ID: 1101436674

View in Genome Browser
Species Human (GRCh38)
Location 12:104670143-104670165
Sequence CCTCACAGGGAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 772
Summary {0: 1, 1: 1, 2: 8, 3: 75, 4: 687}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101436664_1101436674 0 Left 1101436664 12:104670120-104670142 CCGCCTGCTGCAGGGCCTGCTGG 0: 3
1: 0
2: 9
3: 79
4: 673
Right 1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG 0: 1
1: 1
2: 8
3: 75
4: 687
1101436663_1101436674 5 Left 1101436663 12:104670115-104670137 CCACACCGCCTGCTGCAGGGCCT 0: 1
1: 0
2: 8
3: 55
4: 478
Right 1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG 0: 1
1: 1
2: 8
3: 75
4: 687
1101436666_1101436674 -3 Left 1101436666 12:104670123-104670145 CCTGCTGCAGGGCCTGCTGGCCT 0: 1
1: 0
2: 5
3: 69
4: 530
Right 1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG 0: 1
1: 1
2: 8
3: 75
4: 687

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101436674 Original CRISPR CCTCACAGGGAGAGGGAGGA AGG Intronic
900745455 1:4357616-4357638 CCTCGCAGGGAGTGTGATGAGGG - Intergenic
900816258 1:4848660-4848682 CTTCACAGGGAGAGGGGAGATGG + Intergenic
901643816 1:10706171-10706193 CCGTGCAGGGAGAGGGACGATGG + Intronic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902153783 1:14466487-14466509 CCTCTCAGGGAGTGGGGTGAGGG + Intergenic
903480866 1:23652401-23652423 ACAGAGAGGGAGAGGGAGGAGGG + Intergenic
903916880 1:26771310-26771332 CCTTACCAGGAGAGGGAGGCTGG - Exonic
904044061 1:27599868-27599890 TCTCACAGGAGGAGGGAGAATGG - Intronic
904329305 1:29747519-29747541 CAGCTCAGGGAGAGGTAGGAGGG - Intergenic
904359702 1:29963426-29963448 CCTCCCTGGGAGTGGCAGGAGGG - Intergenic
904772582 1:32888648-32888670 CTTTCCTGGGAGAGGGAGGAAGG - Intronic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
905082880 1:35340353-35340375 CGTCAGAGGGAGAGGCAGGATGG + Intronic
905872902 1:41415257-41415279 TCTCACAGGGAGAAGCAGGAAGG - Intergenic
906363179 1:45181466-45181488 CCTGAAAGGGACAGGGAGAATGG + Intronic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
906646769 1:47480919-47480941 CATCCCAGGGAGAGAGAGGCTGG - Intergenic
906767826 1:48451612-48451634 CGATACAGGGAGAGGCAGGAAGG + Intronic
907329263 1:53660640-53660662 CCTGACTGGGGCAGGGAGGAGGG + Intronic
908038716 1:60084348-60084370 ACTGACAGAGAGAGGGAGGGAGG - Intergenic
908150651 1:61298077-61298099 CCCCACATGTCGAGGGAGGAGGG + Intronic
908474219 1:64471771-64471793 CCTCCTCGGGAGAGGAAGGAGGG + Intronic
909183701 1:72457813-72457835 CATCAGAGAGAGAGAGAGGAAGG - Intergenic
910630663 1:89350312-89350334 GCTGACAGGGGCAGGGAGGAAGG - Intergenic
911260588 1:95680645-95680667 CCGAAAGGGGAGAGGGAGGAAGG - Intergenic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
912649014 1:111421782-111421804 CCCCACAGGCAGAAGGAGCAGGG - Intronic
912953376 1:114135800-114135822 CCACCCAGGGAGAGGGGTGAGGG - Intronic
913319701 1:117579531-117579553 CCTCAGAGGCAGAGTAAGGAAGG - Intergenic
916548376 1:165827799-165827821 TCGCACAGGCAGCGGGAGGAGGG + Exonic
916747444 1:167695247-167695269 TCTCACAGGGTGAGGCAGGGAGG + Intronic
917928759 1:179809608-179809630 CAGCACAGGGGCAGGGAGGAGGG + Intronic
918240776 1:182618212-182618234 GCTTTCAGGGAGATGGAGGAGGG + Intergenic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
919853252 1:201688188-201688210 GCACACAGGGAGAGCCAGGAAGG - Intronic
920162907 1:204013326-204013348 ACTCACAGCGAGAGTGAGGCAGG + Intergenic
920175988 1:204102299-204102321 CCCCAGAGGGAGAGGAAGGTGGG - Intronic
920300023 1:204982901-204982923 CCTAACAGTGAGATGGAGGAAGG + Intronic
920530025 1:206695070-206695092 GCTCACAGAGAGGAGGAGGAAGG + Intronic
920686092 1:208110079-208110101 CCTCACAGGGAGAGAAATGTGGG + Intronic
921233023 1:213092832-213092854 CCTCTGAGGGAGTGGTAGGAGGG + Intronic
921891069 1:220353855-220353877 CCTCACAGGGCGTGCGATGAGGG - Intergenic
922317725 1:224457260-224457282 ACACACAGAGAGAGAGAGGAGGG - Intronic
922804058 1:228376779-228376801 CCTCAGAGGCTGTGGGAGGAGGG - Exonic
923195357 1:231661350-231661372 CCTGAAAGGGACAGGGAGAATGG - Intronic
923451455 1:234121711-234121733 CCTGTCAGGGGGTGGGAGGATGG - Intronic
1063067412 10:2623750-2623772 CATGACAGGGAGAGGGAAGCAGG + Intergenic
1063139080 10:3240721-3240743 CCTCCCAGGATGAGGGAGGCAGG - Intergenic
1063331601 10:5165171-5165193 ACCCAAATGGAGAGGGAGGAGGG - Intergenic
1064316398 10:14261762-14261784 CCTGAGAGGGAGAGACAGGAGGG + Intronic
1064414451 10:15136406-15136428 ACAGAGAGGGAGAGGGAGGAAGG + Intronic
1065005174 10:21373137-21373159 AATCTCAGAGAGAGGGAGGAGGG - Intergenic
1065607427 10:27432640-27432662 ACTCACATGGAGAGGGAGGGAGG - Intergenic
1066120650 10:32283222-32283244 CTTCACATTGAGGGGGAGGAGGG - Intronic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066435266 10:35391803-35391825 GATAACAGGAAGAGGGAGGAGGG - Intronic
1066499300 10:35974483-35974505 TCTCACAGGGAGGAAGAGGAAGG - Intergenic
1069360308 10:67633862-67633884 CCTGAAAGAGACAGGGAGGATGG + Intronic
1070737239 10:78871637-78871659 GCTCTCAGAGAGAGGGAGAAAGG - Intergenic
1070798036 10:79228542-79228564 GCACACAGGGGCAGGGAGGAAGG + Intronic
1070831060 10:79418399-79418421 CCTGGCAGGCAGAGGGAGCATGG - Intronic
1071175638 10:82923783-82923805 ACACACAGGTAGAAGGAGGAGGG - Intronic
1071406354 10:85337032-85337054 CCTCACAGAGGGAGGGAAGAAGG + Intergenic
1071554537 10:86592273-86592295 CTTCACAGAGAGTGGGAGCAGGG + Intergenic
1071574458 10:86715486-86715508 GCTCTCAGGGAGCTGGAGGAGGG + Intronic
1071838713 10:89446139-89446161 CCTCAAAGTGACAGGGAGAATGG + Intronic
1071847459 10:89535468-89535490 CGTGTCAGGGAGAGGGAAGAGGG + Exonic
1073096800 10:100984821-100984843 CCACACAGGAAGGGAGAGGAGGG - Exonic
1073150585 10:101308766-101308788 TCTCCCAGGGAGATGGGGGATGG - Intergenic
1073176369 10:101559964-101559986 GCTCAGAGGAAGGGGGAGGAAGG - Intergenic
1073468265 10:103707089-103707111 CCTGTCAGGGAGAGGGGTGAAGG - Intronic
1073733201 10:106315641-106315663 CTTCCCAGGGAGAGGGAGGACGG + Intergenic
1075455686 10:122583383-122583405 GGTCACAAGGTGAGGGAGGAAGG + Intronic
1075457809 10:122596086-122596108 GGTCACAAGGTGAGGGAGGAAGG + Intronic
1075576106 10:123578697-123578719 CCTCAGAAGGGTAGGGAGGAGGG - Intergenic
1075745120 10:124721753-124721775 GTTCACAGGGAGAGTGAGTAAGG - Intronic
1075778915 10:125004707-125004729 CCTCAGAGGGAGGGAGGGGATGG - Intronic
1075904061 10:126065292-126065314 CCTCAGAGGAAGAAGAAGGAGGG + Intronic
1076006142 10:126949246-126949268 CCCCACAGGGAGAGGGCTGCAGG - Intronic
1076167448 10:128293906-128293928 CCTCACAGGGAGGCGGAAGTGGG - Intergenic
1076613672 10:131742817-131742839 CCTCACAGGGAAAGCCAGGTGGG - Intergenic
1076667743 10:132102656-132102678 CCTCACAGAGGGAGGGTGAAAGG - Intergenic
