ID: 1101438455

View in Genome Browser
Species Human (GRCh38)
Location 12:104684209-104684231
Sequence CTGTAATCCTTCAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 171}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101438455_1101438461 13 Left 1101438455 12:104684209-104684231 CCTTCCTTCTTGAAGGATTACAG 0: 1
1: 0
2: 0
3: 7
4: 171
Right 1101438461 12:104684245-104684267 TGGTACAAAATGTGGATGGATGG 0: 1
1: 0
2: 3
3: 14
4: 199
1101438455_1101438462 17 Left 1101438455 12:104684209-104684231 CCTTCCTTCTTGAAGGATTACAG 0: 1
1: 0
2: 0
3: 7
4: 171
Right 1101438462 12:104684249-104684271 ACAAAATGTGGATGGATGGATGG 0: 1
1: 0
2: 11
3: 93
4: 865
1101438455_1101438463 21 Left 1101438455 12:104684209-104684231 CCTTCCTTCTTGAAGGATTACAG 0: 1
1: 0
2: 0
3: 7
4: 171
Right 1101438463 12:104684253-104684275 AATGTGGATGGATGGATGGATGG 0: 3
1: 60
2: 617
3: 4307
4: 22210
1101438455_1101438460 9 Left 1101438455 12:104684209-104684231 CCTTCCTTCTTGAAGGATTACAG 0: 1
1: 0
2: 0
3: 7
4: 171
Right 1101438460 12:104684241-104684263 GAATTGGTACAAAATGTGGATGG 0: 1
1: 0
2: 0
3: 15
4: 173
1101438455_1101438464 25 Left 1101438455 12:104684209-104684231 CCTTCCTTCTTGAAGGATTACAG 0: 1
1: 0
2: 0
3: 7
4: 171
Right 1101438464 12:104684257-104684279 TGGATGGATGGATGGATGGATGG 0: 12138
1: 10577
2: 16657
3: 22775
4: 28470
1101438455_1101438459 5 Left 1101438455 12:104684209-104684231 CCTTCCTTCTTGAAGGATTACAG 0: 1
1: 0
2: 0
3: 7
4: 171
Right 1101438459 12:104684237-104684259 ATAGGAATTGGTACAAAATGTGG 0: 1
1: 0
2: 0
3: 18
4: 240
1101438455_1101438465 29 Left 1101438455 12:104684209-104684231 CCTTCCTTCTTGAAGGATTACAG 0: 1
1: 0
2: 0
3: 7
4: 171
Right 1101438465 12:104684261-104684283 TGGATGGATGGATGGATGGATGG 0: 12138
1: 10577
2: 16657
3: 22775
4: 28470
1101438455_1101438458 -7 Left 1101438455 12:104684209-104684231 CCTTCCTTCTTGAAGGATTACAG 0: 1
1: 0
2: 0
3: 7
4: 171
Right 1101438458 12:104684225-104684247 ATTACAGAATAAATAGGAATTGG 0: 1
1: 0
2: 4
3: 30
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101438455 Original CRISPR CTGTAATCCTTCAAGAAGGA AGG (reversed) Intronic
900777657 1:4596643-4596665 CTGATACCCTTCAAGAAGAAGGG - Intergenic
907077643 1:51592990-51593012 CTGAAATCCATCAGGAAGTAGGG + Intronic
907699836 1:56774999-56775021 CTGTCAGCCTTCAAAAAGTAGGG + Intronic
909805018 1:79863644-79863666 CAGTGTTGCTTCAAGAAGGAAGG + Intergenic
911250626 1:95572491-95572513 CTCTAAGCCTTCCAGAAGGGTGG - Intergenic
911756665 1:101565549-101565571 CTGTAGTGATTCAAGAAAGAGGG - Intergenic
916676940 1:167071869-167071891 CTGAAATCCTTCTGGAAGTAAGG + Intronic
917465050 1:175268837-175268859 CTATAATCTATCTAGAAGGAAGG - Intergenic
917628872 1:176873721-176873743 CTGTTATCCTTCAGCCAGGAAGG - Intronic
918188305 1:182147178-182147200 CTGTAATCTTTCCATAAGAAAGG + Intergenic
920381121 1:205535061-205535083 CTGGGATGCTTCAAGAAGGGAGG - Intergenic
