ID: 1101432148

View in Genome Browser
Species Human (GRCh38)
Location 12:104635419-104635441
Sequence CGGCAATTACATCTTCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101432148_1101432157 16 Left 1101432148 12:104635419-104635441 CCCTTAAGAAGATGTAATTGCCG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1101432157 12:104635458-104635480 TCATCTCATCACAGGGGGGTTGG 0: 1
1: 0
2: 0
3: 17
4: 170
1101432148_1101432153 9 Left 1101432148 12:104635419-104635441 CCCTTAAGAAGATGTAATTGCCG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1101432153 12:104635451-104635473 CAAGCAGTCATCTCATCACAGGG 0: 1
1: 0
2: 2
3: 15
4: 180
1101432148_1101432156 12 Left 1101432148 12:104635419-104635441 CCCTTAAGAAGATGTAATTGCCG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1101432156 12:104635454-104635476 GCAGTCATCTCATCACAGGGGGG 0: 1
1: 0
2: 2
3: 51
4: 482
1101432148_1101432154 10 Left 1101432148 12:104635419-104635441 CCCTTAAGAAGATGTAATTGCCG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1101432154 12:104635452-104635474 AAGCAGTCATCTCATCACAGGGG 0: 1
1: 0
2: 1
3: 16
4: 158
1101432148_1101432159 30 Left 1101432148 12:104635419-104635441 CCCTTAAGAAGATGTAATTGCCG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1101432159 12:104635472-104635494 GGGGGTTGGAAGGAGAATTCAGG 0: 1
1: 0
2: 1
3: 21
4: 300
1101432148_1101432158 20 Left 1101432148 12:104635419-104635441 CCCTTAAGAAGATGTAATTGCCG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1101432158 12:104635462-104635484 CTCATCACAGGGGGGTTGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 198
1101432148_1101432155 11 Left 1101432148 12:104635419-104635441 CCCTTAAGAAGATGTAATTGCCG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1101432155 12:104635453-104635475 AGCAGTCATCTCATCACAGGGGG 0: 1
1: 0
2: 1
3: 10
4: 141
1101432148_1101432152 8 Left 1101432148 12:104635419-104635441 CCCTTAAGAAGATGTAATTGCCG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 1101432152 12:104635450-104635472 ACAAGCAGTCATCTCATCACAGG 0: 1
1: 0
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101432148 Original CRISPR CGGCAATTACATCTTCTTAA GGG (reversed) Intronic
900493130 1:2962785-2962807 AGGCAATTACATCGTGTAAATGG + Intergenic
906999829 1:50840296-50840318 CGGCCATTTCATTTTCTTAGTGG - Intronic
907566316 1:55437608-55437630 AGGCTACTACATCTTCTTACAGG + Intergenic
913397219 1:118385279-118385301 AGGCAATTAAGTCTTCTTACAGG + Intergenic
916059900 1:161091333-161091355 CGGCAGTGACCTCTTCTTCAGGG + Intergenic
920904667 1:210150945-210150967 TGGCCATTACATTTACTTAATGG - Intronic
921844276 1:219862391-219862413 CTGAAATTTCATCTTCTTTATGG - Intronic
1063338566 10:5241207-5241229 CGGCCACTACATCATCTTCAAGG - Intergenic
1064466484 10:15587481-15587503 CAGCAATTTCATCTTCCTAACGG + Intronic
1068270079 10:54711090-54711112 TGGTAATTACATCTGCTAAAAGG + Intronic
1069256117 10:66333967-66333989 CGGCCATTACATAATGTTAAAGG - Intronic
1071887824 10:89969940-89969962 GGACAATTTCATCTACTTAAAGG - Intergenic