1076676140 10:132148697-132148719 CTGCACAGGAGGAGGGAGGAGGG + Intronic
1076997561 11:306161-306183 CCTCGAAGGGACAGGGAGGTTGG - Intergenic
1077058224 11:606249-606271 CCTCCCAGAGGGAGGGAGGGAGG - Intronic
1077238913 11:1500562-1500584 CCTCTGAGGCAGTGGGAGGATGG - Intronic
1077404225 11:2375716-2375738 ACTCTCAGGAAGTGGGAGGAGGG - Intergenic
1077522784 11:3046200-3046222 CCACACTGTGAGAGGAAGGAAGG - Intronic
1077530954 11:3094511-3094533 CCCCACAGGGAGAGGCTGGTGGG + Intronic
1078322188 11:10346304-10346326 CCAGACAGGGAGAGGGAGAAGGG - Intronic
1078757769 11:14227505-14227527 CCTGACAGAGAGCAGGAGGAGGG - Intronic
1079446544 11:20561894-20561916 ACTCAAAGGGTGAGGGTGGAAGG + Intergenic
1081166207 11:39811502-39811524 CCTGAAAGTGAGAGGGAGAATGG + Intergenic
1081254838 11:40879595-40879617 ACTCACAGATAAAGGGAGGATGG + Intronic
1081695367 11:45105736-45105758 GCCCCCAGGGAGAGGGAGGTGGG - Intronic
1081752150 11:45518828-45518850 CCTAGCAGGGAGGGGCAGGAAGG - Intergenic
1082873301 11:57963381-57963403 ATTCACAGGGAGAGAGAGGAAGG - Intergenic
1083649404 11:64192668-64192690 CCTCACAGGAAGAAGGTGGGCGG - Intronic
1083798449 11:65032297-65032319 TCGCCCAGGGACAGGGAGGAAGG - Intronic
1084540376 11:69782607-69782629 CCATCCAGGGAGAGGGAGGGGGG - Intergenic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1085018092 11:73188455-73188477 CCCAACAGGGATAGGGAGGGGGG - Intergenic
1085450098 11:76626685-76626707 CCCCACAGGGAGAGGGATTAAGG + Intergenic
1085458798 11:76680895-76680917 CCCAGCAGGGAGAGGGAGGAGGG - Intergenic
1085533847 11:77206604-77206626 CCTCAGGTGGAGAGGGAGGAAGG - Intronic
1085625116 11:78065908-78065930 CCTCAACGGGAGAGGGAAGAAGG - Intronic
1085654894 11:78304984-78305006 CCTCCCAGAGAGAGTAAGGAAGG - Intronic
1085832529 11:79916735-79916757 CCTCTGAGGGAGAGGGAACACGG - Intergenic
1086442207 11:86839484-86839506 CCTCAAAGTGATAGGGAGAATGG + Intronic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1087240023 11:95764111-95764133 CCTCACAGATAGATGAAGGAGGG + Intergenic
1087666408 11:101053821-101053843 CCACACAGAGAAAGGAAGGAGGG - Intronic
1088063063 11:105680712-105680734 CCTCACTGGGGAAGGGAGGAGGG - Intronic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088715163 11:112542721-112542743 CCCACCAGGAAGAGGGAGGAAGG + Intergenic
1089356673 11:117858407-117858429 CCTGACATGGAGAGGGAGTGAGG - Intronic
1089654678 11:119938442-119938464 CCCAACATGGAGAGGGAGGGAGG - Intergenic
1090026902 11:123175419-123175441 CCCCACATGTTGAGGGAGGAAGG - Intronic
1090351449 11:126110994-126111016 CCTCACATGGTAAGGGAGGCAGG + Intergenic
1090357805 11:126151580-126151602 GACCACAGGTAGAGGGAGGAAGG + Intergenic
1090973226 11:131660482-131660504 CCTCTCGGGAGGAGGGAGGAAGG - Intronic
1091319695 11:134640778-134640800 GGTCACAGGGACAGGCAGGAAGG + Intergenic
1091790928 12:3271758-3271780 CCATAAAGGGAGAGGCAGGAGGG - Intronic
1092077281 12:5684277-5684299 CCTCAGAGGGATAGGGATCAGGG + Intronic
1092566605 12:9672670-9672692 CCTGAAAGAGACAGGGAGGATGG - Intronic
1092818512 12:12331703-12331725 TCTGACAGGGAGGAGGAGGAGGG + Intronic
1093516329 12:19990808-19990830 CTTAAGAGGGAGAGGGAGGCAGG + Intergenic
1093806042 12:23434424-23434446 ACTCACAGGAAAATGGAGGATGG + Intergenic
1095498557 12:42811672-42811694 CCTTACAGCCTGAGGGAGGAGGG + Intergenic
1095666958 12:44813862-44813884 CCTCACAGGAAGAGTAAGAAAGG + Intronic
1096596700 12:52700440-52700462 CCACAGAAGGTGAGGGAGGAAGG + Intronic
1096694018 12:53337528-53337550 CCTGACAGGGAGAGCTGGGAGGG - Intronic
1097182392 12:57178885-57178907 CCTCACAGGGATTGGGAGCTGGG - Exonic
1097266468 12:57748356-57748378 CCTCAAAAGGAGAGGTGGGAGGG + Exonic
1097689856 12:62724526-62724548 CCTCAGAGGGAGAGGGTAGGTGG - Intronic
1098309709 12:69136222-69136244 CCACCCTGGGAGAGGCAGGAAGG + Intergenic
1098536266 12:71597006-71597028 CCCCATGGGGGGAGGGAGGAGGG - Intergenic
1099618911 12:84976007-84976029 CTTCACTGGCAGAGGGAAGAGGG - Intergenic
1099779256 12:87172952-87172974 CCTGAAAGTGACAGGGAGGATGG + Intergenic
1099832120 12:87857470-87857492 CCACTGTGGGAGAGGGAGGAAGG - Intergenic
1101040677 12:100752352-100752374 TGTAAGAGGGAGAGGGAGGAAGG - Intronic
1101238840 12:102817899-102817921 CCTGACAGAGGGAGGCAGGAGGG - Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1102204604 12:111081970-111081992 CCTCTCAGGGTGAGGGAGCCGGG - Intronic
1102576548 12:113859471-113859493 GCTCACAGGGAGGGGAAGCAGGG - Intronic
1103236098 12:119373925-119373947 CCTCAAAGAGAGAGTGAGAAAGG - Intronic
1104675148 12:130707354-130707376 CCTCCCATGGGGAGGGAGGGAGG + Intronic
1104754858 12:131262596-131262618 GTACACATGGAGAGGGAGGAAGG + Intergenic
1104936156 12:132365448-132365470 CCACTCCTGGAGAGGGAGGAAGG + Intergenic
1105948387 13:25208796-25208818 TCTCACAGGGAGAGGCAGGGAGG + Intergenic
1106593387 13:31116934-31116956 GGGCAGAGGGAGAGGGAGGAGGG + Intergenic
1107196540 13:37659311-37659333 CATCACAGGGGGAAAGAGGAAGG - Intronic
1107562514 13:41571306-41571328 CGGGAGAGGGAGAGGGAGGAGGG - Intronic
1107708202 13:43127609-43127631 AGACAGAGGGAGAGGGAGGAGGG - Intergenic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1109438716 13:62341327-62341349 TCTCACAGAGAGAGGGAGAGGGG - Intergenic
1109669557 13:65586695-65586717 CCTCAAAGTGACAGGGAGAATGG + Intergenic
1109908970 13:68885451-68885473 CCACGCAGGGAGCGGGAGAAGGG + Intergenic
1110152291 13:72270095-72270117 CCTGAAAGGGACAGGGAGAATGG - Intergenic
1110408503 13:75177583-75177605 CCTCACATTGAGGGGGAAGAGGG + Intergenic
1110760485 13:79225259-79225281 CTTCCTAGGGAGGGGGAGGAGGG + Intergenic
1111305802 13:86410899-86410921 CCTGAAAGAGAGAGGGAGAATGG + Intergenic
1111736988 13:92154127-92154149 TATCACATGGAGAGAGAGGATGG + Intronic
1112751562 13:102588828-102588850 CCTCACAGGGGAAGGGGTGAGGG - Intergenic
1113513201 13:110872153-110872175 CCCCGCAGGGAGAGGCGGGAGGG - Intergenic
1113631654 13:111892210-111892232 GCTCACAGGGTGACAGAGGAAGG - Intergenic
1113667319 13:112149732-112149754 CCTCACAGGGGGAAGGTGGTGGG - Intergenic
1114267130 14:21079433-21079455 CTTCCAAGGGAGAGGGAGGTGGG - Intronic
1114909798 14:27176535-27176557 CCTCACATTGGGAGAGAGGAAGG + Intergenic
1116565564 14:46440009-46440031 CCTGACAGCGACAGGGAGAATGG + Intergenic
1117115252 14:52504102-52504124 CCTGAAAGTGAGGGGGAGGATGG + Intronic
1117680296 14:58197025-58197047 CCTCAGAAGAAGAGGGAGGCCGG + Intronic
1118866830 14:69711021-69711043 TCCCACAGGGAGAGGGAGGAAGG - Exonic
1119321121 14:73731080-73731102 CCTAGCAGGGAGAAGTAGGAGGG - Intronic
1119323209 14:73743635-73743657 CCTCACAGTGAGGAAGAGGAAGG + Intronic
1119754819 14:77108772-77108794 ACTCAAAAGAAGAGGGAGGAGGG - Intronic
1120718536 14:87866016-87866038 CCTCTCAGGGAAAGGGAGAATGG + Intronic
1120997382 14:90426968-90426990 TCTCACTGGACGAGGGAGGAAGG - Intergenic
