ID: 1101434770

View in Genome Browser
Species Human (GRCh38)
Location 12:104655214-104655236
Sequence GACTTCGCAGAGCCTAGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101434768_1101434770 2 Left 1101434768 12:104655189-104655211 CCTTGCTTTTGGTGGAAGGGTGA 0: 1
1: 0
2: 2
3: 22
4: 304
Right 1101434770 12:104655214-104655236 GACTTCGCAGAGCCTAGAGCGGG 0: 1
1: 0
2: 0
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101434770 Original CRISPR GACTTCGCAGAGCCTAGAGC GGG Intronic
900960443 1:5915686-5915708 GACTTGCCAGAGCCCTGAGCTGG + Intronic
903974457 1:27140120-27140142 GGCTTCCCAGAGCTTTGAGCTGG - Intronic
907359682 1:53904485-53904507 GACTTAGCAGGGGCTGGAGCTGG - Intronic
908985872 1:70020569-70020591 GACTTCTCAGTGGCTAGTGCAGG - Intronic
913518615 1:119625017-119625039 GAGATTACAGAGCCTAGAGCTGG + Intronic
917124552 1:171675234-171675256 AACTTGGCTGAGCCTAGAACTGG + Intergenic
918869412 1:189949676-189949698 GACTTCCCAGACCCCAGAACTGG - Intergenic
1063618787 10:7625873-7625895 GCCTTTGCAGAACTTAGAGCTGG - Intronic
1065306405 10:24373295-24373317 GACTTCCCAGAGCCAAGAAGAGG - Intronic
1067142001 10:43666161-43666183 GACTCTGCAGAGCCCAGAGGTGG + Intergenic
1075115785 10:119626372-119626394 GGCTTCCCAGAGACAAGAGCTGG + Intergenic
1077013983 11:392009-392031 GACTCCGCCGAGCCTGGAGCTGG + Intergenic
1077917007 11:6617860-6617882 GACTTCCCAAAGCCTGGAACAGG + Intronic
1080532626 11:33191892-33191914 GACTCCGCAGAGGCTGGAGGTGG + Intergenic
1083743682 11:64723668-64723690 GGCTTCGAGGAGCCTAGAGAAGG + Intergenic
1085607423 11:77914556-77914578 GACTGCCCAGAGCTTACAGCAGG + Intronic
1088976707 11:114822400-114822422 GACTCAGCAGAGCCTGGAGCTGG + Intergenic
1090085135 11:123643871-123643893 GACTTCCCAGAGCCTGGCTCAGG - Intronic
1090605343 11:128417259-128417281 GGCTTCACAGAGGCTAGAGCTGG - Intergenic
1091791191 12:3273170-3273192 AAATCCGCAGAGCCTAGAGCAGG - Intronic
1101434770 12:104655214-104655236 GACTTCGCAGAGCCTAGAGCGGG + Intronic
1102886468 12:116525781-116525803 GACTTCGCAGAGCCTTTCCCAGG - Intergenic
1107006665 13:35619985-35620007 GTGTTCCCAGAGCCCAGAGCAGG - Intronic
1107025987 13:35802011-35802033 GACTTCCCAGAGCCCAGAGAAGG - Intronic
1107277275 13:38690702-38690724 GATTTCTCAGAGCCTGGTGCTGG - Exonic
1114444826 14:22780379-22780401 GACTTTTCAGAGCCAAGAGCCGG - Intronic
1115975955 14:38997168-38997190 CATTTTGAAGAGCCTAGAGCAGG + Intergenic
1121000361 14:90447746-90447768 AACATCGCAGAGGCTGGAGCAGG + Intergenic
1123580039 15:21706657-21706679 GACTTCCCAGCCTCTAGAGCTGG + Intergenic
1123616687 15:22149279-22149301 GACTTCCCAGCCTCTAGAGCTGG + Intergenic
1125675891 15:41502434-41502456 GACTACGCGAAGCCGAGAGCAGG + Exonic
1128239157 15:66089198-66089220 GACTTGGCAGAAGCTACAGCTGG + Intronic
1202988909 15_KI270727v1_random:440902-440924 GACTTCCCAGCCTCTAGAGCTGG + Intergenic
