ID: 1101427407

View in Genome Browser
Species Human (GRCh38)
Location 12:104599315-104599337
Sequence CCATTAAAAGTCTGCTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101427407_1101427412 5 Left 1101427407 12:104599315-104599337 CCATAAAAGCAGACTTTTAATGG 0: 1
1: 0
2: 2
3: 11
4: 205
Right 1101427412 12:104599343-104599365 ATGGTAGGCTTTTCACCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 27
1101427407_1101427410 -10 Left 1101427407 12:104599315-104599337 CCATAAAAGCAGACTTTTAATGG 0: 1
1: 0
2: 2
3: 11
4: 205
Right 1101427410 12:104599328-104599350 CTTTTAATGGATTCCATGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 110
1101427407_1101427414 19 Left 1101427407 12:104599315-104599337 CCATAAAAGCAGACTTTTAATGG 0: 1
1: 0
2: 2
3: 11
4: 205
Right 1101427414 12:104599357-104599379 ACCGCGCGGTCCCGGAGCCATGG 0: 1
1: 0
2: 0
3: 5
4: 84
1101427407_1101427416 20 Left 1101427407 12:104599315-104599337 CCATAAAAGCAGACTTTTAATGG 0: 1
1: 0
2: 2
3: 11
4: 205
Right 1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1101427407_1101427413 11 Left 1101427407 12:104599315-104599337 CCATAAAAGCAGACTTTTAATGG 0: 1
1: 0
2: 2
3: 11
4: 205
Right 1101427413 12:104599349-104599371 GGCTTTTCACCGCGCGGTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101427407 Original CRISPR CCATTAAAAGTCTGCTTTTA TGG (reversed) Intronic
904597808 1:31657674-31657696 CCAGAAAAAGTCTGCGTTGATGG + Intronic
905786852 1:40765279-40765301 CCATTAAAAATCTGGTTCAAAGG - Intronic
906699237 1:47845677-47845699 GTGTTTAAAGTCTGCTTTTAGGG + Intronic
907361192 1:53916838-53916860 CCATTTAAAATTTGCTTTTCCGG + Intronic
908762845 1:67527798-67527820 CCATTCAAATTATGATTTTATGG - Intergenic
909362841 1:74784530-74784552 AAAATAAAAATCTGCTTTTATGG - Intergenic
909894839 1:81054956-81054978 CCAAAATAAGTATGCTTTTAGGG + Intergenic
910353384 1:86325638-86325660 TTAGTAAAAGTCTGATTTTATGG - Intergenic
911396404 1:97315878-97315900 CTAGAAAAAGACTGCTTTTAGGG + Intronic
911456769 1:98134512-98134534 CAGTTAAAAGTGTTCTTTTATGG - Intergenic
911646596 1:100343529-100343551 CCATTATAATTCTGATTTTGGGG + Intergenic
911655829 1:100442913-100442935 TAATTCAAATTCTGCTTTTAGGG + Exonic
913243624 1:116852250-116852272 CCTTTCAGAGTCTGCTTTTCAGG - Intergenic
913464442 1:119125271-119125293 CCATTAAAAGTCACCTTCTTGGG + Intronic
914741715 1:150471343-150471365 CCATCAGAAGGCTGCTTATAGGG - Exonic
915816986 1:158978062-158978084 GCATTAAAGTTCTGCCTTTATGG + Intergenic
917498933 1:175568175-175568197 CCATTCAAGGACTGCTTTTCAGG + Intronic
918570517 1:185986321-185986343 CCTTGAAAAATCTGATTTTAAGG + Intronic
919509258 1:198440404-198440426 CCCTGAAAAATCTGCTTGTAAGG - Intergenic
919517156 1:198540164-198540186 CCATTATTATTCTGATTTTATGG + Intronic
920132176 1:203740867-203740889 CCCACAAAAGTCTGCTTTGATGG - Exonic