1075961467 10:126571037-126571059 CGGCAAGCACATCTATTTAATGG - Intronic
1081756599 11:45549259-45549281 TGGCATTAAAATCTTCTTAATGG - Intergenic
1085853557 11:80150233-80150255 AGCCAATTTAATCTTCTTAAAGG + Intergenic
1086925550 11:92636446-92636468 TTTCAGTTACATCTTCTTAAAGG + Intronic
1088509883 11:110563567-110563589 GGCCTATTTCATCTTCTTAATGG + Intergenic
1088979796 11:114851906-114851928 CAACAATTCCATGTTCTTAAAGG - Intergenic
1091799414 12:3315519-3315541 CGACAATGACATCTTGTTACAGG - Intergenic
1094214696 12:27928532-27928554 CTGCAATTCCATCTCCTGAAGGG + Intergenic
1094411528 12:30172270-30172292 AGGCTATTGCATCTTCTTCAAGG - Intergenic
1096186222 12:49582954-49582976 TAACAATTTCATCTTCTTAAAGG - Intronic
1097525264 12:60726536-60726558 TGGCAGTTACATGTTTTTAATGG - Intergenic
1098709683 12:73739669-73739691 CTTAAATAACATCTTCTTAAAGG + Intergenic
1100772172 12:97935475-97935497 AGGCAATAATATCTTCTGAAAGG + Intergenic
1101428279 12:104605680-104605702 CGGCAATTACATTTTATTTTGGG - Intronic
1101432148 12:104635419-104635441 CGGCAATTACATCTTCTTAAGGG - Intronic
1105739573 13:23309446-23309468 CGGCACTATCATCATCTTAATGG - Intronic
1106596947 13:31151434-31151456 AGACAATTACATCATCTTTATGG + Intronic
1107440441 13:40422542-40422564 GTACAATTACATCTTCTCAAGGG + Intergenic
1109044458 13:57391350-57391372 TGGCATTTCCATCTTCTTCATGG + Intergenic
1110463842 13:75778556-75778578 CGGTGCTTACATCTGCTTAAGGG - Intronic
1111491157 13:88976992-88977014 TGGCAAATAAATCTTCTAAAAGG + Intergenic
1113080452 13:106514392-106514414 AGACAATTTCATCTTCTTTATGG + Intronic
1130871576 15:87976215-87976237 CGGCATTTATCTCTTCTTGAGGG - Intronic
1135053230 16:19209254-19209276 CAGCAATTACATGTTTTTATGGG - Intronic
1137547196 16:49412403-49412425 TTGCAATTACATATTTTTAAAGG - Intergenic
1144679283 17:17182178-17182200 CTGCATTTCCATCTTCTTGAAGG - Intronic
1151158077 17:72141008-72141030 CGGAACTGACATCTTCTTAGAGG + Intergenic
1153052529 18:913539-913561 CTCAAATTACATCTTTTTAAAGG + Intergenic
1156304952 18:35869359-35869381 TGGTTATTACATCTTCTTATTGG + Intergenic
926641895 2:15245886-15245908 TGGCTTTTACATCTTTTTAAAGG - Intronic
927913980 2:26922396-26922418 TGTCAAATACATCTTCATAAAGG - Intronic
930478876 2:51921831-51921853 TGGCTATTACATCTCCTTATGGG + Intergenic
931563727 2:63591365-63591387 AGGTAATTCCATCTTATTAATGG - Intronic
936906418 2:117540529-117540551 CTACAATTACATTTTCTTGAAGG - Intergenic
937635566 2:124151925-124151947 AGGAAATTACAACTTCTTAAGGG + Intronic
939467340 2:142575706-142575728 CAGCAATTATATTTTCTTGAGGG + Intergenic
939621807 2:144429565-144429587 CGGCAGTTACATCTTAGGAAGGG - Intronic
940395236 2:153182342-153182364 CTGCAGTTTCATTTTCTTAACGG + Intergenic
940474187 2:154139899-154139921 CTGCCATTACATCTTTATAAAGG - Intronic
1169701215 20:8448867-8448889 AGGAAATTACATCTCCTGAAAGG + Intronic
1170849344 20:19990222-19990244 CGGCGAATACATCTTCTGCATGG - Exonic
1174874963 20:54217361-54217383 CAGCAAATACATCTTCTTGCAGG - Intronic
1174943905 20:54963689-54963711 CGGAAATGTCATCTGCTTAATGG + Intergenic
