGTTAAGGG - Intronic
1075063513 10:119273310-119273332 CATTAAAAGGGGGCTTTGATGGG + Intronic
1076777456 10:132705650-132705672 CTTTAAAAGTCTGCTTACCTGGG + Intronic
1078953684 11:16165046-16165068 CTTTAAAAATCTACTTTTAGAGG + Intronic
1079537729 11:21535109-21535131 CTTGAAAAGTCTGCTTTATTGGG + Intronic
1079717062 11:23761364-23761386 TTTTCAAAGTCTGCTTTTTTTGG + Intergenic
1080565170 11:33502246-33502268 CATGAGAAGTCAGCTTTAATCGG + Intergenic
1080900712 11:36487911-36487933 CAATAAATGTGTACTTTTATCGG - Exonic
1087934737 11:104019046-104019068 CAGGAAAACTCTTCTTTTATTGG + Intronic
1088580433 11:111310447-111310469 CATTAAAAATCTAGTTTTACTGG - Intergenic
1088965384 11:114715938-114715960 CAAGAAAAGTCTGGTTTGATCGG - Intergenic
1091444433 12:535462-535484 CAGTAAAAGTTTCCTTTTACTGG - Intronic
1093637354 12:21487281-21487303 AATTAAAAATCTGGTTTTTTTGG - Intronic
1096604995 12:52758343-52758365 CCTTAAAAGTGTGCATTAATAGG + Intergenic
1097105123 12:56617721-56617743 CTTTAAAAGACTGTTTTCATAGG - Intronic
1097521563 12:60677082-60677104 CATGGAATGTCTGTTTTTATGGG + Intergenic
1097539611 12:60923308-60923330 CATCACAATTCTGCTGTTATTGG - Intergenic
1098166900 12:67707963-67707985 CATTGACAGTTTGCGTTTATGGG - Intergenic
1098560940 12:71871439-71871461 CAGTAAAAATGTGCTATTATGGG + Intronic
1099234447 12:80066776-80066798 GATAACAAGTCAGCTTTTATAGG + Intergenic
1100088863 12:90945613-90945635 CATTAAAATTCTGCTTTTGGTGG + Intronic
1100156013 12:91801319-91801341 CATGAACAGTGAGCTTTTATTGG - Intergenic
1100169648 12:91959659-91959681 CATTAGAATTCTCCTTTTGTTGG - Intergenic
1101093933 12:101316247-101316269 CACTAAATGTCACCTTTTATTGG - Intronic
1101427406 12:104599314-104599336 CATTAAAAGTCTGCTTTTATGGG - Intronic
1101700970 12:107173424-107173446 CATGAAACGTCAGGTTTTATAGG - Intergenic
1102922096 12:116799297-116799319 CAAGAAAACTCTGCTTTTAAAGG + Intronic
1103347245 12:120259526-120259548 CATTAAAAGTCCGTCTTTAAGGG + Intronic
1104559282 12:129829422-129829444 CATGACAAATGTGCTTTTATGGG + Intronic
1107466523 13:40655580-40655602 AATAAAATGTCTGCTTCTATAGG + Intronic
1109043258 13:57370802-57370824 AATTAAATATCTGCTTATATTGG - Intergenic
1109761449 13:66835186-66835208 CTTTTAAAGTCTGTTTTTGTAGG + Intronic
1109908615 13:68879013-68879035 CTTTCAAACTCTACTTTTATAGG - Intergenic
1112215024 13:97421324-97421346 AATTAAAAGTCTCCATTTAAAGG - Intergenic
1112871960 13:103983203-103983225 TATTAAAAGTCTGCAAATATGGG - Intergenic
1112874703 13:104022081-104022103 CATTTGAAGTTTGCTTTCATAGG - Intergenic
1113232887 13:108235439-108235461 CATTAAATGTGTGTTTCTATAGG + Intergenic
1113290315 13:108898817-108898839 CATTAATAATCTGTTTTAATTGG - Intronic
1113756258 13:112813182-112813204 AATTAAAGGACTGCTTTTCTAGG - Intronic