922400834 1:225253546-225253568 GCTTCAAAAGTCTCCTTTTATGG + Intronic
923819534 1:237422382-237422404 TCATTAAAAATTTGCTTTGAAGG - Intronic
1063319878 10:5042886-5042908 CTTTGAAAAGTTTGCTTTTATGG - Intronic
1063485534 10:6417116-6417138 CCATGGAAATTGTGCTTTTAAGG - Intergenic
1065402390 10:25320259-25320281 CCATTAAAAGTCCACTATTAAGG - Intronic
1065412095 10:25440459-25440481 CCATTAGAAGGGTGCTATTATGG - Intronic
1065648220 10:27859318-27859340 CCATTATAAATCTGTTTTTATGG - Intronic
1066653178 10:37678846-37678868 CCATTAAATTCCTGCTTCTAAGG + Intergenic
1067037534 10:42931387-42931409 CCATTAAATTCCTGCTTCTAAGG + Intergenic
1070203054 10:74226948-74226970 AAATTAATACTCTGCTTTTATGG - Intronic
1072037571 10:91577577-91577599 CCATTTAAAGTCTGCTCACATGG - Intergenic
1072127225 10:92457583-92457605 ACAGTAGAAGTCTGCTGTTAAGG - Intronic
1074037401 10:109754211-109754233 CCATCAGAACTCTGATTTTATGG + Intergenic
1074313278 10:112340829-112340851 CCATCATAGGTCTGATTTTAAGG - Intergenic
1074393212 10:113075154-113075176 CCATTTAAAGTATTCTTTTCAGG - Intronic
1076459910 10:130635070-130635092 TCAGTAAAAGTCTGATTTTGTGG + Intergenic
1078943878 11:16041646-16041668 AGATTAAAATTCTGCTTTTGTGG + Intronic
1079944759 11:26728082-26728104 CCATTAGAATTCAGCTTTTCAGG + Intergenic
1082643895 11:55698081-55698103 TGACTAAAAATCTGCTTTTATGG + Intergenic
1085706786 11:78793614-78793636 CCATTAATAGTCAGCATTTGAGG + Intronic
1086296913 11:85379294-85379316 GGATTAAAAGTCAGCTGTTAGGG - Intronic
1087233108 11:95688320-95688342 ACATTAAAATTGTGCTTTTCTGG - Intergenic
1087767625 11:102173346-102173368 CCATTAAAAATCTTCTTTAGGGG + Intronic
1088009416 11:104981263-104981285 CCAATTAATGTCTGCCTTTATGG + Intergenic
1090510576 11:127370388-127370410 TCAATAAAAGTCTGATTTTCTGG - Intergenic
1094232807 12:28127409-28127431 CTATTAAAGTTCTGTTTTTAGGG - Intergenic
1098877391 12:75880652-75880674 CCATGAACTGTCTGCTTTTTAGG - Intergenic
1100607178 12:96161430-96161452 CCATGAAAAATCTCCTTTCATGG + Intergenic
1101341535 12:103846230-103846252 CATTTACAAGACTGCTTTTAAGG + Intergenic
1101427407 12:104599315-104599337 CCATTAAAAGTCTGCTTTTATGG - Intronic
1103347244 12:120259525-120259547 GCATTAAAAGTCCGTCTTTAAGG + Intronic
1104559281 12:129829421-129829443 CCATGACAAATGTGCTTTTATGG + Intronic
1104578719 12:129993001-129993023 CCTTCAAAAGGCTGCTTTTTTGG - Intergenic
1107255263 13:38418355-38418377 ATATTTAAAGTCTTCTTTTAAGG - Intergenic
1109866450 13:68271327-68271349 CCCTTATAAGACTGCTGTTAGGG + Intergenic
1110004070 13:70243487-70243509 TCATTAAAACTCTGCTTTTATGG - Intergenic
1110083780 13:71350979-71351001 CCATTAAAATTCTGATTAAATGG + Intergenic
1112414248 13:99191177-99191199 CCATTAGAAGTCTGCAGTCAGGG + Intergenic
1112460468 13:99599636-99599658 AAATTCAAAGACTGCTTTTAAGG - Intergenic