1133644111 16:7746999-7747021 GACTGCCCAGAGCCAAGAGCTGG - Intergenic
1136617966 16:31410352-31410374 GGCTGGGCAGAGACTAGAGCGGG - Intronic
1138531422 16:57636376-57636398 GACTTCTCAGAGCCTTTATCGGG + Intronic
1141058681 16:80843302-80843324 GGCTTTGCAGAGTCAAGAGCAGG + Intergenic
1141168687 16:81677544-81677566 GACTTGTCAGAGCCTTGACCTGG - Intronic
1141926134 16:87170884-87170906 GTATCCCCAGAGCCTAGAGCAGG + Intronic
1147217075 17:38906996-38907018 AACTTTGCAGAGCTTGGAGCAGG + Intronic
1148164648 17:45474875-45474897 GACTTAGAACAGCTTAGAGCTGG - Intronic
1148960653 17:51390047-51390069 GACTTCACAGAGCCTTTACCTGG + Intergenic
1149666828 17:58370848-58370870 GTCTTCTCACAGCCCAGAGCTGG + Intronic
1150395867 17:64821542-64821564 GACTTAGAACAGCTTAGAGCTGG - Intergenic
1151642301 17:75405264-75405286 GACTGCCCAGAGCCAAGAGCCGG + Exonic
1151667760 17:75555560-75555582 GACCTGGAAGAGCCCAGAGCAGG + Intronic
1151936769 17:77266667-77266689 GACTTCTCAGAGCCTGTAGGAGG - Intergenic
1152000332 17:77641315-77641337 CAGTGGGCAGAGCCTAGAGCTGG + Intergenic
1152724981 17:81940757-81940779 TCCCTCGCAGAGCCTGGAGCTGG + Exonic
1154110050 18:11559967-11559989 GACTTCCCACAGCCAGGAGCTGG + Intergenic
1155353423 18:24928496-24928518 GTCTTCACAGAGGCTACAGCAGG + Intergenic
1157399760 18:47377622-47377644 GACTCCGCAAAGCCTTAAGCAGG - Intergenic
1157608004 18:48938377-48938399 GACTTCGCACAGCCAAGAGATGG + Intronic
1161596906 19:5155124-5155146 GACCTCACAGGGCCTAGGGCGGG - Intergenic
1165150018 19:33754663-33754685 GACGTGGCAGAGGCTGGAGCGGG - Intronic
1165404854 19:35623236-35623258 GACTCCCCAGCGCCTAGAGGAGG - Exonic
1166142687 19:40813443-40813465 GACTGTGCAGAGCCTAGGACTGG + Intronic
1166184838 19:41133322-41133344 GACTGTGCAGAGCCTAGGACTGG - Intergenic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
931633378 2:64321073-64321095 GACTTCCCAGCCTCTAGAGCTGG + Intergenic
933507951 2:83203117-83203139 GACTTAGTAGTGCATAGAGCAGG - Intergenic
934040724 2:88125757-88125779 GCCTTCACTGAACCTAGAGCTGG - Intronic
935884659 2:107603644-107603666 GACTGCACAGCCCCTAGAGCAGG - Intergenic
939005536 2:136782319-136782341 GAATTAGCAGAGCCCAGAACTGG - Intronic
939620347 2:144411592-144411614 GGCCTCGCAGAGCCTCCAGCTGG + Intronic
942567230 2:177279192-177279214 AGCTTCCCAGAGCATAGAGCAGG + Intronic
944525565 2:200615384-200615406 AACATTGCACAGCCTAGAGCTGG - Intronic
944660216 2:201915610-201915632 GACTCTGCAGAGCATAGAGGTGG + Intergenic
1172123016 20:32609572-32609594 ACCTTCCCAGAGTCTAGAGCAGG + Intergenic
1173039626 20:39450106-39450128 GACATCCCAGAGCACAGAGCAGG + Intergenic
1174133091 20:48359694-48359716 GTCTCAGCAGAGCCCAGAGCTGG + Intergenic
1174579688 20:51562778-51562800 GACTCCGCCGAGCCGGGAGCCGG - Intronic
1174853423 20:54019334-54019356 GACTTCTCAGAGCCTTTAGTAGG + Intronic
1175459998 20:59145410-59145432 GACTTCTCAGAGCCTTTACCTGG + Intergenic
