ID: 1101427411

View in Genome Browser
Species Human (GRCh38)
Location 12:104599341-104599363
Sequence GCGCGGTGAAAAGCCTACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 19}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101427411_1101427416 -6 Left 1101427411 12:104599341-104599363 CCATGGTAGGCTTTTCACCGCGC 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1101427411_1101427421 22 Left 1101427411 12:104599341-104599363 CCATGGTAGGCTTTTCACCGCGC 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1101427421 12:104599386-104599408 ATGAGCCCGTCTGCCGCCATAGG 0: 1
1: 0
2: 0
3: 3
4: 33
1101427411_1101427414 -7 Left 1101427411 12:104599341-104599363 CCATGGTAGGCTTTTCACCGCGC 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1101427414 12:104599357-104599379 ACCGCGCGGTCCCGGAGCCATGG 0: 1
1: 0
2: 0
3: 5
4: 84
1101427411_1101427422 23 Left 1101427411 12:104599341-104599363 CCATGGTAGGCTTTTCACCGCGC 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1101427422 12:104599387-104599409 TGAGCCCGTCTGCCGCCATAGGG 0: 1
1: 0
2: 1
3: 0
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101427411 Original CRISPR GCGCGGTGAAAAGCCTACCA TGG (reversed) Intronic
1076496467 10:130900769-130900791 GCGCGATGAAAGGCCTCCCATGG + Intergenic
1077737709 11:4808659-4808681 GCCCTGTGAAAAGCCTACTGGGG - Intronic
1089736326 11:120552468-120552490 GTGCAGGGAAAAGCATACCATGG + Intronic
1090153535 11:124411568-124411590 CAGCGGTGAAAAGCCTAAGACGG - Intergenic
1096095102 12:48929533-48929555 GCCCACTAAAAAGCCTACCATGG + Intronic
1101427411 12:104599341-104599363 GCGCGGTGAAAAGCCTACCATGG - Intronic
1108228741 13:48317262-48317284 GCGCGGGGAGAAGCCCACAAGGG + Intronic
1125612304 15:40979823-40979845 GTGCTGTGAAGAGCCTTCCATGG - Exonic
1149638577 17:58189281-58189303 GCACGATGAAAAGCCCACGAGGG + Intergenic
1165976285 19:39679701-39679723 GGGAGGTGAACAGCCCACCAGGG + Intergenic
934537177 2:95144485-95144507 GCACAGAGAAATGCCTACCATGG - Intronic
944441797 2:199750700-199750722 GCCCGGTGGAAAGCCATCCATGG - Intergenic
1170140437 20:13120907-13120929 GCACAGTGAACAGCCTAACATGG + Intronic
1179789631 21:43748912-43748934 GCGCGGAGGGAAGCCCACCACGG - Intronic
1183639233 22:39083255-39083277 GCGGGGAGAAGAGCCTGCCAGGG - Intronic
1184151962 22:42644572-42644594 GGGCTGTGAAAAGTCTACCAAGG - Intronic
991124486 5:63053997-63054019 GCACTTTGAAATGCCTACCAGGG - Intergenic
1017064675 6:150518133-150518155 GGGAGGTAAAAATCCTACCAGGG - Intergenic
1018939466 6:168299569-168299591 GTGAGGTGAAATGCCTTCCAAGG + Intronic
1018955933 6:168410700-168410722 CCGCGGTGCACAGCCTGCCAGGG + Intergenic
1038737982 8:30189594-30189616 GAGCAGTGATTAGCCTACCAAGG - Intergenic
1193557328 X:82971692-82971714 GCATGGTGAAATACCTACCAGGG - Intergenic