1115355923 14:32447505-32447527 CCAGGAAAATTCTGCTTTTTTGG - Intronic
1117429373 14:55638508-55638530 ACATTAAAATTTTGTTTTTAAGG + Intronic
1119164831 14:72483633-72483655 TCATTACAACTTTGCTTTTATGG + Intronic
1119811447 14:77523792-77523814 CCTTTCAAAGCTTGCTTTTAAGG - Intronic
1119945234 14:78686431-78686453 CCATTAATTGTCTGCTTTGATGG + Intronic
1123103559 14:105823377-105823399 CCATTATAACTCTGTTGTTATGG - Intergenic
1123496043 15:20828061-20828083 CCATTTAAAGTCTGTTTTATCGG - Intergenic
1123552528 15:21397153-21397175 CCATTTAAAGTCTGTTTTATCGG - Intergenic
1123588774 15:21834541-21834563 CCATTTAAAGTCTGTTTTATCGG - Intergenic
1125762712 15:42108133-42108155 CCATTAAGAGTCTGCTGTTGGGG + Intergenic
1126253479 15:46596513-46596535 TCATTAAAAGTCTGCACTCAGGG - Intergenic
1127875740 15:63109876-63109898 CAATTACAAGTCATCTTTTATGG - Intergenic
1128554289 15:68620563-68620585 CATTCAAAAGTCTGCGTTTAGGG + Intronic
1131120681 15:89821705-89821727 CCATTAAAATACTGCTTAAAGGG + Intergenic
1132283164 15:100638162-100638184 CCCTTAAAAATCTGATTTTAGGG - Intronic
1202960877 15_KI270727v1_random:124373-124395 CCATTTAAAGTCTGTTTTATCGG - Intergenic
1138649330 16:58450053-58450075 ACTTGAAAAGTCTGCTGTTAGGG - Intergenic
1140411194 16:74741389-74741411 CAAGTAAAAGTCGGCTTTTGTGG + Intronic
1140425823 16:74860480-74860502 CCATTAAAAGTCAGCTTTTCAGG + Intergenic
1140896881 16:79332707-79332729 CTATTACAAGTCTCCTTTGATGG + Intergenic
1149533750 17:57416282-57416304 GCATTAAAAATGTTCTTTTAAGG + Intronic
1149755841 17:59184745-59184767 CCATTAAAAGTTCTCTTTTGTGG + Intronic
1149785935 17:59435013-59435035 CCATCAAAAGTCAGGTTTCAGGG - Intergenic
1152669760 17:81595842-81595864 TCATTAAAAGTCCACTTTTTTGG - Intronic
1154471056 18:14702053-14702075 ACATTAAAAATCTGTTTTTTGGG - Intergenic
1155804519 18:30150854-30150876 ACATTAAAAGTATGTTTTTGGGG - Intergenic
1156722408 18:40086088-40086110 CACTTAAAAGTCTTCTTATAAGG - Intergenic
1157528394 18:48402359-48402381 CCATTACAAGTGTGTTTCTAAGG + Intronic
1157993876 18:52531340-52531362 CCTTTTCCAGTCTGCTTTTAAGG - Intronic
1158708426 18:59815894-59815916 AATTTAAAAGTCTGCTTTTCCGG + Intergenic
1165598836 19:37035497-37035519 CCACAAAAAGTCTGCGTGTATGG + Intronic
1165994935 19:39837402-39837424 CCATAAAAAGCCTCCTTTTGGGG - Intronic
1166120500 19:40683525-40683547 ACATTCAAAGTCTGCTTCCAGGG + Intronic
1166622763 19:44317477-44317499 CCATTAAAAATCTGATTATTTGG + Intergenic
927322188 2:21759864-21759886 ACATTTAAAGATTGCTTTTAGGG - Intergenic
933072293 2:77874250-77874272 GCATTAAAAGTCTATTTTTTTGG - Intergenic
933469828 2:82707784-82707806 CCATTAAAAGTCTACATTCATGG + Intergenic
933515994 2:83302643-83302665 AGATCAAAATTCTGCTTTTATGG - Intergenic
935793227 2:106613618-106613640 CATATAAATGTCTGCTTTTATGG + Intergenic