1177080865 21:16636982-16637004 CTGCCATTATATCTTCTTCAGGG + Intergenic
1179149319 21:38796503-38796525 GGTCAATTACATGTTCATAATGG - Intergenic
1183652667 22:39167431-39167453 CGTCAATTTCATCTTCCTGAAGG - Intergenic
950344507 3:12280215-12280237 GGGCATTTACATCTTAGTAAGGG + Intergenic
956401207 3:68882007-68882029 CGTCAAATAGATCTTGTTAAAGG + Intronic
960354884 3:116639149-116639171 TGCCTATTACATTTTCTTAAAGG - Intronic
965752552 3:171991025-171991047 AGCCAATGACATATTCTTAAAGG + Intergenic
969518903 4:7664450-7664472 GGACGATTACATCTTCTTTAAGG + Exonic
971171978 4:24242809-24242831 CAGCAATTCCATCTTCCTGACGG + Intergenic
971506036 4:27367532-27367554 CTGCCATTACATCTCCTTCATGG + Intergenic
971679754 4:29681818-29681840 CCCAAATTACATCTTCATAAAGG + Intergenic
974910343 4:68110159-68110181 GGTTAATAACATCTTCTTAATGG + Intronic
975758714 4:77596977-77596999 CAGCATTTTCATCTTTTTAAAGG - Intronic
976166101 4:82256788-82256810 CAGGAATTATATCTTATTAATGG + Intergenic
978247154 4:106587356-106587378 CCGCCATTACATCTTCTACATGG + Intergenic
985347480 4:189021899-189021921 CGGCTATTTCCTCTTCCTAACGG - Intergenic
988200360 5:28061359-28061381 TTGCTATTACATCTTCCTAAGGG - Intergenic
988773992 5:34459946-34459968 GAGCAATGAAATCTTCTTAAGGG - Intergenic
988871101 5:35391097-35391119 TTGCAATTTCATTTTCTTAATGG + Intergenic
993736978 5:91489013-91489035 CTACAATGACATCTTCTCAATGG + Intergenic
998658147 5:144205326-144205348 TGACTATTACATCATCTTAAAGG - Exonic
999942260 5:156556246-156556268 GGGCAATTTAATCTTCCTAATGG - Intronic
1000171384 5:158706214-158706236 TGGCAAATCCATCTTCTTAGAGG - Intronic
1006088075 6:31610914-31610936 CAGCAATTCCATCTTAATAAGGG - Intergenic
1008938661 6:57020717-57020739 CGGCAATTTCCTTTTCTAAATGG + Intronic
1012858716 6:104533423-104533445 CTGCATTTACATCCTCTAAAGGG + Intergenic
1014179212 6:118366320-118366342 CTGCAATACTATCTTCTTAAGGG - Intergenic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1023899283 7:44462852-44462874 AGGCAATTACATTTTAGTAAAGG - Intronic
1032123735 7:129175732-129175754 TGGTAATTACATTTTCATAAAGG - Intergenic
1032554472 7:132817272-132817294 CAACAATTACATTTGCTTAAAGG + Intronic
1035107696 7:156455964-156455986 CGGCAAATCCATCTTTTTAATGG + Intergenic
1035133073 7:156674078-156674100 CAGCAGTTACATCTGCTTCATGG - Intronic
1036681304 8:10876405-10876427 CAACAATTACATCAGCTTAATGG - Intergenic
1038883754 8:31640590-31640612 CAGCAGGTACATCTTCTTCATGG + Intronic
1039264686 8:35811479-35811501 AGGCATTTACATCATGTTAAAGG + Intergenic
1050777866 9:9289784-9289806 CAGGATTTACTTCTTCTTAAAGG + Intronic
1051662380 9:19437815-19437837 GGGCAATTACATCTGGTTGAGGG - Intronic
1054770386 9:69077924-69077946 CGGGAATTACATTTTTTTAATGG - Intronic
1058699405 9:107588146-107588168 TTGAAATTACATCTTCTTATGGG + Intergenic
1185782509 X:2861710-2861732 AGGTACTTACATCTTCTGAACGG - Exonic
1187466942 X:19536072-19536094 CTGAAATTACATTTTATTAATGG + Exonic
1192659246 X:73024328-73024350 TTACAATTATATCTTCTTAATGG + Intergenic
1199528464 X:148820493-148820515 CGGCAAAGCCATCTTTTTAATGG - Intronic