1121021367 14:90582213-90582235 CCTCAGAGGCAGAGAGAGGGGGG - Intronic
1121070240 14:91012830-91012852 CCTCAAAAGGAGCTGGAGGAAGG + Intronic
1121217438 14:92259447-92259469 CCTCCCAGTCAGAGGGAGGCTGG - Intergenic
1121374858 14:93399200-93399222 CCCCACATGTAGAGGGAGGGAGG - Intronic
1121466035 14:94116078-94116100 TCTCTGAGGGAGATGGAGGAGGG + Intronic
1121630026 14:95415178-95415200 CCACACAGTGAGAGGCAGCAAGG - Intronic
1122926363 14:104904709-104904731 CTTCAAAGGAGGAGGGAGGAGGG - Intergenic
1123072998 14:105651268-105651290 CCTCCCAGGCTGGGGGAGGACGG + Intergenic
1123092922 14:105750037-105750059 CCTCCCAGGCTGGGGGAGGACGG + Intergenic
1123576780 15:21677517-21677539 TCTTACTAGGAGAGGGAGGATGG + Intergenic
1123613402 15:22119985-22120007 TCTTACTAGGAGAGGGAGGATGG + Intergenic
1124252473 15:28115919-28115941 CCTCAGTGGGACAGGAAGGAGGG + Intronic
1125967678 15:43887356-43887378 CCTCACAGGCAAAGGGAGGGTGG + Intronic
1126849801 15:52789990-52790012 CCCCACAGTGAGAGGAAGGAAGG - Exonic
1128064940 15:64758726-64758748 AGTCACAGGGAGTGGGAGGGTGG + Intronic
1128090472 15:64915635-64915657 CCTGACCTTGAGAGGGAGGAGGG + Intronic
1128618902 15:69132286-69132308 CCACTCAGGGAGAGGCAGAATGG + Intergenic
1128634243 15:69293020-69293042 ACTCACTGGGAGAGGGGGCATGG + Intergenic
1128765556 15:70248972-70248994 AGTCACAGTGAGAGGGAGGAAGG + Intergenic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129607029 15:77030022-77030044 CTTCCCAGGGGAAGGGAGGAGGG - Intronic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129921571 15:79323629-79323651 CCTCAGAGGGTGAAGGAGAAGGG - Intronic
1130140419 15:81221581-81221603 CCTGGCATCGAGAGGGAGGAAGG - Intronic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1130397182 15:83512785-83512807 GCTGATAGGGAGAGGGAGGGAGG - Intronic
1130921146 15:88345686-88345708 CCTCACATGGTAAAGGAGGAAGG + Intergenic
1131494929 15:92900120-92900142 CCCAACAGGGGGAGGGGGGAGGG - Exonic
1131522099 15:93124359-93124381 CCAAAGAGGGACAGGGAGGAGGG + Intergenic
1202985648 15_KI270727v1_random:411762-411784 TCTTACTAGGAGAGGGAGGATGG + Intergenic
1132712092 16:1273472-1273494 CCTCCCAGTGTGAGGGAGGAAGG + Intergenic
1132746006 16:1436588-1436610 CCACACAGGGAGAGGGAGGAGGG + Intronic
1132843244 16:1988683-1988705 GGTCAGAGGGAGAGAGAGGAGGG + Intergenic
1132883057 16:2170822-2170844 GCTCACAGGGAGAGGGCGGCTGG + Intronic
1133469258 16:6058341-6058363 TCTGAGAAGGAGAGGGAGGAAGG - Intronic
1133640717 16:7714686-7714708 CCTCACAGGTGGTGGGAGGGAGG + Intergenic
1134066716 16:11233114-11233136 CCCCCCATGAAGAGGGAGGAGGG - Intergenic
1134823671 16:17267099-17267121 CAGCACAGGGTGAGGCAGGAAGG + Intronic
1135400627 16:22164045-22164067 CCTCAGGTGGAGAGGGAGGTCGG + Intergenic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1135981849 16:27153936-27153958 CCTCACAGAGAAGGGGAGGTTGG + Intergenic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136545119 16:30950151-30950173 CCTCACAGGAAGTGGGATGGAGG + Intronic
1136594681 16:31239847-31239869 CCAGACAGGGAGAGAGAGGAGGG - Intergenic
1137000454 16:35225258-35225280 CTTCACAGGTAGTGTGAGGAGGG - Intergenic
1137473056 16:48779408-48779430 CCTCACAGGGAAAGAGAGAAAGG - Intergenic
1137760988 16:50940215-50940237 CCTCCCAAGGAGAGGGAGCTGGG - Intergenic
1137883111 16:52073281-52073303 CTTCTCAGGGAGCAGGAGGAGGG + Intronic
1137996410 16:53219387-53219409 TCTCTCAGGGAGAGACAGGAAGG + Intronic
1138073200 16:54014414-54014436 CATCACACGGAGAGAGAGAAAGG - Intronic
1138351878 16:56350374-56350396 CTGCACAGGGAGTGGGAGGAAGG - Intronic
1138457296 16:57128749-57128771 CCACACAGCGAGAGGATGGAGGG - Intronic
1138478453 16:57285442-57285464 CCTGACAGCGTGAGGGAGGAGGG + Intergenic
1138514895 16:57530638-57530660 CCTCTCAGGGGCAGAGAGGAGGG - Intronic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1140659678 16:77176089-77176111 CATCTCAGAGAGAGGGAAGAGGG - Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1140852473 16:78947990-78948012 AGTCAAAGGCAGAGGGAGGAAGG + Intronic
1141376596 16:83536447-83536469 CATCACAGGGAGAGAGAAAAGGG + Intronic
1141733551 16:85838020-85838042 ACTACCAGGGAGAGGGAGGAGGG + Intergenic
1142108573 16:88319165-88319187 CCTCACAGACAGATGGAAGAGGG + Intergenic
1142129171 16:88424957-88424979 CCTGAGAGGGAGAGGAAGGCCGG - Intergenic
1142262487 16:89049513-89049535 CCTCACAGGCCCAGGGAGGAGGG - Intergenic
1142308141 16:89297043-89297065 CCTCCCAGGGAGGTAGAGGAAGG - Intronic
1142361116 16:89627571-89627593 TCTCAGAGAGAGAGAGAGGAAGG + Intronic
1142373209 16:89694348-89694370 CCTCCCTGGGAGTGGGAGGCTGG - Intronic
1143158004 17:4850980-4851002 GCTGACAGGGGCAGGGAGGAGGG - Intronic
1143672265 17:8405027-8405049 CCCCACAGGGAGTGGCAGGAAGG - Intergenic
1143966772 17:10761135-10761157 ACTCACACGGCGGGGGAGGATGG + Intergenic
1144429417 17:15177421-15177443 TGTGATAGGGAGAGGGAGGAAGG - Intergenic
1144950660 17:18991908-18991930 CCTGCCAGGGTGTGGGAGGATGG + Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1145962969 17:28897970-28897992 TCTCACAGTGAGTAGGAGGAGGG - Exonic
1145966857 17:28925294-28925316 CCTCTCAGGGATATGGTGGAGGG + Intronic
1146673596 17:34758222-34758244 CCTCCCAGGGATGAGGAGGAAGG - Intergenic
1147141785 17:38464567-38464589 CTTCCTGGGGAGAGGGAGGAAGG + Intronic
1147500396 17:40957758-40957780 CTTCACAGGGAGGGGAAGAAGGG + Intergenic
1147586600 17:41656755-41656777 CCTTCCATGGGGAGGGAGGAAGG + Intergenic
1147635374 17:41960723-41960745 GCTCACAGTGGGAGGGAGGTGGG + Intronic
1147924135 17:43936200-43936222 CCTCAGAGGGAAAGGGGGCAGGG + Intergenic
1148152063 17:45402816-45402838 CCTCTGTGGGAGAGGGAGGAAGG + Exonic
1149413961 17:56438900-56438922 CATCAAAGGGAGAAGGAGAAGGG + Intronic
1149529077 17:57380503-57380525 CCTAACAGGGAGAGTGAAGCGGG + Intronic
1150283089 17:63940685-63940707 GCACACAGAGTGAGGGAGGAGGG - Exonic
1150410442 17:64937124-64937146 CCTCTGTGGGAGAGGGAGGAAGG - Intergenic
1151100486 17:71550741-71550763 CCTCACAGTGTGGGGAAGGAAGG + Intergenic
1151115838 17:71733916-71733938 CTACACAGGGAGGAGGAGGAGGG - Intergenic
1151889511 17:76943846-76943868 TTTTACAGGGAGAGGGAGGGAGG + Intronic
1151933533 17:77247784-77247806 CCTCACATGGAGGGGGAGGGAGG - Intergenic
1151961033 17:77405750-77405772 CGTGACACAGAGAGGGAGGACGG - Intronic
1152277936 17:79369025-79369047 CCACACAAGGAGAGCGAGGAGGG + Intronic
1152489325 17:80618972-80618994 CCTCGCAGGGAAGGGGAGGCGGG - Intronic
1152512822 17:80801970-80801992 CCCCACGGGCAGAGGGAAGACGG + Intronic
1152554045 17:81044241-81044263 CTTCACAGGGAGGGGATGGATGG + Intronic
1152610661 17:81313712-81313734 GCTGCCAGCGAGAGGGAGGAGGG + Exonic
1152768477 17:82153491-82153513 CCCCACAGGCAAAGGAAGGAGGG + Intronic
1152802813 17:82339789-82339811 CCTCATGGGGAGAGGAGGGAGGG + Intergenic