1115114864 14:29867985-29868007 AATTAAAAGTCAGCATTTATAGG + Intronic
1115666223 14:35551475-35551497 TTTTAAAAGTCTGCTTGAATGGG + Intronic
1116096215 14:40372525-40372547 CTTTAAAAGTATGAGTTTATAGG - Intergenic
1116338805 14:43695557-43695579 TATTAAAAGTCTGGTATGATAGG - Intergenic
1118472956 14:66092729-66092751 GATTAAAAGTATGTTGTTATGGG + Intergenic
1119164832 14:72483634-72483656 CATTACAACTTTGCTTTTATGGG + Intronic
1119204190 14:72782044-72782066 AATCAATAGTCTGCTTCTATAGG - Intronic
1120296888 14:82652865-82652887 TATTAAAACTCTGCTTTTCTAGG - Intergenic
1120945427 14:89990662-89990684 CATTCAAAGTGTACTTTTAATGG + Intronic
1121426716 14:93857455-93857477 CATTAATTTTCTGGTTTTATAGG - Intergenic
1124254586 15:28130454-28130476 CAATAAAAATCTGGTTTTAGTGG + Intronic
1125100431 15:35906280-35906302 CTTTAAAAGTAGGCTTTTACTGG + Intergenic
1125762713 15:42108134-42108156 CATTAAGAGTCTGCTGTTGGGGG + Intergenic
1125914230 15:43471051-43471073 CATTAAAAACCTGCTGTTATAGG + Intronic
1126761730 15:51975865-51975887 CACTAACAGTCTGCCTTTACTGG + Intronic
1126892970 15:53225980-53226002 CATTTAAAGTCTGCTTTCCCAGG - Intergenic
1126949440 15:53864186-53864208 CAATAAAATTCTGCTTGAATTGG - Intergenic
1127240051 15:57103556-57103578 CATACAATGTCTTCTTTTATTGG - Intronic
1127277109 15:57456776-57456798 TATCAAATGTCTGCTTTGATGGG + Intronic
1127653677 15:61035175-61035197 CAGTAAAAGCCTTCTATTATGGG - Intronic
1128833688 15:70792078-70792100 GATTAAAAATCTGATTTAATAGG - Intergenic
1134474367 16:14559662-14559684 CATTAAAAAATAGCTTTTATGGG - Intronic
1135621619 16:23960724-23960746 CAGTAAAACACTGCCTTTATAGG + Intronic
1136135085 16:28251231-28251253 CATTTACAGATTGCTTTTATAGG - Intergenic
1138901245 16:61273685-61273707 CAGGAAAATGCTGCTTTTATTGG + Intergenic
1146711941 17:35049768-35049790 AAATAACAGTCTGCTTTTGTTGG - Intronic
1146761151 17:35480616-35480638 CATTAATTATCTCCTTTTATGGG + Intronic
1146975081 17:37104271-37104293 AATTAAAAGTGTGCATTTTTAGG - Intronic
1148289101 17:46426842-46426864 AATTAAAATTCTGCTTTTAATGG - Intergenic
1148311270 17:46644419-46644441 AATTAAAATTCTGCTTTTAATGG - Intronic
1148400362 17:47354335-47354357 AATTCATAGTCTGCATTTATTGG + Intronic
1150097915 17:62394927-62394949 CATTAAAAGTCTGTTCTATTTGG - Intronic
1150651537 17:67013499-67013521 CATTAAAAGTATATTTCTATGGG - Intronic
1154397044 18:14000435-14000457 CATTAAAATACTGATTTTAGAGG - Intergenic
1155804518 18:30150853-30150875 CATTAAAAGTATGTTTTTGGGGG - Intergenic
1155893639 18:31296171-31296193 CATTATAAATCAGCTTTTCTTGG - Intergenic
1155893642 18:31296305-31296327 CATTATAAATCAGCTTTTCTTGG - Intergenic
1157924504 18:51748657-51748679 CATAAAAAGTCTGTATTTACTGG - Intergenic
