ID: 1101430497

View in Genome Browser
Species Human (GRCh38)
Location 12:104622955-104622977
Sequence CACTTTAGACTGCTTCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101430497_1101430499 -9 Left 1101430497 12:104622955-104622977 CCCTGCTGAAGCAGTCTAAAGTG 0: 1
1: 0
2: 2
3: 10
4: 118
Right 1101430499 12:104622969-104622991 TCTAAAGTGCTCAACTAAGTTGG 0: 1
1: 0
2: 0
3: 9
4: 125
1101430497_1101430500 14 Left 1101430497 12:104622955-104622977 CCCTGCTGAAGCAGTCTAAAGTG 0: 1
1: 0
2: 2
3: 10
4: 118
Right 1101430500 12:104622992-104623014 TGCATTAATCTCTAGACCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101430497 Original CRISPR CACTTTAGACTGCTTCAGCA GGG (reversed) Intronic
902120414 1:14160199-14160221 CACTTTAGCCTGCAATAGCAAGG + Intergenic
905882573 1:41474295-41474317 CATGCTAGACTGGTTCAGCAAGG - Intergenic
907487316 1:54786956-54786978 CCCTCTAGACTGCTTCGGCAAGG - Exonic
909592723 1:77370082-77370104 CACTTTGGACTTATTCTGCAAGG - Intronic
918316954 1:183330468-183330490 CAGCTTGGACTGCTTCACCATGG + Intronic
918964428 1:191323566-191323588 CAGTTTAGACTGATTCACCTGGG + Intergenic
920172720 1:204081793-204081815 GACTTCAGACTCCTTCAGTAGGG - Intronic
921491795 1:215786120-215786142 CATTTTGGACTAATTCAGCAGGG + Intronic
924586479 1:245365331-245365353 CTCTTTACACTGCAGCAGCAAGG - Intronic
1063026321 10:2182319-2182341 CACTTTAGAAGGCTGAAGCAGGG + Intergenic
1063986422 10:11508612-11508634 CACTTTTTACTGCTTCATCGAGG - Intronic
1064788519 10:18927546-18927568 CACTTTAGAGCACTTCAGAAAGG - Intergenic
1067448155 10:46365629-46365651 CTCCTTGGACTGCATCAGCAGGG + Intergenic
1067512955 10:46910950-46910972 CAATTAAGACAACTTCAGCAAGG - Intergenic
1067649291 10:48140872-48140894 CAATTAAGACAACTTCAGCAAGG + Intergenic
1074324589 10:112436777-112436799 CAATTTTTACTGCTTCATCAAGG - Intronic
1079876317 11:25861618-25861640 CACTTTGGACTGCATGAGAATGG + Intergenic
1083986592 11:66219774-66219796 AACTTTAAACCGCTTCAGGAGGG - Exonic
1090337595 11:125983370-125983392 GACTCAAGACTGCTCCAGCATGG - Intronic
1095232645 12:39759755-39759777 CATTTTAGACTATTTCAGGAAGG + Exonic
1095703232 12:45212455-45212477 CACTGGAGACTGCTTAAGCGGGG + Intergenic
1098153697 12:67574947-67574969 TACTTTAAAATACTTCAGCATGG - Intergenic
1098976011 12:76902856-76902878 CACTGTACCCTGCCTCAGCAGGG - Intergenic
1099298128 12:80856629-80856651 CACTTTACACTGCATCAGCATGG - Intronic
1101430497 12:104622955-104622977 CACTTTAGACTGCTTCAGCAGGG - Intronic
1103285068 12:119794068-119794090 CACTTTAGACTGGGTCCGCAAGG - Intronic
1103856672 12:123974714-123974736 CATTTTTGACTGCTTTAACAAGG + Intronic
1104137287 12:125952623-125952645 CTCTGAAGACTGGTTCAGCATGG - Intergenic
1105752213 13:23431886-23431908 CACTTTAGCATGCTTCACCATGG + Intronic
1107333071 13:39322556-39322578 CCCTTTAGACTGCTTCTTAAGGG + Intergenic
1107598669 13:41990501-41990523 CCCTTTATTCTGCTTCAGGAGGG - Intergenic
1112983079 13:105410685-105410707 CACTTTTCGCTGCTTCATCAAGG - Intergenic
1114244976 14:20904671-20904693 CACTTTAGCCTGCTTTGGCAAGG - Intergenic
1115375526 14:32671263-32671285 TAGTCTAGCCTGCTTCAGCAGGG - Intronic
1116523338 14:45875135-45875157 TTTTTTAGACTGCTTCTGCATGG + Intergenic
1117161592 14:52995171-52995193 CACATTAGCCTGCTGCGGCAGGG + Intergenic
1120917772 14:89724722-89724744 GACTTTTTACGGCTTCAGCAAGG + Intergenic