1153382003 18:4450813-4450835 AATCCTAGGGAGAGGGAGGAAGG + Intronic
1153555422 18:6307790-6307812 GTTCACAGGGAGAGGGAGAATGG + Intronic
1153678489 18:7477374-7477396 CCTCATGGGGGCAGGGAGGAGGG + Intergenic
1154384853 18:13884025-13884047 ACTAACAGGGAGAAAGAGGAGGG + Exonic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1155147291 18:23094631-23094653 CACCCCAGGGAGGGGGAGGAAGG + Intergenic
1155280080 18:24230235-24230257 ACAAACAAGGAGAGGGAGGAGGG + Intronic
1155546772 18:26923979-26924001 GATGACAGGGAGAGGCAGGAGGG + Intronic
1155623068 18:27803251-27803273 CCCCACATGTAGAGGGAGGGAGG + Intergenic
1155651902 18:28152925-28152947 ACTCACTGGGGGAGGGAGGGAGG + Intronic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1156609905 18:38713754-38713776 CCACACAGGGATAGACAGGATGG + Intergenic
1157080372 18:44518364-44518386 CTGCACTGGGAGAGGGAGAAGGG + Intergenic
1157444628 18:47735330-47735352 CACCACAGGGAGGGGCAGGAGGG + Intergenic
1157762104 18:50272839-50272861 CCCCAGAGGAAGAGGCAGGAGGG - Exonic
1158727125 18:59983778-59983800 CAACACAGTGAGAGGGAGGGAGG - Intergenic
1159954187 18:74507800-74507822 CCTGACAAGGAGAGGGAGGCCGG - Intronic
1160008173 18:75083769-75083791 CCTCTCAGAAAGAGGGAGGTCGG - Intergenic
1160046573 18:75392185-75392207 TCTCAGAGAAAGAGGGAGGAAGG + Intergenic
1160536601 18:79597823-79597845 CCTCACAGGGGTGGGGATGAGGG + Intergenic
1160537650 18:79603674-79603696 CCTCTCAGGGCGGGGGCGGAGGG - Intergenic
1160689497 19:454877-454899 CAGCACTGGGAGAGGCAGGACGG - Intronic
1160770297 19:828087-828109 CCTCTTAGGGAGTGGGACGATGG + Intronic
1161031938 19:2061566-2061588 GCTCAGAGGGCGAGGGAGGCGGG + Intergenic
1161340591 19:3739850-3739872 CCTCACAAGAAGAGGCGGGAGGG - Intronic
1161353084 19:3804424-3804446 CATCAGGGAGAGAGGGAGGAAGG + Exonic
1161437621 19:4273162-4273184 CATCAGAGGGATGGGGAGGAGGG + Intergenic
1161652435 19:5493474-5493496 CTTCCCAGGACGAGGGAGGAGGG + Intergenic
1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG + Intergenic
1163190217 19:15672229-15672251 CCTTAGAGGGCGACGGAGGAAGG - Intergenic
1163390589 19:17027550-17027572 CCACACGGGGAGGGGCAGGAGGG - Intergenic
1163502601 19:17685958-17685980 TCTCCCAGGGAGAGGTGGGATGG - Intronic
1163633719 19:18429211-18429233 CCTCGGAGGGCGAGAGAGGAAGG - Intronic
1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG + Intergenic
1164563268 19:29308640-29308662 TCTCACAGGGACAGGGCTGAGGG + Intergenic
1164629924 19:29755249-29755271 CTCCACAGGCAGAGGCAGGAGGG + Intergenic
1164827766 19:31297012-31297034 CCTCAGTGGGAGCGGGAGGTGGG + Intronic
1164861661 19:31566537-31566559 CCTGACAGGGGGAAAGAGGAGGG + Intergenic
1165314789 19:35048212-35048234 CCGCACAGTGAGAGCCAGGATGG + Intronic
1165404660 19:35622316-35622338 GCTCTCACGGGGAGGGAGGAAGG + Intronic
1165607475 19:37118005-37118027 CCTCAAAGTGACAGGGAGAATGG + Intronic
1166201208 19:41238945-41238967 CCTGACATAGGGAGGGAGGATGG + Intronic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1166528181 19:43526345-43526367 ATTCACTGGGAGAGAGAGGAGGG + Exonic
1168103981 19:54155596-54155618 CCTCACTGGGGAGGGGAGGAGGG - Exonic
1168279595 19:55297698-55297720 TCGCTCAGGGAGAGGGAGCAGGG - Intronic
1168290236 19:55354063-55354085 CCTCCAGGGGAGAGGGAGGCGGG - Exonic
925449223 2:3953802-3953824 TCTCCCAGGGACAGAGAGGAAGG + Intergenic
925522010 2:4757300-4757322 CGTCAGAGGAAGAGGGAAGAAGG - Intergenic
926010109 2:9400462-9400484 TCTCAGAGGCCGAGGGAGGAGGG - Intronic
926057045 2:9779899-9779921 CATCACAGGCAGAGGCAGGCTGG - Intergenic
927177366 2:20420056-20420078 GCTCACAGGAACAGGGAAGATGG + Intergenic
927313204 2:21653197-21653219 CCTCTCAGGGCGTGGAAGGAGGG + Intergenic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
927666453 2:25036233-25036255 CCTCCCAGAGGGAGGGAAGAGGG - Intergenic
928163940 2:28955657-28955679 CCTCCCAGGAAGTGGGAGTACGG - Intergenic
929107108 2:38376684-38376706 CCTTACGCGGACAGGGAGGAAGG - Intronic
929174945 2:38966940-38966962 TCTCTAAGGGAGAGGGAGGTAGG - Intronic
929209131 2:39334707-39334729 CCTCTCAGGGAGGGAAAGGAGGG - Intronic
929507539 2:42540017-42540039 CCAGCCAGAGAGAGGGAGGAAGG - Intronic
929565059 2:42978860-42978882 CCTCAGAAGGACAGGGAGGAGGG + Intergenic
929570214 2:43018196-43018218 GCTGACAGGGAGAGGAGGGAGGG + Intergenic
929997967 2:46840869-46840891 CATCACTGGGACAGGAAGGAAGG - Intronic
930089599 2:47521856-47521878 CCTCACTGGGCGAGGGTGGGGGG + Intronic
931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG + Intronic
931125242 2:59268726-59268748 CCTCAAAGGGAGAGGAAGAGGGG - Intergenic
931140624 2:59453660-59453682 CCAGACCGGGAGAAGGAGGAAGG - Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932459341 2:71872476-71872498 CCCCACAGGGCCAGGGAGGGTGG - Intergenic
932515840 2:72348158-72348180 GCTCACAGGTAGAAGGAGTAAGG + Intronic
932568175 2:72922498-72922520 CATCACAGGGAGATGGGTGAGGG - Intronic
932794494 2:74682702-74682724 CCTCTTTGGGGGAGGGAGGAAGG + Intronic
933906731 2:86901401-86901423 CCACACAGGCACAGGCAGGAAGG + Intergenic
934321497 2:91975237-91975259 CCCCACAGGGACTGGGGGGAGGG - Intergenic
934522737 2:95030197-95030219 CCTCACAGGAAGAGGAAGGCAGG + Intronic
934936168 2:98467101-98467123 GCTCACATGGCGAGAGAGGAAGG + Intronic
935775819 2:106470310-106470332 CCACACAGGCACAGGCAGGAAGG - Intergenic
936152996 2:110031874-110031896 TGTCTCAGGGAGAGGGAGGGTGG + Intergenic
936191684 2:110339538-110339560 TGTCTCAGGGAGAGGGAGGGTGG - Intergenic
936365431 2:111850270-111850292 CCACACAGGCACAGGCAGGAAGG - Intronic
936373815 2:111924293-111924315 GCTCACAGGGAAAGTGGGGATGG - Intronic
936715649 2:115184065-115184087 CCAGACAGGGAGAGGGAATAGGG + Intronic
936839714 2:116754601-116754623 CCTCCCCGGGACAGGGAGGCCGG + Intergenic
937117629 2:119419945-119419967 GATCACATGGTGAGGGAGGAAGG + Intergenic
937198285 2:120179869-120179891 ACTGACAGGAAGATGGAGGATGG + Intergenic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
938337285 2:130511238-130511260 TCACATAGCGAGAGGGAGGAGGG - Intergenic
938352553 2:130609497-130609519 TCACATAGCGAGAGGGAGGAGGG + Intergenic
938657092 2:133445708-133445730 CAGCACAGGGAGAGTAAGGAAGG + Intronic
938864565 2:135404483-135404505 CCTCAAAGTGACAGGGAGAATGG + Intronic
939314109 2:140524790-140524812 CCAAAAGGGGAGAGGGAGGAAGG + Intronic
939640683 2:144637279-144637301 CCTGAAAGGGACAGGGAGAATGG - Intergenic
939698499 2:145358746-145358768 TCTAACAGGGAGAAGTAGGAGGG + Intergenic
939961884 2:148572503-148572525 CCTCAGAGGGGTGGGGAGGAGGG - Intergenic
940111965 2:150164840-150164862 ACTCAGAGGGAGAAGGAGCAAGG - Intergenic
940132631 2:150400988-150401010 CCAGACAGGGTGAGAGAGGAGGG - Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940639564 2:156332599-156332621 CCTCACGGAGGGAGGGAGCAGGG + Exonic