1158038527 18:53064984-53065006 AATTTAAATTCTTCTTTTATAGG + Intronic
1159047990 18:63388035-63388057 AATTTAAAGTCTGCTCTGATGGG - Intergenic
1160477565 18:79206238-79206260 CTTTAGAAGTATGCTATTATTGG - Intronic
1162836792 19:13324912-13324934 CATTGTAACTCTGCTTTTTTAGG - Intronic
1164166898 19:22687499-22687521 CATTACAAGTATACTTTTTTTGG + Intergenic
1166552693 19:43676910-43676932 CATTTAAAGTCTCCTGTTTTAGG - Intergenic
926547225 2:14256367-14256389 CTTTAAAAGTAAGCATTTATTGG - Intergenic
927993873 2:27468533-27468555 CTTTTAAAGTCTTCTTTTTTAGG - Intronic
930641916 2:53861934-53861956 CTTTAAAACTCTTCTTTTGTTGG - Intergenic
931473978 2:62569755-62569777 ATTTAAAAGTCTGCATTTATTGG + Intergenic
934721877 2:96584467-96584489 CATTCAAAATCTGGTTTTCTAGG + Intergenic
935913689 2:107925786-107925808 TATTGAAAGTCTCATTTTATTGG + Intergenic
936654207 2:114465848-114465870 CATTCAAAATCTGTTTTTCTAGG + Intronic
936797151 2:116220607-116220629 AATTAAAATTATGCTTTTGTTGG - Intergenic
939154184 2:138504449-138504471 CTTTAAAAGTCTGATTCTAGGGG - Intronic
940071592 2:149694405-149694427 GATTAAACATCTGCTATTATGGG + Intergenic
940389538 2:153116038-153116060 AATTAAAAGTGTGGTTTTAGGGG + Intergenic
940532127 2:154891365-154891387 CATTTAAAGTATGCTTTTGGTGG - Intergenic
941291611 2:163682631-163682653 CATTGAATGATTGCTTTTATAGG + Intronic
942130252 2:172871611-172871633 AAAAAAAAGTCTGCTTTTTTGGG - Intronic
942349052 2:175033779-175033801 CATTAGAAGTGTGCTTCTCTGGG + Intergenic
942884504 2:180906892-180906914 CATAAATAGTCTGTTTTCATGGG - Intergenic
944992834 2:205257089-205257111 AATTATAAGTCTGTTTTTATTGG - Intronic
1169492691 20:6084491-6084513 AATTAAAATTATGCTTCTATAGG - Intronic
1170432021 20:16284564-16284586 CAGAAAAACTCTGCTTTTATGGG + Intronic
1172050645 20:32115000-32115022 CAAAATAAGTCTGATTTTATAGG - Intronic
1173116068 20:40244266-40244288 TGATAAAGGTCTGCTTTTATGGG - Intergenic
1173806386 20:45928244-45928266 CATTATAATTCTGGTTTTGTAGG + Intergenic
1174099051 20:48113236-48113258 TATTAAATGACTGCCTTTATAGG + Intergenic
1175275409 20:57765765-57765787 CATTAAAAATGTGCCTTTAAAGG + Intergenic
1179383634 21:40921704-40921726 CATTACAAATCTTCTTTTCTAGG - Intergenic
1179482641 21:41688177-41688199 CATTACAAGTCAGCTTTTCTTGG - Intergenic
949222472 3:1652363-1652385 GGTTTAAAGTCTGTTTTTATCGG + Intergenic
949474400 3:4429961-4429983 TTTTAAAAGTATGCTTTTAAAGG + Intronic
950874510 3:16258382-16258404 GATTACAAGTCAGTTTTTATAGG + Exonic
951140828 3:19156816-19156838 TATTTTGAGTCTGCTTTTATTGG + Intronic
952100326 3:30004008-30004030 CATAAAAACTTTGCTTTCATTGG - Exonic
953178690 3:40576336-40576358 CTTTAAAAAGCTGCATTTATTGG - Intergenic
955050142 3:55402463-55402485 TATTCAAAGGCTGCTTTCATAGG - Intergenic