1175992798 20:62797758-62797780 GTCCTCGCAGAGCTTGGAGCTGG + Intronic
1176200303 20:63857370-63857392 GGCTTGGAAGACCCTAGAGCAGG - Intergenic
1177146240 21:17410280-17410302 GAATTTGAACAGCCTAGAGCAGG + Intergenic
1181865015 22:25847855-25847877 GACGTGGCAGAGCCTGGATCAGG + Intronic
949170901 3:995197-995219 GACTTCCCAGGGTCTAGAACTGG + Intergenic
950480077 3:13238590-13238612 CACATTCCAGAGCCTAGAGCAGG + Intergenic
950480555 3:13241121-13241143 GACTTCTCAGAGCCTGCAGTGGG - Intergenic
954397338 3:50299668-50299690 GACTTGTCAGAGCCTGGGGCGGG - Intergenic
954458968 3:50615648-50615670 GACCTTACAGAGCCTAGAGGAGG - Intronic
958673661 3:97237123-97237145 GATTTTGCAGAGCCTAGAAAGGG + Intronic
968966459 4:3771392-3771414 GACTTCTCAACGCCCAGAGCAGG + Intergenic
979018902 4:115469089-115469111 GACTCCGCAGAGTCCAGAGGTGG - Intergenic
981529109 4:145734889-145734911 GACTTCCCGGAGGCTAGAGCAGG + Intronic
984312023 4:178074086-178074108 GACTTCGGAAAGCTTAGTGCTGG + Intergenic
985119720 4:186627903-186627925 GGCTTCTCAGAGCCTTGAACTGG + Intronic
986793924 5:11191090-11191112 CATTTCTCAGGGCCTAGAGCAGG + Intronic
987210355 5:15675691-15675713 GACTGCTCAGAACCTAGAGAAGG - Intronic
998412478 5:141922275-141922297 GTCTTCTCAGATCCTAGAACGGG + Intergenic
1002162603 5:177324578-177324600 GACTCTGCAGAGTCTGGAGCTGG + Intergenic
1002182813 5:177440330-177440352 CACCACGCAGAGCCTGGAGCTGG - Intronic
1003465530 6:6376692-6376714 AACCTCCCAGAGCATAGAGCTGG + Intergenic
1006026208 6:31148683-31148705 GACATCCCAGAGCCAGGAGCAGG - Exonic
1006114085 6:31766092-31766114 GGCTGCCCAGAGCCTAGAGTCGG + Intronic
1013130027 6:107223826-107223848 GAAATCCCAGAGTCTAGAGCAGG + Intronic
1013285208 6:108675343-108675365 GACACCTCAGAGCCTAGACCTGG - Intronic
1015829810 6:137356600-137356622 GATTTGGCAGAGACTAGAGTGGG + Intergenic
1016377052 6:143432154-143432176 AACTTGGTAGAGCATAGAGCTGG + Intronic
1017017775 6:150115835-150115857 GACTTCGCAGCACCTAGCCCAGG + Intergenic
1017616485 6:156251823-156251845 GACTTAGGAGAGCCCAGAGCAGG - Intergenic
1022000810 7:26224459-26224481 GACCTTGCAGAGAGTAGAGCTGG + Intergenic
1027413902 7:77953279-77953301 AACTTCCCAGAGCCTAGCACAGG + Intronic
1029217297 7:98959816-98959838 TACTTAGAAGAGCCTAAAGCAGG + Intronic
1049246568 8:141565895-141565917 GACTTCACAGAGCCTGTACCAGG - Intergenic
1049335223 8:142080721-142080743 GACTTCTCAGAGCCTTGAATCGG - Intergenic
1049454965 8:142682123-142682145 GGCCCCCCAGAGCCTAGAGCTGG - Exonic
1054814545 9:69462602-69462624 GACTTCTCAGAGCCTTGAAGAGG + Intronic
1056808131 9:89744392-89744414 GGATGCCCAGAGCCTAGAGCTGG - Intergenic
1061245941 9:129401390-129401412 GACCTAGCAGGGCCCAGAGCAGG - Intergenic
1061695255 9:132368722-132368744 CCCTGGGCAGAGCCTAGAGCAGG + Intergenic
1188078224 X:25805741-25805763 GACTTCGCAGCACCTAGCCCAGG + Intergenic
1196968851 X:121087002-121087024 GGCTTCCCAGAGCCTAGGCCTGG - Intergenic