940688366 2:156882978-156883000 CCTCACGTGGATATGGAGGATGG + Intergenic
940792371 2:158042693-158042715 CCTTATAGGAAGAGAGAGGAAGG + Intronic
941775881 2:169393315-169393337 CCTCATAGGTGGATGGAGGAGGG - Intergenic
942113737 2:172707264-172707286 CCACCCTGGGAGCGGGAGGAAGG + Intergenic
942398302 2:175575370-175575392 CTTCACATGGAGAGGGAGGGAGG - Intergenic
943197419 2:184771969-184771991 TCTCAAAGGGAGAGGGAATAGGG + Intronic
943555674 2:189401211-189401233 CCTGTCAGAGAGTGGGAGGAGGG - Intergenic
943648835 2:190435062-190435084 CCTCAGATGGAGAGGGGGGTTGG - Intronic
943712579 2:191113572-191113594 CTTCACAGGGAGATGTAAGAAGG + Intronic
944030012 2:195224169-195224191 CCTCAAAGTGACAGGGAGAATGG + Intergenic
946020671 2:216637771-216637793 CCTGTCAGGCAGAGGGAAGAGGG + Intronic
946375348 2:219305189-219305211 CCTCTCAGGGAGACTGAGAAGGG - Intronic
946523421 2:220491735-220491757 CCCAACAGGGAGAGGCAGGAAGG - Intergenic
947517349 2:230817551-230817573 TCTCTCAGGGAAAGGGAGGAAGG + Intronic
947519137 2:230830315-230830337 CCTCACTGTGTGAGGGTGGAAGG - Intergenic
947565327 2:231189776-231189798 GCTCACAGAGGGAGGGAGGGAGG + Intergenic
947740055 2:232480892-232480914 CTTCACAGGGAGAGCAGGGAGGG - Intronic
947857164 2:233331831-233331853 CCTCGAAGGGAGAAAGAGGAAGG - Intronic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
948069248 2:235106460-235106482 ACCCACAGGGACAGGCAGGACGG - Intergenic
948377279 2:237529846-237529868 TCTCCCAGGAGGAGGGAGGAGGG - Intronic
1168935734 20:1664044-1664066 CATCACATGGTGAGAGAGGAAGG + Intergenic
1169146629 20:3256835-3256857 CCTCAGAGGCCAAGGGAGGAGGG + Intronic
1169191738 20:3662433-3662455 ACACACAGGGAGATGGATGAGGG - Intronic
1169263998 20:4156661-4156683 CCTCACTGGGTGAATGAGGAAGG + Intronic
1169277503 20:4243674-4243696 CCTCACCGAGAGAGAGGGGAGGG - Intronic
1169894736 20:10490792-10490814 GTTCACAGGGAGAAGGAGAATGG - Intronic
1169896360 20:10509069-10509091 CCTGACTCGGAGTGGGAGGAGGG - Intronic
1170662727 20:18358691-18358713 CATCCCAAGGAGAGGAAGGAGGG - Intergenic
1170980485 20:21207566-21207588 CCTCTAAGGGAAAGGGGGGAGGG - Intronic
1171255002 20:23684030-23684052 ACACACAGGGAGATGGTGGAGGG + Intergenic
1171271453 20:23821675-23821697 ACACACAGGGAGATGGTGGAGGG + Intergenic
1172061112 20:32188168-32188190 CCTAACAGGTAGAGGCAGGGGGG + Intergenic
1172123086 20:32609860-32609882 CCTCAGATGGAGAGTGAGGGGGG - Intergenic
1172290161 20:33770303-33770325 CCACCCAGGGAGAGGGAAGCAGG - Intronic
1172782932 20:37447854-37447876 GAGCACAGGGAGAGGGAAGATGG - Intergenic
1173222028 20:41138409-41138431 CCTCTGGGGGAGAGGGAGGAAGG + Intronic
1173452838 20:43180388-43180410 TATGACAGGGAGAGAGAGGAAGG - Intronic
1173603070 20:44309928-44309950 CCTCTCAGGGTGGGTGAGGAAGG + Intronic
1173615422 20:44400328-44400350 CGAAACAGGGAGAGGGAGGAGGG + Intronic
1173733780 20:45345763-45345785 CCTGAGAGGGAGTGGCAGGAAGG + Intronic
1174419652 20:50391252-50391274 CCTACCAGGGAGAGAGGGGAAGG - Intergenic
1175056275 20:56201496-56201518 CATCATGGGGAGAGGGAGGAAGG + Intergenic
1175065435 20:56282425-56282447 CCCCAGAAGGAGAGGGAGGCTGG - Intergenic
1175089919 20:56493975-56493997 TCCCACAGGCACAGGGAGGAGGG - Intronic
1175441526 20:58995745-58995767 TCTCACAGGGCGAGAGAGGCTGG - Exonic
1175743577 20:61437393-61437415 CGTCACAGGGAGACAGAAGATGG - Intronic
1176000593 20:62829745-62829767 CCCTACAGGGAAAGGAAGGAGGG - Exonic
1176032037 20:63017368-63017390 CCTCCCACGGTGAGAGAGGACGG + Intergenic
1176099902 20:63360212-63360234 CCAGGCAGGAAGAGGGAGGAAGG + Intronic
1176130921 20:63496543-63496565 CCTCAGAGGGATGGGGAGGCTGG - Intronic
1176172845 20:63703910-63703932 CCCCACAAGGAGGGGGAAGAGGG + Intronic
1176175715 20:63723043-63723065 CGTCATAGGAGGAGGGAGGATGG - Intronic
1176222027 20:63974306-63974328 CCACACAGGGGCAGGGATGAGGG + Exonic
1176671603 21:9740008-9740030 TCTCAGAGAGAGAGAGAGGATGG - Intergenic
1178109693 21:29357739-29357761 CATCACAGAGAGAGCAAGGATGG - Intronic
1178121388 21:29473719-29473741 GCTCACAGACAGAGGGAGCAGGG - Intronic
1178349265 21:31860623-31860645 GATCACATGGTGAGGGAGGAAGG + Intergenic
1178664302 21:34533320-34533342 CCTAACAGGCAGAGTGAGAATGG - Intronic
1178974271 21:37208427-37208449 CCCCAGTGGGGGAGGGAGGAGGG - Intergenic
1179058218 21:37955327-37955349 TATCACAGGGGGAGGGAGGATGG + Intronic
1179364225 21:40740734-40740756 ACTCAGAAGGACAGGGAGGATGG + Intronic
1179438818 21:41379499-41379521 CCTCTCAAGGAGTGGGAAGAAGG - Intronic
1179507474 21:41851486-41851508 CCTGGCAGGGTCAGGGAGGAGGG + Intronic
1179514448 21:41897189-41897211 CCAGACAGGGGGAAGGAGGAGGG + Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179632852 21:42689232-42689254 CCTCAAGGTGACAGGGAGGACGG - Intronic
1179802146 21:43816186-43816208 CCTCAGCAGGAGAGGGAGGCAGG - Intergenic
1179903479 21:44406947-44406969 CCCCACCAGGGGAGGGAGGAGGG + Intronic
1179987591 21:44930196-44930218 ACTAACAGGGGGAGGGAGGGGGG - Intronic
1180120710 21:45745712-45745734 CTTCACGGAGAAAGGGAGGAAGG + Intronic
1180588565 22:16915584-16915606 CCTCACAGGGAGAATGATGTGGG + Intergenic
1180708582 22:17824622-17824644 CGTCACAGGGAGAGATAGGCGGG + Intronic
1181437929 22:22921192-22921214 CCCCAGAGGGAGAGGGGAGAGGG - Intergenic
1181764719 22:25083240-25083262 CCACACACGCAGAGGGAAGATGG - Intronic
1182749973 22:32633589-32633611 CCTCCGAGGCAGAGGGAGCAAGG + Intronic
1182777227 22:32839989-32840011 CCTCCCGGGGAAGGGGAGGAGGG - Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1183279443 22:36924180-36924202 GGTCACAGGGAGGGGCAGGATGG - Intronic
1183284167 22:36952137-36952159 GATCACAGGGAGGGGCAGGATGG + Intergenic
1183319098 22:37154261-37154283 CCTCAGATGGAGAGGCAGGGAGG + Intronic
1184106736 22:42371745-42371767 CCAGGCAGGAAGAGGGAGGAGGG - Intergenic
1184747671 22:46465469-46465491 CCCCAGAATGAGAGGGAGGAGGG - Intronic
1185006285 22:48278726-48278748 CCTGACAGGGTGAGGCAGCAGGG + Intergenic
1185074862 22:48677742-48677764 CCTCACAAGGAGAGTCAGGTCGG + Intronic
1185076830 22:48687674-48687696 TGTCACTGGGAGAGTGAGGAGGG - Intronic
1185180856 22:49362035-49362057 AATCACAGAGAGAGGGAAGAGGG + Intergenic
1185190443 22:49433040-49433062 CCGGGCAGGGAGAGGGCGGATGG - Intronic
1185190470 22:49433130-49433152 CCAGACAGGGAGAGGGTGGATGG - Intronic
1185190491 22:49433211-49433233 CCCGGCAGGGAGAGGGCGGATGG - Intronic
1185190502 22:49433253-49433275 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190518 22:49433334-49433356 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190538 22:49433414-49433436 CCCGGCAGGGAGAGGGCGGATGG - Intronic
1185190549 22:49433456-49433478 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190571 22:49433537-49433559 CCCGGCAGGGAGAGGGCGGATGG - Intronic
1185190582 22:49433579-49433601 CCCAGCAGGGAGAGGGCGGATGG - Intronic