956153643 3:66270217-66270239 TTTTATAAGTCTGGTTTTATTGG + Intronic
957307462 3:78476326-78476348 CCTGAAAAGTCTTCTTTTGTGGG - Intergenic
957318518 3:78599228-78599250 CATTACAACTCTGCTTTTGTTGG + Intronic
957623204 3:82622785-82622807 TTTTAAAAGTCTGTTTTTGTTGG - Intergenic
958101267 3:89014390-89014412 TATGAAAAGTCAGCTTTTACAGG - Intergenic
958524079 3:95230099-95230121 AATCAAAAGTCTGCTATTTTTGG + Intergenic
958668007 3:97164768-97164790 AATTAATTGTCAGCTTTTATTGG + Intronic
959159355 3:102705035-102705057 AAGTACAGGTCTGCTTTTATGGG + Intergenic
959538878 3:107518240-107518262 TATTACAAGTTTGCTTTTTTAGG + Intergenic
959941763 3:112087612-112087634 ATTGCAAAGTCTGCTTTTATAGG + Intronic
960023186 3:112978517-112978539 CATAAAAAGACTGCTTTCCTGGG + Intergenic
960036268 3:113105701-113105723 CCCTAAAATTCTGCTTTAATTGG + Intergenic
960513909 3:118581847-118581869 CTTTATAAGATTGCTTTTATGGG - Intergenic
962544531 3:136419217-136419239 AAATAAAAGTTTGCTTTTCTAGG + Intronic
962773409 3:138634843-138634865 GAGTAAAAGTCTTCTTTTAATGG + Intergenic
963487797 3:145958264-145958286 CATTTAAAGTCTCCTTTTAAAGG - Intergenic
964340127 3:155699462-155699484 CTTTATAAGTCTCCTTTTCTAGG - Intronic
965233780 3:166089410-166089432 CATTGTAAGTATACTTTTATGGG - Intergenic
965482215 3:169232873-169232895 CATGAAAAGGCTGCTTATAAAGG - Intronic
970124200 4:12791156-12791178 CATATAAAATCTGGTTTTATGGG - Intergenic
970537492 4:17043914-17043936 CAACAAAAGCCTGCTTTTATAGG + Intergenic
971672032 4:29573877-29573899 CATGAAAAGTCTTCTTGTAAAGG + Intergenic
972086072 4:35217657-35217679 CACTAAAATTCTGCTTTTGAAGG + Intergenic
973219931 4:47713767-47713789 CATTAAAAATTTGCTTTTTTGGG - Intronic
973616279 4:52681468-52681490 CATCACAAGTCTGATTTCATAGG - Intergenic
974843985 4:67329316-67329338 CATTTAAAGTCTGCTATGATAGG + Intergenic
975533988 4:75429473-75429495 AATTGAAAGTCTGCTGCTATAGG - Intergenic
976188339 4:82465384-82465406 AATTTAAATTCTGCTGTTATTGG + Intergenic
976761096 4:88550198-88550220 CATTAAAAGTCTCGTTTTCCTGG + Intronic
978832577 4:113106519-113106541 CATTTAAAGTCAGCTCTTTTTGG + Intronic
979057304 4:116013530-116013552 CATTAAAAGTAAGATTTTAATGG + Intergenic
979969960 4:127122377-127122399 AATTAAAGGTCTGTTTTTTTTGG + Intergenic
980043975 4:127968399-127968421 AATTTAAAGTCTTCTTTTTTAGG + Intronic
980738056 4:136916905-136916927 CATTAAAAGCCAGCATTCATCGG + Intergenic
981417949 4:144515199-144515221 AAATAAGAGTCTGCTTTTAAAGG - Intergenic
981844312 4:149150136-149150158 CATTATAAGCCTGATTTTAATGG - Intergenic
981974957 4:150715524-150715546 TATTAAATGTCTGCTTTTGTTGG - Intronic
982817256 4:159901721-159901743 CATAAAGACTTTGCTTTTATAGG - Intergenic
