ID: 1101434865

View in Genome Browser
Species Human (GRCh38)
Location 12:104655788-104655810
Sequence CTCTGTCACCTATACCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101434865_1101434872 24 Left 1101434865 12:104655788-104655810 CCATTCAGGTATAGGTGACAGAG 0: 1
1: 0
2: 0
3: 6
4: 134
Right 1101434872 12:104655835-104655857 TAGTTGCTTATGTAAATTCAGGG 0: 1
1: 0
2: 2
3: 15
4: 177
1101434865_1101434871 23 Left 1101434865 12:104655788-104655810 CCATTCAGGTATAGGTGACAGAG 0: 1
1: 0
2: 0
3: 6
4: 134
Right 1101434871 12:104655834-104655856 ATAGTTGCTTATGTAAATTCAGG 0: 1
1: 0
2: 3
3: 15
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101434865 Original CRISPR CTCTGTCACCTATACCTGAA TGG (reversed) Intronic
900806058 1:4769131-4769153 CCCTGGCCCCAATACCTGAATGG - Intronic
903522483 1:23961426-23961448 CTTTGTCACCTACAAGTGAATGG - Exonic
906946760 1:50301045-50301067 CTCAGTCACCTATGGCAGAAAGG - Intergenic
908358501 1:63345152-63345174 CTGTCTCATCTATACCTGCAAGG + Intergenic
908631707 1:66116595-66116617 CTCTGTCACCTATGCTGGAGTGG + Intronic
911540713 1:99155019-99155041 CTTTGACACCTATACCTTAGAGG - Intergenic
918579767 1:186112249-186112271 TTCTGTCACTTACAACTGAAAGG - Intronic
922342405 1:224668612-224668634 CTCTGACACCTAGGCCTCAAGGG - Intronic
922882915 1:228996137-228996159 CACTGTCCCCTTTACCTAAATGG - Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1063529521 10:6817893-6817915 CTCTTTCAGCCATACCAGAATGG + Intergenic
1063965860 10:11345161-11345183 CTCTGGCACCTCTACCCCAAAGG - Intergenic
1063979797 10:11444320-11444342 CTCCGTCCCCTACCCCTGAACGG + Intergenic
1065652798 10:27911031-27911053 CTCTGTAACTTGTGCCTGAATGG + Intronic
1066013639 10:31216692-31216714 CTCTGGCACCTTTTCCTAAATGG + Intergenic
1066246221 10:33585672-33585694 CTTTACCACCTATAGCTGAAGGG - Intergenic
1073302931 10:102481884-102481906 GCCTGTCACCAAAACCTGAATGG + Exonic
1077131189 11:973591-973613 CTCTGCCACCTATGACTGAATGG - Intronic
1078160848 11:8838552-8838574 CTCTGTGACCTATGCCAGAGAGG + Intronic
1079114350 11:17631694-17631716 CTCCATCACAGATACCTGAAAGG - Exonic
1083175418 11:60946825-60946847 CACTGTCACCCCTTCCTGAATGG - Intronic
1086284023 11:85224430-85224452 CTCAGTCCCCTACACCTCAATGG - Intronic
1086930724 11:92690007-92690029 ATCTGTCAACTAGGCCTGAAGGG + Intronic
1092863034 12:12735910-12735932 CTCTGTCACCCAGGCCTGAGTGG - Intronic
1093710772 12:22327617-22327639 CTCTGTGCCCTATACTTTAAGGG - Intronic
1096742893 12:53707171-53707193 CTCTGTCACCCAAAGCTGTAGGG + Intergenic
1099207858 12:79748649-79748671 CTCTGTCACCTAGGCTGGAATGG - Intergenic
1101434865 12:104655788-104655810 CTCTGTCACCTATACCTGAATGG - Intronic