936992883 2:118384875-118384897 CCATTAAAAATTACCTTTTAGGG - Intergenic
938624583 2:133094405-133094427 TAATTAAAAGACTCCTTTTAAGG + Intronic
939154185 2:138504450-138504472 GCTTTAAAAGTCTGATTCTAGGG - Intronic
940389537 2:153116037-153116059 AAATTAAAAGTGTGGTTTTAGGG + Intergenic
941505567 2:166339748-166339770 AATTTAAAAGTCTGATTTTAAGG - Intronic
941889275 2:170561210-170561232 CCATTCTAACTCTTCTTTTAAGG - Intronic
942884505 2:180906893-180906915 CCATAAATAGTCTGTTTTCATGG - Intergenic
946540243 2:220676372-220676394 TCATTAAAACTCTGATTTAATGG - Intergenic
946566790 2:220974446-220974468 CCTTTAAAAGTCACCTTTTTTGG + Intergenic
946955472 2:224925099-224925121 CGTTTAAAAGCCTGCTTTTCAGG + Intronic
947103169 2:226643345-226643367 CCCTTAAGAGTCTGTTTCTAGGG - Intergenic
1168902692 20:1378304-1378326 TGATTAAAAGTGTGCTTTGAAGG + Intronic
1169720944 20:8675704-8675726 CCCTTAAAAGTCTCTTTTAATGG - Intronic
1170166702 20:13367027-13367049 ACATTGAAAGGCTCCTTTTATGG + Intergenic
1170432020 20:16284563-16284585 GCAGAAAAACTCTGCTTTTATGG + Intronic
1170649072 20:18223450-18223472 CAATTAAGAGTCTGCTTCTGGGG - Intergenic
1170744290 20:19085038-19085060 AAAATAAAAGTCTACTTTTATGG + Intergenic
1170813092 20:19690185-19690207 TCATTGAATTTCTGCTTTTAAGG + Intronic
1175753989 20:61517759-61517781 CTATTATATGTCTGATTTTATGG + Intronic
1177417356 21:20811821-20811843 CATTTAAAAATATGCTTTTAAGG - Intergenic
1179165339 21:38931177-38931199 CCTTTAAGAGCATGCTTTTAGGG - Intergenic
949178842 3:1102024-1102046 TTTTTAAAAGTCTTCTTTTAAGG + Intronic
949664597 3:6322570-6322592 CTGTTAGAAATCTGCTTTTAAGG + Intergenic
950821218 3:15761447-15761469 TCATTAAAAGGCTGTTTTGATGG + Intronic
950942343 3:16905415-16905437 CCATTAGAAGGCTGCTATTTTGG - Intronic
951154146 3:19328538-19328560 GCAATAAAAATTTGCTTTTAGGG + Intronic
953713359 3:45294038-45294060 CCATGGGAACTCTGCTTTTAAGG - Intergenic
954046285 3:47933900-47933922 CCATTTAAAGTTGGCTTTTGGGG - Intronic
956561983 3:70588714-70588736 CCATAAGAAGCCTCCTTTTAGGG + Intergenic
957307464 3:78476327-78476349 CCCTGAAAAGTCTTCTTTTGTGG - Intergenic
957705326 3:83772790-83772812 CCATAATTACTCTGCTTTTATGG - Intergenic
958181737 3:90069501-90069523 CCATTATGAGTCTCATTTTAGGG + Intergenic
960645022 3:119870557-119870579 ACATTAAAATCCAGCTTTTAGGG - Intronic
961618064 3:128199537-128199559 CCATTAAAAGACTGGTTAAATGG - Intronic
962568541 3:136689042-136689064 CCATAAAGAATCTGCTTTTCTGG - Intronic
962692895 3:137918617-137918639 CCAGTTAGAGCCTGCTTTTAGGG - Intergenic
964881674 3:161430269-161430291 CCATTAAAAGTCTTCTCATTGGG + Intergenic
965365766 3:167797689-167797711 CCATTATAAGTCTATTCTTAAGG + Intronic
966697420 3:182805136-182805158 CCAATAAAAGTCTACTCTTTAGG - Intronic
967800772 3:193656776-193656798 CATATAAAAGTCTGCATTTACGG - Intronic