983124630 4:163935364-163935386 CATTGAAAATCTGTTTTTAAAGG + Intronic
983507560 4:168571672-168571694 CTTTAGAAATCTGGTTTTATCGG + Intronic
984087712 4:175332809-175332831 CATTAAAATTATACATTTATAGG - Intergenic
984124545 4:175790954-175790976 CAATTAAAGTTTGCTTTAATGGG + Intronic
984303026 4:177948428-177948450 TAATAAAAGTCTGCTAATATAGG + Intronic
985233094 4:187843028-187843050 CACTCAAAGTATGCTTTTTTTGG + Intergenic
986288860 5:6381891-6381913 CATTAAAAAGATGCTTTTAATGG + Intergenic
986600978 5:9472937-9472959 TGTTAAAATTCTGCTTTTAAAGG - Intronic
986949802 5:13069796-13069818 CATGATAAGTCTTATTTTATTGG + Intergenic
987966005 5:24873852-24873874 CATTAAAAAGCTTATTTTATTGG - Intergenic
988275614 5:29077956-29077978 CACTCAAAGTTTGCTTTTAGGGG + Intergenic
988310582 5:29551578-29551600 CATTCAAAATCTGCTCTTCTAGG + Intergenic
988383950 5:30537404-30537426 CAGTAAAAGTCTCCTTTTTCTGG - Intergenic
988407339 5:30840849-30840871 CATTAAAAGCCTGCTATTCTTGG + Intergenic
990236897 5:53778351-53778373 CATCAGAAGTCTGCTGTTGTAGG + Intergenic
990665288 5:58065140-58065162 GTTTAAGAGTCTGCTTTTAAAGG + Intergenic
991160722 5:63498238-63498260 AATTAGAAGTCTTCTTTTAGAGG + Intergenic
992065189 5:73100547-73100569 AATTAGAAGTATGTTTTTATTGG + Intergenic
992855364 5:80855323-80855345 TATTAAAAATATGATTTTATTGG - Intronic
992905314 5:81339627-81339649 CCATAAAAGTCAGCTCTTATAGG - Intronic
993042253 5:82827566-82827588 CATTCAAAATCTGCTCTTCTAGG + Intergenic
993166693 5:84364621-84364643 CATTACAATTGTTCTTTTATGGG + Intronic
993487249 5:88502144-88502166 CATCAAAATTCTGATTTAATTGG - Intergenic
993594631 5:89837584-89837606 TATTAAAAGCTTGTTTTTATTGG - Intergenic
993788526 5:92176259-92176281 GATTAAAATTCTACTTATATAGG + Intergenic
994085121 5:95750177-95750199 CATTGAAAATCTGCATTTAAGGG + Intronic
994539684 5:101078290-101078312 CATTCAAAGACTCCTTTTTTGGG + Intergenic
995736246 5:115302973-115302995 CATTAAACACCAGCTTTTATAGG + Intergenic
995805881 5:116051799-116051821 CAATAAAATTCTGCTTTTTGTGG + Intronic
996366461 5:122706476-122706498 AAGGAAAAGTCTGCTTTTCTGGG - Intergenic
1000002515 5:157152448-157152470 TATTATAAGTATGTTTTTATTGG - Intronic
1000441802 5:161272370-161272392 CATTAAGAGTCTAATTTCATTGG - Intergenic
1000581297 5:163038070-163038092 CAATAAAAGTCTGATATTTTGGG - Intergenic
1003503437 6:6721430-6721452 AATTAAAAGTCTTAGTTTATAGG + Intergenic
1004655020 6:17651318-17651340 TATTATAATTCTGTTTTTATTGG - Intronic
1005349063 6:24916565-24916587 CATAACAAGCCTGCATTTATTGG + Intronic
1009414746 6:63403228-63403250 AAGTAAAAGTTTGCATTTATGGG + Intergenic
1009585108 6:65590788-65590810 CATTAAAATTCTGTTTTTTGAGG - Intronic
1010978828 6:82347130-82347152 CTTTAAAAGTATAATTTTATGGG - Intergenic