1121936673 14:98026054-98026076 CACTTTAGCCTTCTTCAGGAAGG - Intergenic
1122259222 14:100502567-100502589 CACTTTAGAGTTCTTCATTAGGG + Intronic
1202928416 14_KI270725v1_random:15425-15447 CATTTTAGTCAGCTTCTGCAGGG - Intergenic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1140607262 16:76553867-76553889 CACTTTTGATTGCATTAGCAAGG - Exonic
1144137304 17:12309089-12309111 CACTATAGACTACTATAGCATGG - Intergenic
1149457879 17:56803085-56803107 CACTCTATACTGTTTCACCAGGG - Intronic
1149623475 17:58063287-58063309 CACTTAAGACTCCTTAGGCATGG + Intergenic
1155678339 18:28457992-28458014 CTGGTTAGACTGCTTCAGCGAGG - Intergenic
1156682098 18:39602665-39602687 CACATTTGACTTGTTCAGCATGG + Intergenic
1164659546 19:29950579-29950601 CACTTTTGAATGGTTCTGCAGGG - Intronic
926819904 2:16840598-16840620 AACTTTAGAAAGCTTCAGAAAGG - Intergenic
932188388 2:69717891-69717913 CCCTCTAGAATGTTTCAGCAGGG + Intronic
936441978 2:112562394-112562416 AAGTTTAAATTGCTTCAGCAAGG - Intronic
937924743 2:127158952-127158974 TACTTTATACTGCTTCCTCAAGG - Intergenic
940214029 2:151286367-151286389 CTCTTTAGTCTCCTTCAGTATGG - Intronic
944991208 2:205238185-205238207 CACATTAAACACCTTCAGCAGGG - Intronic
945248157 2:207739733-207739755 TAATTTTTACTGCTTCAGCAAGG + Intronic
945253246 2:207782376-207782398 CACTTTGGCCTGCTGCAGCAGGG - Intergenic
945424302 2:209681103-209681125 CACTTTAGAATGCTTTAACAGGG + Intronic
945488685 2:210428561-210428583 CAGTTCAGATTGCATCAGCAAGG + Intergenic
1176590445 21:8644068-8644090 CATTTTAGTCAGCTTCTGCAGGG - Intergenic
1179260226 21:39751291-39751313 CCCTTTGGAGGGCTTCAGCAAGG - Intronic
1180273273 22:10621101-10621123 CATTTTAGTCAGCTTCTGCAGGG - Intergenic
1182658495 22:31908341-31908363 CACTTTGTACTTCTCCAGCATGG + Intergenic
1183127408 22:35797503-35797525 TACTTTTTACTGCTTCATCAAGG + Intronic
949136837 3:577607-577629 CATTTTAGTCAGCTTCTGCAGGG + Intergenic
951834616 3:26968445-26968467 CAGTTTACTGTGCTTCAGCATGG + Intergenic
952236444 3:31485416-31485438 CCCTTTAAGCTGCCTCAGCAGGG + Intergenic
963135370 3:141898631-141898653 CATTTTACACTCCTACAGCAGGG - Intronic
963338279 3:144002417-144002439 CAATTTAGGCTGCCTCAGCTGGG - Intronic
964999121 3:162929420-162929442 CATATTAGTCTGATTCAGCATGG + Intergenic
966176770 3:177147012-177147034 TACTTTTTACTGCTTCATCAAGG + Intronic
966615900 3:181912023-181912045 CACTTTGGATTGTTTCTGCAAGG + Intergenic
972931820 4:44081158-44081180 AATTTTTAACTGCTTCAGCATGG - Intergenic
973022797 4:45224587-45224609 CATCTGAGACTGCCTCAGCATGG - Intergenic
974852311 4:67418611-67418633 AATTTTTTACTGCTTCAGCAAGG + Intergenic
976180584 4:82395157-82395179 CACCTTAGAAAGCTTCAGGAAGG - Intergenic
979828549 4:125270931-125270953 CACTGGTGACTGCTTCAGAAAGG - Intergenic
984713735 4:182906872-182906894 CCCTTCAGACAGCATCAGCAAGG + Intronic
986361159 5:6979489-6979511 CCCTTTAGTCTGCTATAGCAGGG + Intergenic
988411455 5:30891078-30891100 CACTTTTGAAAACTTCAGCACGG + Intergenic
990941544 5:61207235-61207257 CACCTTAGACTACCTCAGCCTGG + Intergenic
994825773 5:104711089-104711111 CTCTGTAGACAGCATCAGCAGGG + Intergenic
997857398 5:137384339-137384361 TACTTTAGACTGGTAGAGCAGGG - Intronic
999986331 5:157008676-157008698 CATTTAAGACTACATCAGCATGG + Intergenic
1003241131 6:4346741-4346763 CAGTGCAGACTGCTTCACCAAGG - Intergenic