968311748 3:197689330-197689352 CAATTAAAAAGCTGCTTTTTAGG - Intronic
970124201 4:12791157-12791179 CCATATAAAATCTGGTTTTATGG - Intergenic
971116194 4:23648133-23648155 CCAGTAAAAATTTGATTTTATGG + Intergenic
971969005 4:33597820-33597842 CTATTAAAATTCTGCATTTGAGG - Intergenic
973219932 4:47713768-47713790 ACATTAAAAATTTGCTTTTTTGG - Intronic
973575780 4:52287772-52287794 CCATTAAAATGATGCTTATAGGG + Intergenic
976331178 4:83832729-83832751 CCATTAAAACTCAGCCTTTGAGG - Intergenic
977348478 4:95848256-95848278 CTATTAAAAGGCTGCTTTCCAGG + Intergenic
978128610 4:105165708-105165730 CCTTTCTAAGTCTGCATTTAGGG + Intronic
978331510 4:107618289-107618311 CTATTAAAACTCTTCTATTAAGG - Intronic
979415325 4:120430994-120431016 TTATTAAAAGTCTGGTTGTAGGG - Intergenic
980592455 4:134908260-134908282 ACACTAAATGTCTGCTTTTCCGG + Intergenic
982116515 4:152102946-152102968 CTATTTAAAGTCTCCTTATATGG - Intergenic
984256656 4:177397681-177397703 CCATTCAAATTCTGCTTTCTAGG + Intergenic
985296013 4:188438144-188438166 CCACTGAAAGTCTACTGTTACGG - Intergenic
985979445 5:3450294-3450316 CCATGAAAAGGCAGCTCTTAAGG + Intergenic
986664814 5:10092284-10092306 CCTTTAAAAATTTTCTTTTAAGG - Intergenic
987858854 5:23457520-23457542 CCATTAACAGGCTGATTTTCTGG + Intergenic
988275613 5:29077955-29077977 TCACTCAAAGTTTGCTTTTAGGG + Intergenic
990662188 5:58028281-58028303 CCATTTAACTTCTGCTTTTCTGG + Intergenic
993092841 5:83448312-83448334 CCAATTAAAGTCTAATTTTAAGG + Intergenic
993647305 5:90476488-90476510 GCCTTAAAAGACTACTTTTAGGG + Intronic
994085120 5:95750176-95750198 GCATTGAAAATCTGCATTTAAGG + Intronic
994679999 5:102874845-102874867 CCATAAAAAGTCTGTGTTCAAGG + Intronic
994987005 5:106947458-106947480 AGAGTAAAAGTCTGCTTATATGG - Intergenic
999528704 5:152437324-152437346 CCATTGATAGTCTGATATTAAGG - Intergenic
1001152887 5:169247629-169247651 CCAATAAAAGTCAGCTTTCCAGG - Intronic
1003074196 6:2969698-2969720 CCATTTAAAGACTGGTTTAATGG + Intronic
1003760927 6:9177971-9177993 CTCTTAAAAGTCTGCTTTCTAGG + Intergenic
1007583043 6:42970691-42970713 ACTTTAAAAGTATGGTTTTATGG + Intronic
1009335551 6:62485995-62486017 CCATTGCCAATCTGCTTTTAAGG + Intergenic
1009413343 6:63391928-63391950 CCAGTATAAGTCTTCTTTTAAGG + Intergenic
1010066181 6:71685238-71685260 CTATTAAAATTCTGCTATTAAGG - Intergenic
1010122990 6:72400736-72400758 CCAATAAAACTCTACTTTTCAGG + Intronic
1013695008 6:112691865-112691887 TCATTAAAAGTTTGATTTTCTGG + Intergenic
1014381265 6:120745271-120745293 CATTTAAATGTCTGCTCTTATGG - Intergenic
1015484924 6:133758584-133758606 TTTTTAAAAGTATGCTTTTAAGG + Intergenic
1015751065 6:136559650-136559672 AAATTAAGACTCTGCTTTTATGG - Intronic
1015978775 6:138818262-138818284 CCATTTCAAGTCTGCTCTGATGG - Intronic
1016608857 6:145964968-145964990 CCCTTTAAAGTCTGTTTTTGAGG - Intergenic