924002089 1:239565411-239565433 CTGTAATAGTTCAGGAGGGAAGG + Intronic
1068935460 10:62631536-62631558 CTGGAACCCTTCAAGAACTAGGG - Intronic
1072308256 10:94129179-94129201 ATGAAAGACTTCAAGAAGGATGG + Intronic
1074808465 10:117078276-117078298 CTGTAAGCCATCTACAAGGATGG + Intronic
1076251607 10:128988529-128988551 CTGTTATCCTTCATGAAATATGG + Intergenic
1076875285 10:133212860-133212882 CTGTACTCCGTCAGGAAGTAGGG - Exonic
1079107997 11:17586230-17586252 CTGTCATCCATCAAGAAGCAAGG - Intronic
1081801152 11:45860153-45860175 CTGCACTCATGCAAGAAGGAAGG - Intronic
1082944683 11:58745631-58745653 CTGGAAGCCTTTAAGAAGCAAGG - Intergenic
1083476211 11:62917283-62917305 CTAGAATCCCTAAAGAAGGAGGG + Intronic
1083732022 11:64657449-64657471 TTGTTTTCCTTCAAGAAGGCTGG + Intronic
1085777604 11:79380641-79380663 CTGTGAACCTCCAAGAAGGAGGG + Intronic
1088063374 11:105685104-105685126 CTGGATTCCTTTAGGAAGGAAGG + Intronic
1089409439 11:118227419-118227441 CTTTCATCCTTAAAGAAGGCAGG + Exonic
1092170722 12:6372441-6372463 CAGCAGCCCTTCAAGAAGGAGGG + Intronic
1093231957 12:16555925-16555947 CCCTAACACTTCAAGAAGGATGG + Intronic
1093254429 12:16849323-16849345 CTTTATTTCATCAAGAAGGAAGG - Intergenic
1096580913 12:52584446-52584468 ATGTAATGCTTGAAGATGGATGG + Intergenic
1097336359 12:58388154-58388176 CTGACATCCTTCAAGAAGCTGGG - Intergenic
1097655771 12:62361062-62361084 CTGTTCTCTTTCAAAAAGGAAGG - Intronic
1097952510 12:65447711-65447733 CTGTAATCGTTAGAGAAAGATGG + Intronic
1099412292 12:82346064-82346086 CTGGAATTCTTCAAGATGAAGGG - Intronic
1100880402 12:99009785-99009807 ATGTAATCCTTTAAGAACCAGGG - Intronic
1101438455 12:104684209-104684231 CTGTAATCCTTCAAGAAGGAAGG - Intronic
1101666048 12:106816088-106816110 ATGTTATGCTTCTAGAAGGAGGG - Intronic
1110159347 13:72357177-72357199 CAGTAATCCTTCCATAAGGGTGG + Intergenic
1114578296 14:23733185-23733207 CTGCCCTCCTTCAATAAGGAAGG + Intergenic
1115454658 14:33588308-33588330 CTGTAATCCTCCCAGATGCAGGG + Intronic
1116601756 14:46934722-46934744 CTGTAATATTTCCATAAGGAGGG - Intronic
1116841889 14:49827096-49827118 CTCCTATCCTGCAAGAAGGACGG - Intronic
1119217234 14:72878325-72878347 CATTCATCCTTCAAAAAGGATGG - Intronic
1120184743 14:81383109-81383131 CTTTATTCCTTCAAGCTGGATGG - Intronic
1120762976 14:88302778-88302800 ATGAAGTGCTTCAAGAAGGATGG + Intronic
1122487368 14:102090027-102090049 CTGTCTTCCTCCTAGAAGGATGG - Intronic
1122846470 14:104502775-104502797 CTGTCAGCCTTAAGGAAGGACGG + Intronic
1122893428 14:104743508-104743530 CTGTCATCCTGCTAGAAGGACGG + Intronic
1123056528 14:105573100-105573122 CTGGGAACCTTCTAGAAGGAGGG + Intergenic
1123057405 14:105578707-105578729 CTGGGAACCTTCTAGAAGGAGGG - Intergenic
1123080961 14:105693228-105693250 CTGGGAACCTTCTAGAAGGAGGG + Intergenic
1123081681 14:105698640-105698662 CTGGGAACCTTCTAGAAGGAGGG - Intergenic
1123722824 15:23074743-23074765 CTGTAATGCTTAAAGAGGGGTGG + Intergenic