1101645090 12:106624178-106624200 CTCTATCATTTATAGCTGAAAGG + Intronic
1102950771 12:117029637-117029659 CTCTGTCACCTAGACTAGACTGG + Intronic
1102969020 12:117151333-117151355 CTCTCTCACCTAAACCCTAATGG - Intronic
1104425803 12:128677308-128677330 CTGTGTCCCCCATACCAGAATGG - Intronic
1106111286 13:26779731-26779753 GTGTGTCAGTTATACCTGAAAGG + Intergenic
1109365493 13:61350792-61350814 CTCAATTACCTCTACCTGAATGG - Intergenic
1111434222 13:88185276-88185298 CTCTCCCACCTAAACCTGATGGG - Intergenic
1111479028 13:88797474-88797496 CTCTGTCACCAATACCAGAGAGG - Intergenic
1111698465 13:91656301-91656323 GACTGTCACCTAAAGCTGAATGG + Intronic
1112057941 13:95707919-95707941 TTCGCTCACCTATACATGAAAGG - Intronic
1118302848 14:64630664-64630686 GCCTGACACCTATCCCTGAAGGG + Intergenic
1118735820 14:68701285-68701307 CCCTGTCACCTCTGCCTGGAAGG + Intronic
1119533699 14:75382181-75382203 CTCTGGCACCTACATCTGAAGGG + Intergenic
1126928474 15:53619316-53619338 CACTGTCACATATATCTCAAAGG - Intronic
1127853292 15:62934180-62934202 CTCTCTGAACTATTCCTGAAAGG + Intergenic
1129949039 15:79570071-79570093 CTCTGTAACAGATACCTGAAAGG + Intergenic
1133247434 16:4458612-4458634 CTCTGTCACCTAGACTGGAGTGG - Intergenic
1134561564 16:15214765-15214787 TTCTGTCAACCACACCTGAAAGG + Intergenic
1134922101 16:18126391-18126413 TTCTGTCAACCACACCTGAAAGG + Intergenic
1135640181 16:24112965-24112987 CTCAGTAACTTAAACCTGAAGGG - Exonic
1136006856 16:27336718-27336740 CTCTGTCCCCTCCACCTGGAGGG - Intronic
1140159300 16:72470151-72470173 ATTTGTCACGCATACCTGAAAGG - Intergenic
1140319010 16:73929653-73929675 CTCTGTCTTCTATTCCAGAAAGG - Intergenic
1142239746 16:88939841-88939863 CTGTGTCCCCCAGACCTGAAGGG - Exonic
1143177292 17:4963310-4963332 CTCTGTCACCTAGACCTCTCAGG - Intronic
1143796654 17:9342413-9342435 CTCTGTCACCATTCTCTGAAGGG - Intronic
1146061724 17:29611424-29611446 CTCAGGCACCTTCACCTGAAGGG - Intronic
1146510225 17:33441001-33441023 CTCTGTCACCCAGACTGGAATGG + Intronic
1149527649 17:57369230-57369252 CCCTGTCAGCTATGCCAGAATGG + Intronic
1155327420 18:24678959-24678981 CTCTGTCTCCTCTACCTGCCAGG + Intergenic
1155755598 18:29491112-29491134 TTCTCTCACCAAAACCTGAAAGG - Intergenic
1156049119 18:32910460-32910482 CTCTGTTTCCTCTACATGAAGGG - Intergenic
1156588289 18:38457225-38457247 CTGTGTGACTTATACTTGAAAGG - Intergenic
1157109970 18:44811545-44811567 CTCTGTAACCTGTACCTGCGTGG + Intronic
1158243890 18:55408717-55408739 CTCTGTCACTTGTACCTGTGTGG - Intronic
1164445819 19:28316744-28316766 CTCTGCCACCTCTGCCTGACAGG - Intergenic
1165950326 19:39470637-39470659 CTCTGTCACTTACATCTGAATGG + Intronic