949612594 3:5717994-5718016 CTACACAGGCAAAGGGAGGAGGG + Intergenic
950464959 3:13148267-13148289 CCTCACAGAGGGAGGGAGGAGGG + Intergenic
950866206 3:16191120-16191142 CCTCATAGTGAGAGAGAAGATGG - Intronic
951347070 3:21559769-21559791 CCTCAAAGTGACAGGGAGAATGG - Intronic
951653573 3:24980379-24980401 CCTGAAAGTGAGAGGGAGAATGG - Intergenic
952530168 3:34255141-34255163 ACTCTCAGGGAAAGGGAGGAGGG - Intergenic
952707150 3:36391032-36391054 CCTGCCAGAGAGAGGGAAGATGG - Intronic
952855488 3:37767088-37767110 ACGCAAAGGAAGAGGGAGGAGGG + Intronic
952907907 3:38155192-38155214 CCTCAGAGTGAAAGAGAGGAAGG + Intergenic
952955595 3:38555477-38555499 CCTCGTAGAGATAGGGAGGAAGG - Intronic
952960526 3:38586459-38586481 CATCACAGAGAAAGGGGGGAAGG + Intronic
953979330 3:47405893-47405915 CCTGGGAGGGAGTGGGAGGATGG - Exonic
954445711 3:50545832-50545854 CCTCAAAGGGGGCAGGAGGAGGG - Intergenic
954588357 3:51756827-51756849 CATCACATGGTGAGAGAGGAAGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
956326067 3:68054355-68054377 GATCACATGGAGAGAGAGGAGGG - Intronic
956465978 3:69521112-69521134 CCTCTCAGGGACAGTGAGGAGGG + Intronic
957009338 3:74986122-74986144 CCTGACAGGGCTAAGGAGGAGGG - Intergenic
957147492 3:76443098-76443120 CATCACATGGCGAGAGAGGAAGG + Intronic
958166496 3:89884060-89884082 CCTGAAAGTGAGAGGGAGAATGG - Intergenic
958407630 3:93768334-93768356 CCTGAAAGTGAGAGGGAGAATGG + Intergenic
958553674 3:95646579-95646601 CCTGAAAGTGAGAGGGAGAATGG + Intergenic
959500425 3:107100343-107100365 CAGCACAGTGTGAGGGAGGAGGG + Intergenic
959584819 3:108016121-108016143 CATCACAGGAAGAGAGGGGATGG - Intergenic
959840524 3:110969326-110969348 TCCAAAAGGGAGAGGGAGGAAGG - Intergenic
960523355 3:118681229-118681251 CATCACATGGTGAGAGAGGAAGG - Intergenic
960883226 3:122367106-122367128 GGAGACAGGGAGAGGGAGGAAGG + Intronic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
961812578 3:129530400-129530422 CCGAGAAGGGAGAGGGAGGAAGG + Intronic
962271329 3:133980000-133980022 CCTCACAGGGCACAGGAGGAGGG - Intronic
962736517 3:138329949-138329971 CCAGCCAGGGAGAGGCAGGAGGG + Intergenic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
962839597 3:139221824-139221846 CCTCACAGAGATAGTGAGGCTGG + Intronic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
964542148 3:157791311-157791333 CCTCATAGAGACAGGCAGGAAGG + Intergenic
964628709 3:158784934-158784956 CCTCACCTGGAGAGGGATGAGGG + Intronic
964731618 3:159872832-159872854 TCTAACAGGGATAGGGAGTATGG - Intronic
964869169 3:161294107-161294129 GCTCACAGGTATTGGGAGGAGGG - Intergenic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
965604299 3:170483971-170483993 TTTCACAGTGAGAGGGAGTACGG - Intronic
966105818 3:176332639-176332661 CCTCAAAGGTAGAGAGAAGAAGG + Intergenic
966806994 3:183815488-183815510 GCTCCCAGGGAAAGTGAGGAGGG + Intergenic
967264444 3:187677970-187677992 GATGACAGGGAGAGGGAAGAAGG - Intergenic
967321129 3:188196481-188196503 CTCCAAAGGTAGAGGGAGGAGGG - Intronic
967503115 3:190222848-190222870 CCTCCCAGTGAGAGGGAATAAGG + Intergenic
968434522 4:577507-577529 CCTCTCAGGAAGAGGCTGGAGGG - Intergenic
968732063 4:2273870-2273892 CCACACAGGCAGGAGGAGGAGGG - Intronic
969155387 4:5205462-5205484 GCACACAGAGACAGGGAGGAGGG + Intronic
969339067 4:6529103-6529125 CCTCACAGGGACAGGGAAGGGGG + Intronic
969388550 4:6873469-6873491 CCTCTCAGGAAGAGCTAGGAGGG + Intronic
969502994 4:7565073-7565095 GCTCAGAGGGAGGGGGAGCAAGG + Intronic
969717479 4:8874838-8874860 CCTCACAGGGATGGGGAGACAGG - Intergenic
971276463 4:25202473-25202495 CCTGAAAGTGAGAGGGAGGTTGG + Intronic
971422220 4:26484011-26484033 CCTCACAGGGTCATGGAGAATGG - Intronic
971471494 4:27031657-27031679 GATCACAGGGAGGGGGAGAAGGG - Intergenic
972638914 4:40908474-40908496 CCTGACGGAGAGAGGGAGGCCGG + Intronic
973576958 4:52299232-52299254 TCTCACACTGAGAGGGAGGGTGG - Intergenic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
974370715 4:61013157-61013179 CCTGAAAGTGAGAGGGAGAATGG + Intergenic
974511502 4:62848129-62848151 CCTCACAGGGAGGGAGAGGGTGG + Intergenic
975513853 4:75222851-75222873 CCTGAAAGGGACAGGGAGAATGG + Intergenic
976222587 4:82769788-82769810 CTACAGAGTGAGAGGGAGGAAGG + Intronic
976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG + Intronic
978393261 4:108250227-108250249 ACACATAGAGAGAGGGAGGAAGG + Intergenic
979263196 4:118671712-118671734 CATCACAGTGAGATGGAGGGAGG + Intergenic
979306786 4:119155074-119155096 CATCACATGGTGAGAGAGGAAGG + Intronic
979495139 4:121374972-121374994 CGGCACAGCCAGAGGGAGGATGG - Intronic
979858366 4:125662988-125663010 CTTCATAGGGAGAGGGGAGAAGG + Intergenic
981756750 4:148148173-148148195 CCTCACTGGGATAGGGAATAAGG - Intronic
982096768 4:151930542-151930564 CCTAACAGGAAGGGGAAGGAAGG - Intergenic
982415271 4:155123935-155123957 CCAGAAAGGGAGAGGGAGGCAGG - Intergenic
983803813 4:171968472-171968494 CCTTACAGGAAGAGGAAGAAAGG - Intronic
984501623 4:180565749-180565771 CCACACAGGCCGAGGGAGAAGGG - Intergenic
984712662 4:182898617-182898639 CCTCAGAGATGGAGGGAGGAAGG - Intronic
985187547 4:187333747-187333769 CCACAAAGGGGCAGGGAGGATGG + Intergenic
985241940 4:187939625-187939647 CATAACAGGGAGAGGGAGATTGG + Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985679129 5:1246818-1246840 GAACAGAGGGAGAGGGAGGAGGG - Intergenic
985776541 5:1847173-1847195 CCTCACAGGGAGTGCGGGGCAGG - Intergenic
985875801 5:2592958-2592980 CCTCACAGGAATACGGCGGAGGG - Intergenic
987298259 5:16573655-16573677 AGGCACAGGGAGAGGGAGGATGG + Intronic
988350266 5:30095687-30095709 CCTGTCAGGGAGGAGGAGGAGGG - Intergenic
988636298 5:32988343-32988365 TCTCATAGGGTGAGGCAGGAAGG + Intergenic
988796084 5:34655141-34655163 CCTAGTAGGGAGAGGGAGGAAGG + Intergenic
988903282 5:35756776-35756798 TCTCCCAGGGAGAGGGAAGAAGG - Intronic
989987957 5:50724850-50724872 ACTCAGAGTGGGAGGGAGGAAGG - Intronic
990328295 5:54699460-54699482 ACTCACAGGGAGTTTGAGGATGG + Intergenic
990537659 5:56738789-56738811 CCAAAAGGGGAGAGGGAGGAAGG - Intergenic
990560818 5:56981187-56981209 CATCAAAGTGGGAGGGAGGACGG + Intergenic
990977656 5:61573376-61573398 CCTCACAGCGAGAGACAGCAGGG + Intergenic
992002849 5:72452245-72452267 CCTCAAAGGGAGAGAGAGGGAGG + Intronic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992431513 5:76715673-76715695 CCACACGGAGGGAGGGAGGACGG + Intergenic
992597612 5:78361301-78361323 CCTAACAGAAAGAGGGGGGATGG - Intronic
993466844 5:88258398-88258420 TCTCACAGAGGAAGGGAGGAAGG + Intronic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
993620592 5:90163235-90163257 TATCACAGGAAGAGTGAGGAAGG + Intergenic
993722615 5:91336510-91336532 CATCACAGTGAGTGGCAGGAAGG - Intergenic
993736257 5:91479859-91479881 CCTAACTGGGAGAAAGAGGATGG - Intergenic