1016971911 6:149771816-149771838 TCATTAAAAGTTTTTTTTTACGG - Intronic
1020724674 7:11797009-11797031 CTATTAGTTGTCTGCTTTTAGGG - Intronic
1031214173 7:118869742-118869764 TCATTAAAAGTCTCATTTTTTGG + Intergenic
1036777427 8:11623311-11623333 CCTTTAAAACTGTGTTTTTAGGG - Intergenic
1036956333 8:13191894-13191916 CTATTAAAACTCTGCTTTAAGGG + Intronic
1037128726 8:15382564-15382586 CTATTAAAAGGCAGCTGTTAAGG - Intergenic
1042866012 8:73357306-73357328 CCATTAAAGCTCTGCTTTGGAGG - Intergenic
1042893536 8:73640581-73640603 CCAATAAAATTTTGTTTTTATGG + Intronic
1043173740 8:76998580-76998602 GCATTAAAATTCTGGTTTTTGGG - Intronic
1044031078 8:87238333-87238355 CCATTTAAATTTTGCTTTTAGGG + Intronic
1044419480 8:91977615-91977637 ACATTAAAAGACAACTTTTAAGG + Intronic
1045424272 8:102048262-102048284 CCGGCAATAGTCTGCTTTTATGG - Intronic
1045820794 8:106335793-106335815 AAATTAAAAGGCTGATTTTAAGG + Intronic
1045877116 8:106994649-106994671 ACATTAAAAGCCTAGTTTTAGGG - Intergenic
1046149627 8:110206732-110206754 TGATTAAAAGTCTGCTATTTTGG - Intergenic
1046998167 8:120547293-120547315 CCATAAAAAGTTTGTTTTTCAGG + Intronic
1047888002 8:129274250-129274272 CAATTAAAAGTCTGATTCCAGGG + Intergenic
1048104199 8:131389421-131389443 CCAAAAAGAGTCTGCTTTGATGG - Intergenic
1050156217 9:2668803-2668825 CCATTAATACTCTGTTTTGATGG - Intergenic
1051710897 9:19929312-19929334 CCATTCACAGTCTTCATTTAGGG + Intergenic
1051860011 9:21613856-21613878 CCATTACAAATCTACTTGTATGG - Intergenic
1052028084 9:23596786-23596808 TCATTAAAACTGTGCTTTAATGG - Intergenic
1053570344 9:39298391-39298413 CCATTTAAAGTATGTTTTTTTGG - Intergenic
1054091966 9:60857400-60857422 CCATTTAAAGTATGTTTTTTTGG - Intergenic
1054113379 9:61132990-61133012 CCATTTAAAGTATGTTTTTTTGG - Intergenic
1054126804 9:61320616-61320638 CCATTTAAAGTATGTTTTTTTGG + Intergenic
1054594320 9:67049178-67049200 CCATTTAAAGTATGTTTTTTTGG + Intergenic
1055517885 9:77051535-77051557 CCAATAACATTCTGCTTATAGGG - Intergenic
1056056300 9:82827239-82827261 TCTTTAAATGTATGCTTTTATGG - Intergenic
1056108079 9:83367329-83367351 TAATTAAAAGTTTGATTTTAAGG + Intronic
1056120598 9:83484084-83484106 CCTTTAAATGTATTCTTTTAAGG - Intronic
1056478988 9:86981946-86981968 GCTTTAAATGCCTGCTTTTATGG - Intergenic
1056697934 9:88876038-88876060 CCATCACATGTCTGCTTTTAAGG + Intergenic
1185912270 X:3993069-3993091 CCATTGGAAGTCTACTTTCATGG + Intergenic
1188385341 X:29550650-29550672 CAATTAAAAGTTTGCTCTCATGG + Intronic
1190502003 X:51088278-51088300 CCTTTAAAAGTTTTCTTTTCAGG - Intergenic
1196366444 X:114929423-114929445 CCAATAAAAGTCTGATATTGGGG + Intergenic
1196411204 X:115421146-115421168 CACTTAAAAGTCTCCTTTTGAGG + Intergenic
1197640269 X:128959622-128959644 CCAGCAAAAGTCTGCTGCTAAGG - Intergenic
1199155359 X:144540156-144540178 CCATTAAAAGACTACTATTTTGG + Intergenic