1012018011 6:93877305-93877327 GATTAAAAGTCTGATCTTTTGGG + Intergenic
1012035198 6:94128140-94128162 TATTAGGATTCTGCTTTTATTGG - Intergenic
1012447480 6:99321615-99321637 CATTAAAAGTCTGGATTTTCTGG - Intronic
1012629913 6:101452680-101452702 AATGCAAAGTCTGTTTTTATTGG + Intronic
1013281245 6:108639053-108639075 CGTGAAAAGTCTCCTGTTATAGG - Intronic
1013443983 6:110202470-110202492 CTTTAAAAGTCTCTTATTATAGG - Intronic
1013617297 6:111856878-111856900 CTTTAAAAGTGTGCCTTTATTGG - Intronic
1013749396 6:113385783-113385805 CTTTCAAAATCTACTTTTATTGG - Intergenic
1013885658 6:114962769-114962791 CATTAAAAGGTTTCTTTTAATGG + Intergenic
1015839603 6:137462499-137462521 TATTAAAAGTGAGTTTTTATAGG - Intergenic
1016094342 6:140017566-140017588 CATTAAAAGTCTACTATAAATGG - Intergenic
1016348509 6:143142013-143142035 CATTAAACGGCTGCTTTGGTAGG - Intronic
1017017414 6:150112972-150112994 CACAAAAAGTTTGATTTTATTGG + Intergenic
1017934834 6:158996177-158996199 CATTAAAAATGTTATTTTATTGG + Intronic
1018752613 6:166820675-166820697 AATTACAAGTCAGCTTTTATTGG - Intronic
1019232490 6:170579873-170579895 TAACAAAAGCCTGCTTTTATAGG + Intronic
1020631468 7:10645515-10645537 CATTAAACTTCTATTTTTATGGG - Intergenic
1020692967 7:11380877-11380899 AATTAAAAATATGATTTTATAGG + Intronic
1021011198 7:15468879-15468901 CATTAAAATGCTGCTCTTGTTGG + Intronic
1021853495 7:24831453-24831475 CTTTAAAGTTCTGCTTTTTTGGG + Intronic
1022629618 7:32072306-32072328 CCTTAAAAGGCTGCCTTTAATGG - Intronic
1023054650 7:36281877-36281899 ATTTAAAAATCTGCATTTATAGG - Intronic
1024189869 7:46994881-46994903 CATTATAATGCTGCTTGTATTGG - Intergenic
1025029415 7:55544821-55544843 CACTAAAATTGCGCTTTTATTGG - Intronic
1026842295 7:73676677-73676699 GATTAGAAATCTGTTTTTATGGG + Intergenic
1027614457 7:80404127-80404149 CGTTACAAGTGTGCTTTTAAAGG - Intronic
1028311121 7:89337079-89337101 CTTTAAATGTATGATTTTATAGG - Intergenic
1029959688 7:104676851-104676873 CAGTCAAATTCTGCTTTGATTGG + Intronic
1030846074 7:114413486-114413508 CATTAAAAGTATGTTTATATTGG - Intronic
1031427764 7:121627602-121627624 TATTAAAACTCTGCATTTATTGG + Intergenic
1032653331 7:133902473-133902495 GATTAAATATCTGCTTTCATGGG + Intronic
1034480422 7:151315757-151315779 CATAAAAAGTACGTTTTTATTGG + Intergenic
1036956334 8:13191895-13191917 TATTAAAACTCTGCTTTAAGGGG + Intronic
1038278767 8:26143692-26143714 CATTAAAATTTTACTTTTAATGG + Intergenic
1041133346 8:54727708-54727730 CATTAAATGTCAGATGTTATAGG + Intergenic
1042076258 8:64998317-64998339 CATTAAAAGTCCTCTTTTAGTGG + Intergenic
1042166951 8:65955145-65955167 CATTAAAATTATGTATTTATGGG + Intergenic
1042393451 8:68263369-68263391 CATTACAAATCTGATTTAATTGG + Intergenic
1043330227 8:79107583-79107605 ATTTAGAAATCTGCTTTTATTGG + Intergenic