994642926 5:102432879-102432901 CCTGAAAGAGATAGGGAGGATGG - Intronic
994988607 5:106969472-106969494 AATCCCAGGGAGAGGGAGGGAGG + Intergenic
995310011 5:110699778-110699800 CCTCAGAGGGTGGTGGAGGAGGG - Intronic
995686007 5:114773021-114773043 CCTCTCAGGGAGAAGAAGTAGGG - Intergenic
996508587 5:124294217-124294239 CCTCACATGTTGAGGGAGGGAGG + Intergenic
997206861 5:132055251-132055273 CCTCCCAGGGAGAGAGGGGAAGG - Intergenic
997511795 5:134459384-134459406 CCTCCGCGGGAGAGGGAGGCAGG + Intergenic
997743482 5:136278383-136278405 CCTCACAGGGGCAATGAGGAAGG - Intronic
997789864 5:136749183-136749205 TCTCACAGTGAGAGAGAGCATGG - Intergenic
998159592 5:139805944-139805966 TGCCACAGGGAGAGTGAGGAGGG + Intronic
998463887 5:142327755-142327777 CATCTCAGGCAGAGGGAGCATGG + Intergenic
998466949 5:142354183-142354205 CCTAGAAGGGAGAGTGAGGAGGG + Intergenic
998618813 5:143771846-143771868 CCACTCAGGGAGGAGGAGGAAGG + Intergenic
998821842 5:146064271-146064293 CCTGACAGGGTGAGGAAAGAAGG + Intronic
999098649 5:149004365-149004387 CCTCATTGGGGGAGGAAGGAAGG + Intronic
999645002 5:153708815-153708837 CCTCATAGGAACTGGGAGGAAGG + Intronic
1000180646 5:158807261-158807283 GCTCACAGGGCTAGGCAGGAAGG + Intronic
1000732492 5:164853630-164853652 GCTTACAGAGAGAGGGAGAAGGG + Intergenic
1001099865 5:168805299-168805321 ACACACAGGGAAGGGGAGGAGGG + Intronic
1001919096 5:175586652-175586674 CATCACATGGCAAGGGAGGAAGG + Intergenic
1001963686 5:175895484-175895506 CCTCACACGGACAGGCTGGAAGG + Intergenic
1002213238 5:177610582-177610604 CCTCACTGAGACACGGAGGAGGG + Intergenic
1002225826 5:177722607-177722629 GCACAGAGGTAGAGGGAGGAGGG + Intronic
1002254950 5:177951722-177951744 CCACACAGGTTGAGAGAGGAGGG + Intergenic
1002483131 5:179516682-179516704 CCACACAGGTGGAGAGAGGAGGG - Intergenic
1002538001 5:179888777-179888799 CCTGGCAGGGAGACGGACGAGGG + Intronic
1002568690 5:180128222-180128244 CACCCCAGGGAGAGGGAGGCTGG - Intronic
1002795914 6:470964-470986 CCCCACAGGGACAGGCAGGGTGG - Intergenic
1004016477 6:11736600-11736622 CCACACAGGGAGAGGAAGCAGGG - Intronic
1004813067 6:19281074-19281096 AATCAAAGGGAGAGTGAGGAAGG + Intergenic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006055968 6:31384783-31384805 CCTCACAGGGAAATGGAAGTGGG - Intergenic
1006567539 6:34973327-34973349 CCTCACAGGGAGGGAGACTAAGG - Intronic
1007019423 6:38504429-38504451 TTTCATAGGGAAAGGGAGGAAGG - Intronic
1007095090 6:39208062-39208084 GCACAGGGGGAGAGGGAGGAGGG - Intronic
1007368277 6:41409432-41409454 GCTCGCAGGGAAAGGGAGGGAGG - Intergenic
1007664960 6:43508620-43508642 CCTCTCAGGAAGGGGCAGGACGG - Intronic
1007775540 6:44222662-44222684 CCTCCAAGGGAGGGGGAGGGAGG - Intronic
1009195552 6:60680179-60680201 CCTAACAGGAATTGGGAGGAAGG + Intergenic
1009264269 6:61533321-61533343 CCTCAAAGTGACAGGGAGGATGG + Intergenic
1009380259 6:63019194-63019216 ACTCAAAGAGAGAGGGAGAAAGG + Intergenic
1009608250 6:65902393-65902415 CATCAATGGGAGAGTGAGGATGG - Intergenic
1009925376 6:70114302-70114324 CCTCACAGTGAGAAGGATGATGG - Intronic
1009929514 6:70160373-70160395 CCCCACATGTAGAGGGAGGGAGG - Intronic
1010670199 6:78677515-78677537 CCTGACAGTGACAGGGAGAATGG + Intergenic
1010844189 6:80684747-80684769 CCTGACAGTGACAGAGAGGATGG + Intergenic
1011030252 6:82914880-82914902 CCTCTCAGGATGAGAGAGGATGG - Intronic
1012096347 6:94967580-94967602 CCTCACAGAGTGAGTTAGGAAGG - Intergenic
1012760807 6:103298125-103298147 CTTAAAAGGGAGAGGCAGGAAGG - Intergenic
1012865816 6:104616670-104616692 ACTCTCAGGCAGTGGGAGGATGG - Intergenic
1013296712 6:108764307-108764329 ATTCACAAGGAGAGGAAGGACGG - Intergenic
1013308131 6:108868979-108869001 CCTTACAGTCGGAGGGAGGAAGG - Exonic
1013906052 6:115221298-115221320 TCCCACAGAGAGAGGGAGAAAGG + Intergenic
1014160020 6:118157223-118157245 CCTCACAAGGAGTGGCAGGGTGG - Intronic
1014943465 6:127470340-127470362 CCCCACATGTAGAGGGAGGCAGG - Intronic
1015109076 6:129570511-129570533 CCTGAAAGGGACAGGGAGAATGG + Intergenic
1015864109 6:137710603-137710625 ACACACAGGAAGAGGAAGGAAGG + Intergenic
1016740588 6:147524634-147524656 CTCCACAGGGAGAAGGAGGTAGG - Intronic
1016804201 6:148196546-148196568 GCTCACTGGGAGAAAGAGGATGG - Intergenic
1017173030 6:151475758-151475780 CCTCACGTGGAGAAGGCGGACGG + Intergenic
1017444925 6:154499055-154499077 ACTCACAGGGACAGGACGGAAGG + Intronic
1018073754 6:160191206-160191228 CTTCACAGGGAGTGGGTGGGAGG - Intronic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1018525620 6:164707362-164707384 CCTGACAGTGACAGGGAGAATGG - Intergenic
1018836950 6:167492327-167492349 TCTCTCAGGCAGTGGGAGGATGG + Intergenic
1018863642 6:167731351-167731373 ACTCACCGGAAGAGGGAAGAAGG + Intergenic
1018865783 6:167746167-167746189 GCCCAGAGGGAGAGGCAGGAGGG - Intergenic
1018909777 6:168095335-168095357 CCTCCCAGGCAGCGGGAGCATGG + Intergenic
1019134060 6:169897264-169897286 ACCCACAGGGAGAGGCAGGGAGG - Intergenic
1019168369 6:170114623-170114645 CATCGCAAGAAGAGGGAGGAAGG - Intergenic
1019424574 7:968276-968298 ACCCACAGGCAGAGGGACGAGGG + Exonic
1019501224 7:1365656-1365678 CAGCACAGGGAGTGAGAGGAAGG + Intergenic
1019533215 7:1513953-1513975 CATCACGGGGAGCGGGAGGCGGG + Intergenic
1019561854 7:1663457-1663479 CCTCACTGGGACAGGAAGGCTGG - Intergenic
1019732176 7:2634406-2634428 CCTCACCAGGGGAGGCAGGAAGG - Intronic
1019907370 7:4074991-4075013 CCTCCCAGGGAGAGGGGAGAAGG - Intronic
1021694553 7:23263751-23263773 TCTCTTAGGGAGAGCGAGGAGGG + Intronic
1022127470 7:27372274-27372296 CATTACATGGTGAGGGAGGAAGG + Intergenic
1022238674 7:28488146-28488168 GATCAGAGGGAAAGGGAGGAAGG - Intronic
1023365294 7:39457846-39457868 CCTCTCTGAGAGAGGGAAGAAGG - Intronic
1023562572 7:41491200-41491222 CCTCACAGGGAATGGTGGGAAGG - Intergenic
1023562711 7:41492471-41492493 CCTCACAGGGAGTGGTGGGAAGG + Intergenic
1025251294 7:57353238-57353260 CCTACCAGGGAGAGAGGGGAAGG + Intergenic
1026450305 7:70523524-70523546 CCACCTAGGGAGAGGGAGAATGG - Intronic
1026740387 7:72975409-72975431 CCACAGATGGAGAGGGATGATGG + Intergenic
1026797689 7:73376895-73376917 CCACAGATGGAGAGGGATGATGG + Intergenic
1026956144 7:74377467-74377489 CCTCAGAGGGGCTGGGAGGATGG - Intronic
1027103344 7:75389661-75389683 CCACAGATGGAGAGGGATGATGG - Intergenic
1027171019 7:75872506-75872528 CCTGACAGGCACAGAGAGGAAGG + Intronic
1028157364 7:87446719-87446741 ACTCAACGGCAGAGGGAGGATGG + Intronic
1028499960 7:91508236-91508258 CCTCAAAGTGACAGGGAGAATGG + Intergenic
1030140875 7:106303091-106303113 CCTCAAAGTGACAGGGAGAATGG - Intergenic
1031089532 7:117337685-117337707 CCTCCCAGGGTGGGGTAGGATGG + Intergenic
1032195457 7:129785953-129785975 CCTCCCAGGGCGCGGGAGGAGGG + Intergenic
1032240097 7:130153601-130153623 CCAGGCAGGGAGAGGGAGGAAGG - Intergenic