1124807851 15:32904516-32904538 CTGTAATCTTCCAAGAGGAAAGG + Intronic
1127214233 15:56807815-56807837 CTGTATTCCTACCAGCAGGAAGG + Intronic
1128254094 15:66184593-66184615 TTAAAATCCTTCAAGATGGAAGG + Intronic
1130771926 15:86933190-86933212 CTGTAAGGCTACAAGCAGGATGG - Intronic
1132551466 16:555518-555540 CGGGACTCCTGCAAGAAGGAGGG - Intergenic
1134409995 16:13995866-13995888 TTGTAATCCTTGATGATGGAGGG - Intergenic
1134674569 16:16080674-16080696 CTGTAAGTCTCCAAGAGGGAGGG - Intronic
1138266606 16:55664278-55664300 CTGTAGTGCTGCATGAAGGATGG - Intronic
1138588353 16:57985794-57985816 CTGGAACCCTTCAGGAGGGATGG + Intronic
1143819133 17:9545193-9545215 CTGGCATCCTTTAAGAATGAGGG - Exonic
1150272624 17:63876475-63876497 CGGTAATGCTTCAGGAATGATGG - Intronic
1150276122 17:63899023-63899045 CAGTAATGCTTCAGGAATGACGG - Intergenic
1155831297 18:30517547-30517569 CTGTATCCCATCCAGAAGGAAGG + Intergenic
1156777363 18:40808511-40808533 ATGTAAAACTTCAAGAAGTACGG + Intergenic
1161788919 19:6346878-6346900 GTCTCAGCCTTCAAGAAGGAAGG - Intergenic
1161901969 19:7125790-7125812 CTGAAATCAGACAAGAAGGATGG - Intronic
1162293277 19:9794712-9794734 TTCTAATCCATCAACAAGGAAGG - Intergenic
1166982757 19:46640883-46640905 CTGTAATAGTCCAAGCAGGAGGG - Intergenic
1167372741 19:49093433-49093455 CTGTAATCCTTCAAGGCAGGTGG + Intronic
1167599467 19:50445926-50445948 CGGTACCGCTTCAAGAAGGACGG + Exonic
927044548 2:19263580-19263602 TTTTAATCCTTCAAGACAGAGGG - Intergenic
927370464 2:22348690-22348712 ATGTATTGATTCAAGAAGGAAGG - Intergenic
928403843 2:30999056-30999078 CTGGATTCCTGCAAGAAGGCGGG + Intronic
930015871 2:46970290-46970312 CTTTGAGCTTTCAAGAAGGATGG + Intronic
930804339 2:55475215-55475237 ATTATATCCTTCAAGAAGGAGGG - Intergenic
931700191 2:64903117-64903139 CTGTAAGCCTACAAGAGGAAAGG + Intergenic
935377048 2:102410289-102410311 GTGGAGTCCTTCAAGAAGCAGGG - Intergenic
935469296 2:103437596-103437618 CTGGAATGCTTAAAGAAAGAAGG + Intergenic
936226114 2:110654053-110654075 CTATAATCCTTCAAGAAAAAAGG + Intronic
937682903 2:124663841-124663863 CTGTCTTCCTTTAAGAAGGGAGG - Intronic
937868123 2:126769053-126769075 ATGAAAGCCTTCATGAAGGATGG - Intergenic
938291705 2:130154185-130154207 CTGTGATCCAGCAGGAAGGAGGG - Intronic
939849404 2:147286472-147286494 CTCTGAGCCTTCTAGAAGGAAGG + Intergenic
943232625 2:185274740-185274762 ATGTAATCTTTCAAGAAAGGTGG + Intergenic
943831269 2:192465454-192465476 CTTTCATCCTTCAAGAGTGAAGG - Intergenic
944755417 2:202756618-202756640 CTGTACCCCATCAAGCAGGATGG - Intronic
947394758 2:229675612-229675634 TTGTTATCCTACCAGAAGGATGG + Intronic
947447051 2:230172245-230172267 CTGTCTTCCCTCAGGAAGGATGG + Intronic
948185916 2:236021278-236021300 CTGTCATCCTTTCAAAAGGAGGG - Intronic
949067531 2:242002313-242002335 CTGTACTCGTTTAAAAAGGAAGG - Intergenic
1168742040 20:200274-200296 GACTAATCCTTCAAGAAGGTAGG + Intergenic