1008801739 6:55377036-55377058 CACTCTTGGCTGCTTGAGCAGGG - Intronic
1009620361 6:66067065-66067087 CACTGTAGACTGCTAGAGCGGGG - Intergenic
1009824231 6:68846024-68846046 CATCTGAGACTGCTTCAGCCTGG - Intronic
1011614741 6:89187159-89187181 CATTTTATACTGCCTCAGCCTGG + Intronic
1011735427 6:90305646-90305668 CTCTTTAGTCTCCTTCAGTATGG + Intergenic
1012632783 6:101494323-101494345 CACTCTGGACTGATTCAGAATGG - Intronic
1013899251 6:115133170-115133192 CAATTTGTACTGCTTCACCAAGG + Intergenic
1013937812 6:115619289-115619311 AACTTCAGCCTGCATCAGCAGGG - Intergenic
1014082014 6:117298564-117298586 CATTTTAATCTGCTCCAGCATGG - Intronic
1014382160 6:120755530-120755552 CACTGTAGACTGCTAGAGGAGGG - Intergenic
1014445592 6:121523721-121523743 CAAATTAGGCTTCTTCAGCAAGG - Intergenic
1015399780 6:132776128-132776150 CACTTTAAATTGCTTCACCTGGG - Intronic
1016690984 6:146937409-146937431 CACTTGAGATTTCTTGAGCATGG + Intergenic
1020903244 7:14032044-14032066 CAATGTAGAGTGCTCCAGCAAGG - Intergenic
1021019830 7:15583541-15583563 CATTTTTAACTGCTTCAGCAAGG - Intergenic
1022435499 7:30380344-30380366 CAGTTTAGCCTCCTCCAGCAGGG + Intronic
1024504236 7:50148045-50148067 CACTTTAGACTGCTGCTGATAGG - Intronic
1024765105 7:52648642-52648664 CACTTGAGTCTTCTTCAGCATGG - Intergenic
1026410124 7:70111775-70111797 AACTTTAGACTGCTTAATTATGG + Intronic
1030542702 7:110852163-110852185 CAATTTAGACTGCCACAGGATGG + Intronic
1033067334 7:138168603-138168625 TACTTTAAAATGCTTCAGCATGG - Intergenic
1034424167 7:151005647-151005669 CACTTTTAAATGCTTCAGCTGGG - Intronic
1035336162 7:158128297-158128319 CAATTTGTACTGCTTGAGCAAGG - Intronic
1035458092 7:159022703-159022725 CACTGCAGACTGCGTCATCAGGG + Intergenic
1037050528 8:14367238-14367260 CACTTGAGACTACCTCAGCCTGG + Intronic
1037512101 8:19593923-19593945 CCCTCTAGGCTGCTTCAGGATGG + Intronic
1043133989 8:76498570-76498592 CACTTTAGACTACTTGAGGGTGG + Intergenic
1045402796 8:101835389-101835411 CATTTTAGACTGTTACAACAGGG + Intronic
1047524816 8:125623749-125623771 CACTATGGAGTTCTTCAGCAAGG - Intergenic
1047664613 8:127077038-127077060 CACTTTAGCCACCTTCACCATGG + Intergenic
1048065801 8:130967234-130967256 CACTTCAGACTGATTCAGCAAGG + Intronic
1048136020 8:131747120-131747142 CACTGGGGACTGCTTGAGCAGGG + Intergenic
1051770876 9:20577985-20578007 CACTTTAGCCAGTTTTAGCAGGG - Intronic
1052265072 9:26562676-26562698 TCCTTCAGACTGTTTCAGCAGGG + Intergenic
1052374610 9:27704661-27704683 CACATTAAACAGCTTGAGCAAGG + Intergenic
1054919873 9:70531662-70531684 TACTGTACACTGCTTCTGCATGG + Exonic
1056325923 9:85479083-85479105 CACTTTAGAGGGATTCAGGAAGG - Intergenic
1056511574 9:87310941-87310963 CTCTTTTCCCTGCTTCAGCAAGG - Intergenic
1060654664 9:125361874-125361896 CACTTTAGACAGCAACAGCTGGG - Intronic
1203620451 Un_KI270749v1:122733-122755 CATTTTAGTCAGCTTCTGCAGGG - Intergenic
1186907240 X:14124639-14124661 CACTTTTGACTCCTTGGGCATGG + Intergenic
1186946199 X:14570513-14570535 AAGTGCAGACTGCTTCAGCAGGG + Intronic
1193236788 X:79116549-79116571 CATCTGAGACTGCTTCAGCCTGG + Intergenic
1195425410 X:104723823-104723845 CTCTTTTGACTGCTTCTGCCAGG - Intronic
1195862367 X:109395725-109395747 CACTTTATTCTGCTTCTGCTAGG + Intronic
1196660109 X:118260472-118260494 CACTTTAAACTCCTCCATCAGGG + Intergenic
1199277542 X:145964097-145964119 CACTTTAGTCTGCAGTAGCAAGG - Intergenic