1166006997 19:39914914-39914936 CTCTGTCACCCAGGCCAGAATGG + Intronic
1166150082 19:40866551-40866573 CTCTCTCACATATATATGAATGG + Intronic
1168669786 19:58231875-58231897 CTCTGTCACCTAGGCTGGAATGG + Intronic
926306201 2:11638994-11639016 CTCTTTCCCCTATACCTGTTTGG + Intronic
929189964 2:39130713-39130735 CACTGTCACCTATACCTTGCCGG - Intergenic
929806067 2:45145792-45145814 CCCTGCCACCTACACCAGAACGG + Intergenic
930464245 2:51725235-51725257 CTCTTTCATCCATCCCTGAAAGG - Intergenic
932462287 2:71890613-71890635 CTCTGGGACCTACACCAGAAGGG + Intergenic
935742379 2:106161041-106161063 CTCTGTCACCCATTACTGCAAGG - Intronic
937064357 2:119006051-119006073 CTCTGTCACCTGCACAAGAAAGG + Intergenic
939612558 2:144328573-144328595 CTCTGTCACCTACAACGGGAAGG - Intronic
942345814 2:175001747-175001769 CTCTGTCATTTATAGCTTAATGG - Intronic
943922607 2:193728915-193728937 CTCTGTCCCCTGTACATGCAGGG + Intergenic
944712290 2:202345321-202345343 CTCTGTCACCCAGGCCAGAATGG + Intergenic
944920711 2:204410213-204410235 CTCTGTGTCCTATACCTTTAGGG + Intergenic
948987989 2:241537248-241537270 CTCTGTCACCTAGGCCGGAGTGG + Intergenic
1171943249 20:31351322-31351344 CTCTGTCACTTATTAATGAAGGG + Intergenic
1178328210 21:31662545-31662567 ACCTGTCACCATTACCTGAATGG + Intronic
1178950130 21:36979236-36979258 CTCTGTCACCCAGGCCTGGAGGG - Intronic
1179768809 21:43597279-43597301 CTCTGTTATCTTTTCCTGAAGGG - Intronic
1180257695 21:46644111-46644133 CTCTGGAACATCTACCTGAAAGG - Intronic
1181709618 22:24674271-24674293 CTCTGTAATCTCTACCTGGAGGG + Intergenic
1182888188 22:33793982-33794004 CTCTGTCTCCTACAACTGCAGGG + Intronic
1184616560 22:45641839-45641861 CTCTTCCCCCTATACCAGAAAGG + Intergenic
950195475 3:11006355-11006377 CACTGTCACCTATGCAAGAACGG - Intronic
950440234 3:13006227-13006249 CTCTGCCACCTTCTCCTGAAAGG - Intronic
950517490 3:13476780-13476802 CTCTCACCCCTAAACCTGAAGGG - Intergenic
950967266 3:17154977-17154999 CTCTGTTAGCTATCACTGAATGG + Intergenic
951497619 3:23348624-23348646 CTCAGTCCCCCATACCTAAATGG - Intronic
954738601 3:52728298-52728320 CTCTGTAACCTCTACCTCTAAGG - Intronic
962541219 3:136384372-136384394 CTCTGTAACCTACACCTCCAAGG - Intronic
963842773 3:150124538-150124560 CTCTTTCAACTATAATTGAAAGG + Intergenic
964896377 3:161601587-161601609 ATTTGTCAATTATACCTGAATGG - Intergenic
966141049 3:176756359-176756381 CTCTGAAACTTCTACCTGAAAGG + Intergenic
966395199 3:179495019-179495041 CTCTTTGAGTTATACCTGAATGG - Intergenic
967776485 3:193391427-193391449 CCCTGTCACCCATACCTGCACGG + Intergenic
971503923 4:27346063-27346085 TTCTCTCACCGATACATGAAAGG - Intergenic
971637893 4:29087004-29087026 CTCTGTCACCTAGGCTGGAATGG + Intergenic