1046149626 8:110206731-110206753 GATTAAAAGTCTGCTATTTTGGG - Intergenic
1046563899 8:115874020-115874042 AATTAAAAGTTTACTTTTACTGG + Intergenic
1046657830 8:116914113-116914135 GAGTAAAAATCTGTTTTTATTGG - Intergenic
1047643692 8:126847530-126847552 CATTACACGTGTGTTTTTATAGG + Intergenic
1047976373 8:130134433-130134455 TATTAAAATTCTACTTTTACTGG - Intronic
1048104198 8:131389420-131389442 CAAAAAGAGTCTGCTTTGATGGG - Intergenic
1048157108 8:131967060-131967082 AATTATTAGTCTGCCTTTATAGG - Intronic
1048784304 8:138034322-138034344 CAGTAACAGTCTGTTTGTATGGG - Intergenic
1049147553 8:141012585-141012607 CATTGAAAGTCTGGAATTATAGG + Intergenic
1050641829 9:7676671-7676693 CATTAAAAGTAAGCTATTAAAGG - Intergenic
1051432031 9:16989001-16989023 CATTAACAATCCCCTTTTATTGG - Intergenic
1051795312 9:20861896-20861918 CATTCAATATCTGGTTTTATGGG - Intronic
1051911396 9:22156199-22156221 CCATAAATGTCTGCTTTTATAGG + Intergenic
1052361392 9:27564370-27564392 AACTAAAATTCTGCTTTTACTGG - Intronic
1052602222 9:30648565-30648587 AATTTAAAGTCTGCTTTAACAGG - Intergenic
1053077568 9:35146705-35146727 CATTACAAGTATACTTTTTTTGG - Intergenic
1055166580 9:73202665-73202687 GATGATGAGTCTGCTTTTATTGG - Intergenic
1055696077 9:78885649-78885671 AATTAATAGTGTCCTTTTATGGG - Intergenic
1055734969 9:79317311-79317333 CAACAAATGTTTGCTTTTATTGG + Intergenic
1055887777 9:81085102-81085124 CATTAAAAGTATGCACTAATAGG - Intergenic
1056452062 9:86726042-86726064 CATTATAAAACTGCTTTTACCGG + Intergenic
1058125042 9:101182366-101182388 CATTTAAAATCTAATTTTATAGG - Intronic
1058126043 9:101196256-101196278 CCTATAAAGTCTGTTTTTATAGG - Intronic
1058671493 9:107364168-107364190 CAGTAATAGTATTCTTTTATAGG + Intergenic
1058853401 9:109035413-109035435 AAATAAATGTCTGTTTTTATAGG - Intronic
1058919420 9:109598898-109598920 CAACAAAAGTATACTTTTATTGG + Intergenic
1059776069 9:117476371-117476393 CAATTAAAGTCTGATTTTATTGG + Intergenic
1061577571 9:131516982-131517004 CATAAAAAGTCTTCTGTTACTGG + Intronic
1186249382 X:7649904-7649926 CATTAAGAATCTGCTTGTGTTGG + Intergenic
1187450771 X:19394110-19394132 TATTAAGAGTCTGCTATTACAGG - Intronic
1187490168 X:19744020-19744042 TATTAACAGCCTGCTTTGATTGG - Intronic
1189422430 X:40868050-40868072 CATTCAAAGTCCTCTTTTCTAGG + Intergenic
1189422907 X:40872706-40872728 GAAAAAAAATCTGCTTTTATGGG - Intergenic
1192394805 X:70768783-70768805 AATTTATAGTCTGCTATTATTGG - Intronic
1193130937 X:77919269-77919291 CATTATAAGTTTCCTCTTATAGG - Intronic
1194299929 X:92173631-92173653 TATGGAAAGTCTGATTTTATAGG + Intronic
1194730168 X:97443610-97443632 CATAAAAACTCAGCTTTAATGGG - Intronic
1197941886 X:131799022-131799044 AATTATAAGTCTGCATTAATAGG - Intergenic