1032384039 7:131509213-131509235 CTAACCAGGGAGAGGGAGGAGGG + Intronic
1032486114 7:132288683-132288705 CCCCACAGGGGCAGAGAGGATGG + Intronic
1033519362 7:142145411-142145433 GATCAGAGAGAGAGGGAGGAAGG - Intronic
1034567363 7:151926198-151926220 CCGCACAGGGACATGGAGCACGG - Intergenic
1034683488 7:152949097-152949119 CCTCACTGAGAGAGTGAGGGGGG - Intergenic
1034997110 7:155584535-155584557 ACTCACAAGGAGGGGCAGGATGG - Intergenic
1035599726 8:890564-890586 CCGCAGAGGGAAGGGGAGGAGGG - Intergenic
1036282539 8:7414125-7414147 CCTCCCAAGGAGAGAGAGCAGGG + Intergenic
1036338933 8:7897424-7897446 CCTCCCAAGGAGAGAGAGCAGGG - Intergenic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037284536 8:17284400-17284422 CCTCACAGGGAAAGGAAGTAAGG - Intronic
1037549487 8:19956601-19956623 CCTCCCAGAGGGTGGGAGGAGGG - Intronic
1038281341 8:26168045-26168067 CCTCAGAAGGAGAAGGAGGTGGG - Intergenic
1039389193 8:37163362-37163384 CTTTACAGGGAAGGGGAGGAGGG + Intergenic
1039408272 8:37330977-37330999 ACACAAAGGGAGAGGGCGGAGGG + Intergenic
1039413295 8:37373619-37373641 CCCCACATGTTGAGGGAGGAAGG - Intergenic
1039801950 8:40965540-40965562 CCTGAAAGTGACAGGGAGGATGG + Intergenic
1040681052 8:49809746-49809768 CCTCACATGTTGAGGGAGGGAGG + Intergenic
1040787450 8:51181976-51181998 CCTCACAGGGCGTGTGATGAGGG - Intergenic
1040962303 8:53047758-53047780 CCTGAAAGTGACAGGGAGGATGG - Intergenic
1042436569 8:68773158-68773180 GATCCCAGTGAGAGGGAGGAGGG + Intronic
1042679620 8:71368393-71368415 CCTCTCAGGGAAAGACAGGAAGG - Intergenic
1043165072 8:76893430-76893452 CCTTACAAGGAAAGGAAGGAAGG - Intergenic
1043661376 8:82746450-82746472 CTTCCCAGAGAGAAGGAGGAGGG + Intergenic
1043911384 8:85868432-85868454 CCTGTCAGGGGGTGGGAGGAGGG - Intergenic
1044038488 8:87336305-87336327 CCTGAAAGGGACAGGGAGAATGG - Intronic
1045860500 8:106811032-106811054 CCTCACCTGGAGAGGGAGGTTGG - Intergenic
1047029835 8:120864404-120864426 CCTAACAAGGAGTGGGATGAAGG + Intergenic
1047197557 8:122735237-122735259 ACACACAGGGAGAGGGAGGAAGG - Intergenic
1047206564 8:122806993-122807015 GCTCACTGGTAGAGGGTGGAGGG + Intronic
1048278551 8:133087425-133087447 CCTCACACCCCGAGGGAGGAAGG - Intronic
1048531522 8:135254369-135254391 CCTGACTGGGGGAGGCAGGAGGG - Intergenic
1048730406 8:137434092-137434114 CCATACAGAGAGAGGCAGGAAGG - Intergenic
1048952001 8:139504304-139504326 CCACACAGGGACAGGGAAGAGGG - Intergenic
1049028452 8:140014095-140014117 CCACACAGGGAAAGTGACGAAGG + Intronic
1049243030 8:141548384-141548406 CCCCAGAGAGGGAGGGAGGAAGG + Intergenic
1049345323 8:142135750-142135772 CGTCTCAGGGAGGGGCAGGAGGG - Intergenic
1049366005 8:142237200-142237222 CCACGCAGGGAGAAGCAGGAGGG - Intronic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1049418983 8:142508541-142508563 CTGCTCAGGGAGAGGGTGGAAGG + Intronic
1049465329 8:142748801-142748823 CCTCACAGAGACTGGGAGCAAGG - Intergenic
1049484976 8:142851467-142851489 CCTGAAAGTGAGAGGGAGAATGG + Intronic
1049865682 8:144934036-144934058 CCAGACAGGGAGAGGCAGGGAGG - Intronic
1050181458 9:2927368-2927390 CCTGTCAGGGAGTGGGAGGTAGG + Intergenic
1050521427 9:6504704-6504726 CCTAACAGGGAAAGTGAGGAAGG - Intronic
1051288511 9:15521437-15521459 ACTCACAGGGGGAGGTGGGATGG - Intergenic
1052386599 9:27830366-27830388 CCCCACATGTTGAGGGAGGAAGG + Intergenic
1052818199 9:33118134-33118156 ACACACACGGAGAGGGAGGAAGG + Intronic
1053844922 9:42226497-42226519 ACACAGAGAGAGAGGGAGGAAGG - Intergenic
1055443374 9:76358476-76358498 CCTCAAAGGAAGAGGCAAGAGGG - Intronic
1055709008 9:79038105-79038127 GGTCACAGGGAGAGGGAGATAGG + Intergenic
1055829667 9:80363126-80363148 CCTAGAAGGGAGAGGGAGGGGGG - Intergenic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056684426 9:88747706-88747728 CCACACAGGGAGAGAGGGGCAGG + Intergenic
1057228416 9:93304512-93304534 CCCCACAGGGAGACCGAGGTGGG + Intronic
1057761265 9:97876497-97876519 CTTAAGAGGGAGATGGAGGAAGG + Intergenic
1057818630 9:98314596-98314618 CCTCACCGGGAGCAGGAGGGAGG - Intronic
1058674617 9:107389733-107389755 CCTCACTGGCAGAGGGAGAGTGG - Intergenic
1059248924 9:112871013-112871035 CCTCACTGGGAGATGTGGGAAGG + Exonic
1059292143 9:113235658-113235680 CATGACTGGGAGAGGCAGGAGGG + Intronic
1059573771 9:115468373-115468395 CCTCACTGGTAGAGGGAAGCTGG - Intergenic
1060785734 9:126450502-126450524 CCTCACATGGGGATGGAGCAGGG - Intronic
1060947598 9:127579285-127579307 CCTAAAGGGGAGAGGAAGGAGGG - Intergenic
1061509169 9:131049976-131049998 CCTCTCTGGCAGAGGGAGGGAGG - Intronic
1061604432 9:131698237-131698259 CCTAACAAGCAAAGGGAGGAGGG + Intronic
1062161585 9:135083359-135083381 CCTGCCAGGGAGAGTGCGGAGGG + Intronic
1062200634 9:135300915-135300937 AGACACAGGGAGAGGGAGAAAGG - Intergenic
1062278848 9:135743110-135743132 CCTCCCAGGGACAGGCAGGCAGG + Intronic
1062391715 9:136336524-136336546 CCTCACAGGGCCATGGAGGGAGG - Intronic
1185506554 X:635509-635531 CCCCACAGCCGGAGGGAGGAGGG - Intronic
1186726262 X:12362354-12362376 CCTGTCATGGAGTGGGAGGAGGG - Intronic
1186979119 X:14939939-14939961 CCACAGTGGGAGGGGGAGGAGGG - Intergenic
1187099356 X:16176945-16176967 TCTCTGAGGGAGAGGGAGGATGG + Intergenic
1187285332 X:17898762-17898784 CATCACACGCAGAGGCAGGAAGG - Intergenic
1188637455 X:32452088-32452110 GCTCATAGGGAGAGGGAAGAGGG + Intronic
1189573551 X:42325387-42325409 GCTCACAGGTAAAGGAAGGAAGG + Intergenic
1190739532 X:53280164-53280186 CGCCACAGGGGTAGGGAGGACGG + Intronic
1191175020 X:57490314-57490336 CCTGTCAGGGAGTGGGGGGAGGG - Intergenic
1191726274 X:64284356-64284378 CCTGACAGTGACAGGGAGAATGG + Intronic
1192031204 X:67514307-67514329 CCTGTCAGGGAGAGGGGGGCTGG + Intergenic
1192432830 X:71124307-71124329 CATCAAAGGGAGAGGGAGGCCGG - Exonic
1193452274 X:81685457-81685479 CCTGAAAGTGACAGGGAGGATGG + Intergenic
1193713570 X:84908237-84908259 CATATGAGGGAGAGGGAGGAGGG + Intergenic
1193780994 X:85701249-85701271 TCTCTCAGGGAGAAGGAGGAGGG - Intergenic
1195238464 X:102926335-102926357 CCTCTCAGGGAGGTAGAGGATGG + Intergenic
1196276067 X:113766889-113766911 TTTCATAGGGAGAGGGAGCAGGG - Intergenic
1197157390 X:123284783-123284805 CCTCAAAGTGACAGGGAGAATGG + Intronic
1197841311 X:130750046-130750068 GCAGACAGGCAGAGGGAGGAAGG - Intronic
1197923153 X:131617639-131617661 CCTCACAAGGAAAGGTAGGATGG + Intergenic
1198130799 X:133693066-133693088 CCTGTGAGGGAGAGGGAGCAGGG + Intronic
1200065440 X:153502316-153502338 CCTCCCAGGGAGAGTGAGTCAGG - Intronic
1200676292 Y:6150339-6150361 CCTCAAAGTGATAGGGAGAATGG + Intergenic
1201146255 Y:11066994-11067016 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146272 Y:11067047-11067069 GTACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146552 Y:11067931-11067953 GAACAGAGGGAGAGGGAGGAAGG + Intergenic