ID: 1101427416

View in Genome Browser
Species Human (GRCh38)
Location 12:104599358-104599380
Sequence CCGCGCGGTCCCGGAGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101427406_1101427416 21 Left 1101427406 12:104599314-104599336 CCCATAAAAGCAGACTTTTAATG 0: 1
1: 0
2: 1
3: 27
4: 273
Right 1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1101427411_1101427416 -6 Left 1101427411 12:104599341-104599363 CCATGGTAGGCTTTTCACCGCGC 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1101427403_1101427416 24 Left 1101427403 12:104599311-104599333 CCCCCCATAAAAGCAGACTTTTA 0: 1
1: 0
2: 1
3: 19
4: 226
Right 1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1101427404_1101427416 23 Left 1101427404 12:104599312-104599334 CCCCCATAAAAGCAGACTTTTAA 0: 1
1: 0
2: 2
3: 36
4: 310
Right 1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1101427407_1101427416 20 Left 1101427407 12:104599315-104599337 CCATAAAAGCAGACTTTTAATGG 0: 1
1: 0
2: 2
3: 11
4: 205
Right 1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1101427405_1101427416 22 Left 1101427405 12:104599313-104599335 CCCCATAAAAGCAGACTTTTAAT 0: 1
1: 1
2: 5
3: 25
4: 378
Right 1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG 0: 1
1: 0
2: 0
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101427416 Original CRISPR CCGCGCGGTCCCGGAGCCAT GGG Intronic
914900558 1:151709115-151709137 CCGCGGGGTCCCGCAGGGATGGG - Intronic
919981294 1:202644098-202644120 CCGCGGGCTGCCGGAGCCCTCGG - Intronic
922831645 1:228557390-228557412 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922832122 1:228609372-228609394 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922832682 1:228611613-228611635 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922833243 1:228613854-228613876 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922833803 1:228616095-228616117 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922834360 1:228618336-228618358 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922834922 1:228620567-228620589 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922835472 1:228622770-228622792 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922836030 1:228625012-228625034 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922836587 1:228627252-228627274 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922837147 1:228629493-228629515 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922837707 1:228631735-228631757 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922838265 1:228633975-228633997 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922838824 1:228636200-228636222 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922839383 1:228638441-228638463 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922839944 1:228640672-228640694 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922840504 1:228642913-228642935 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
922841067 1:228645144-228645166 CCGGGCGGGCCCGGAGGCCTGGG + Intergenic
1063504036 10:6580238-6580260 CCGCGCAGTCCCAGCGCCACCGG - Exonic
1069738433 10:70672589-70672611 CCTCGCGCGCCCGGAGCCAGCGG + Intergenic
1071817853 10:89251421-89251443 CCTCGCGGTCCAGGAGCACTGGG + Intronic
1073460119 10:103661314-103661336 CCGCGGGGTCCGGGGGACATGGG + Intronic
1074503119 10:114043990-114044012 CGGCGCGGGGCCGGAGGCATGGG - Intergenic
1076312290 10:129517188-129517210 CCTCGCTGTCCAGGAGCCATGGG - Intronic
1076658446 10:132039481-132039503 CCACGCTGTCCAGGGGCCATGGG - Intergenic
1083457135 11:62786814-62786836 CCGGGCGGCCGCGGAGCCGTGGG - Exonic
1083635438 11:64118222-64118244 CCGCGTGGTGCCGTAGCCAATGG - Exonic
1089398879 11:118153073-118153095 CCTCGCGGTCCCGGAGCCCCGGG + Intergenic
1092256198 12:6927970-6927992 CCGCGCGATCCCGGGCCCCTCGG - Intronic
1095085044 12:38051356-38051378 CCGGGTGGTGCCGGAGACATGGG + Intergenic
1096668160 12:53180798-53180820 CCGCGCGGCCAGGGAGCCAGCGG + Exonic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1115910899 14:38255600-38255622 CCGCGCGGTGCAGGAGCGTTGGG + Exonic
1124496996 15:30192833-30192855 CCGCGGGCTGCCGGAGCCCTCGG - Intergenic
1124746580 15:32345814-32345836 CCGCGGGCTGCCGGAGCCCTCGG + Intergenic
1128109550 15:65067936-65067958 GCGCGCGGCCCCGGACCCGTCGG + Exonic
1137683162 16:50368639-50368661 CCGGGCCGCCCCGGAGCCACTGG + Intronic
1142336155 16:89490557-89490579 CCGCTGGGTCCTGGAGCCAGAGG - Exonic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1144730420 17:17522809-17522831 CCGCGTGCTCCTGCAGCCATGGG - Intronic
1164155755 19:22596053-22596075 CCGCCCGCTCCCGGAGTCAGCGG + Intergenic
1164693834 19:30228811-30228833 CCGGGCAGTCCCGGAGCCCGCGG - Intronic
1166689379 19:44813454-44813476 CCGCACGGTCCGGGAGGCCTCGG + Exonic
929118871 2:38467438-38467460 CACAGCGGTCCCAGAGCCATAGG + Intergenic
930711920 2:54557999-54558021 CCGCGCGGGCCCGGGACCCTTGG + Intronic
934653082 2:96103461-96103483 CCTAGCTGTCCCGCAGCCATCGG - Intergenic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
1175853114 20:62104368-62104390 ACCTGCGGTCCGGGAGCCATGGG + Intergenic
1176177310 20:63734895-63734917 TCCCGGGGTCCCGCAGCCATCGG + Intronic
1179853574 21:44150903-44150925 CAGCGGGGTCCCGGAGAGATGGG - Intergenic
969714331 4:8861086-8861108 CCGCGGGGTCCCGGACACAGCGG + Intronic
970637104 4:18021668-18021690 CCGCTCAGTGCCGGAGCCCTCGG - Exonic
975706100 4:77113279-77113301 TCGCGCGGTGCCGGAGTCCTCGG + Intergenic
984803722 4:183735806-183735828 CCGCCCAGTCCCGGAGCGAGCGG - Intergenic
1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG + Exonic
1036930639 8:12952123-12952145 CAGCGCTGTCCCGCAGCCAGGGG - Intronic
1054891793 9:70259317-70259339 CCGCGCGCTGCCGGAGCCCCGGG - Intronic
1062579054 9:137221621-137221643 GCGCCCTGTCCTGGAGCCATGGG - Intergenic
1062722030 9:138049615-138049637 CCGCCCGGTCCCAGAGCCACCGG - Intronic
1194810273 X:98380342-98380364 CCGCGCGTGCCTGCAGCCATTGG + Intergenic
1198715652 X:139555461-139555483 CAGCGCCGTTCCGGAACCATAGG - Intronic
1200218436 X:154379026-154379048 CCGCGCGGGCGCGGAGCAAAAGG - Intergenic