972557058 4:40192701-40192723 CTTTTTCACCTTGACCTGAAGGG + Intronic
975032797 4:69643056-69643078 CTAAGTCACCTCTAACTGAAAGG - Intronic
976801786 4:89000777-89000799 ATCTGTCATCTTTATCTGAAAGG - Intronic
980819321 4:137993380-137993402 CTGTGACACATATCCCTGAAGGG + Intergenic
981113469 4:140961396-140961418 CTCTCTTTCATATACCTGAATGG + Intronic
982422542 4:155214257-155214279 CACTCTTACCTATACCTTAATGG + Exonic
983227643 4:165099913-165099935 CTCTGTCACCCAAGACTGAAAGG - Intronic
984598124 4:181694906-181694928 CTCTGTCACCTTAACTTCAAAGG + Intergenic
985533557 5:448302-448324 CCCTGTAACCTGTCCCTGAACGG + Intronic
986003623 5:3649601-3649623 CACTGTGACCCATACCTGGAGGG + Intergenic
990441887 5:55854820-55854842 ATCTGTCTCATTTACCTGAAGGG + Intronic
997733515 5:136197308-136197330 CTTTGTCTCCTATCCCAGAAAGG + Intergenic
1012879531 6:104769331-104769353 CTTTGTCATATATATCTGAAAGG + Intronic
1014113235 6:117644796-117644818 CTCAGGCACCTGTACCTGGATGG + Intergenic
1020823044 7:12994406-12994428 TTCTGTCACCTACATCTGTAAGG - Intergenic
1022922793 7:35033388-35033410 CTCTGTCACCCCTACCTTCATGG - Intronic
1025923818 7:65940057-65940079 CTCTGTCACCCAGGCCGGAATGG + Intronic
1026262572 7:68768133-68768155 CTCTGTCACCCATGCTGGAATGG + Intergenic
1028866162 7:95716141-95716163 GTATGTCACTTATACCTCAATGG + Intergenic
1040581552 8:48702671-48702693 TTCAGTTACCTATACCTGCAGGG + Intergenic
1048185441 8:132236084-132236106 CACAGTCACCTATACCAGCATGG + Intronic
1051030451 9:12668770-12668792 TTCTTTCAACTATACCTTAAAGG - Intergenic
1051876646 9:21801322-21801344 CCCTGTCTCCTATTCCTCAAAGG + Intergenic
1055323200 9:75102001-75102023 CTCTGTCACCTAGGCTGGAAGGG + Intronic
1056459309 9:86793940-86793962 CTCTTTCATCTCTTCCTGAAGGG + Intergenic
1056632219 9:88303325-88303347 CTGTGTCTCTTTTACCTGAATGG - Intergenic
1057304398 9:93903955-93903977 TTCTGTCCCCTCTCCCTGAAAGG + Intergenic
1058175786 9:101735824-101735846 TTCTGTCACCTGAATCTGAATGG - Intronic
1058765089 9:108174750-108174772 CTATTCCACATATACCTGAAGGG - Intergenic
1060248926 9:121970424-121970446 CTGTGCCACCTAAACATGAAGGG - Intronic
1061182064 9:129030202-129030224 TTCTGTCACCTATCCCAGCATGG + Intergenic
1192916320 X:75655019-75655041 ATCTGTCATCTATCCCTGATTGG + Intergenic
1196218955 X:113088663-113088685 CTCTGCCACCTCCACCAGAAAGG + Intergenic
1201068114 Y:10118720-10118742 CTCTGTCACCTAGACTGGAGTGG - Intergenic
1201105336 Y:10759247-10759269 CTCTGTCACTTAGACTTGAGTGG + Intergenic
1201119573 Y:10862636-10862658 CTCTGTCACCAAGACTGGAATGG + Intergenic
1202341895 Y:23878435-23878457 CTTTGTCACCCATACTGGAAGGG + Intergenic
1202528872 Y:25791651-25791673 CTTTGTCACCCATACTGGAAGGG - Intergenic