1170444964 20:16416983-16417005 CTGTAGTCCCCCAAGAAGGTGGG + Intronic
1170996532 20:21365468-21365490 CTGTAATGCTTCCAGGAGCAAGG + Exonic
1174492342 20:50909239-50909261 CTGTAATCCTACTACTAGGAAGG + Intronic
1180598033 22:16992094-16992116 CTGGAATACTACAAGAATGATGG - Exonic
1181873588 22:25922601-25922623 CAGTAACCCTCCAAGAAGGCAGG - Intronic
1182038872 22:27220592-27220614 CTGTTGTCATTCAAGAAGGATGG - Intergenic
951107186 3:18758395-18758417 CTGTGAACTTTCAATAAGGAAGG + Intergenic
953861915 3:46551724-46551746 CTGTCATCCTTGAAGTAGTAAGG - Intronic
954980802 3:54743700-54743722 CTGTAATCCTTCTTGAGAGATGG + Intronic
955069270 3:55558879-55558901 CTGTGATCCTCCAGGAAGAAGGG + Intronic
955639713 3:61069142-61069164 CTTTAAATCTCCAAGAAGGAGGG + Intronic
959443358 3:106406629-106406651 TTCTTATCCTTCAAGAAGCAGGG - Intergenic
962200443 3:133396809-133396831 ATTTGATCCTTGAAGAAGGAAGG - Exonic
962257359 3:133881538-133881560 CTGTGATCCTTCTAGAAGCTGGG - Intronic
963240679 3:142999749-142999771 CTGTAAGCCTTCCTGGAGGAAGG + Intronic
964359115 3:155875750-155875772 CTGTATTTGCTCAAGAAGGACGG + Intronic
968020303 3:195380519-195380541 CATTTATCCTTCAAGAATGAGGG - Intronic
978218241 4:106234607-106234629 CTGGAATTCTTTAAAAAGGAAGG + Intronic
980457171 4:133059414-133059436 CTGTAATTTGTCAAGCAGGAGGG - Intergenic
982606794 4:157525986-157526008 GTGGAGCCCTTCAAGAAGGAAGG + Intergenic
982788660 4:159565122-159565144 CTGTCATGTTCCAAGAAGGAGGG + Intergenic
983708697 4:170688756-170688778 CTGTCCACCTTCAAAAAGGAAGG + Intergenic
986804132 5:11292353-11292375 CTGGAGTCCTTCTAAAAGGAGGG + Intronic
994784825 5:104144729-104144751 CTGGAATCCATAAAGAAGTATGG + Intergenic
998941454 5:147287484-147287506 CTGTAATAATTAAAGATGGATGG - Intronic
999928080 5:156401387-156401409 CTGTATTCATTCAACAAGGTAGG + Intronic
1000002141 5:157149176-157149198 TTGTAATCCTACAAAAAGGCAGG + Intronic
1000951446 5:167488479-167488501 ATGAAATATTTCAAGAAGGAGGG - Intronic
1002382131 5:178838732-178838754 CTGTCATCCTCCCAGAGGGACGG + Intergenic
1002648594 5:180674533-180674555 CTGTCATCCTCCCAGAGGGACGG - Intergenic
1004945279 6:20605251-20605273 CTCAAATATTTCAAGAAGGAAGG + Intronic
1006597761 6:35205986-35206008 CTGAAAACCTGCAATAAGGAAGG - Intergenic
1006960493 6:37925381-37925403 CTGTAAGACTACAGGAAGGACGG + Intronic
1007026618 6:38582557-38582579 CAGAAACCCTTCAAGAGGGAAGG - Intronic
1008381179 6:50841324-50841346 ATGAAAACCTTCAAGAAAGAGGG - Intronic
1008871606 6:56278838-56278860 CATTACTCTTTCAAGAAGGAAGG - Intronic
1010128862 6:72467830-72467852 CTGTCATCCTTGAAGAAGTCAGG - Intergenic
1010477685 6:76308487-76308509 CTGGACTCCTTCAAGAATCACGG + Intergenic
1012816828 6:104033206-104033228 GTTTAATCCTTGAACAAGGAAGG + Intergenic
1013168063 6:107611309-107611331 CAGTAATCTTTCAGGAAGAAAGG + Intronic
1014206752 6:118664458-118664480 CAGGAATGCTTCACGAAGGAGGG + Intronic
1015859953 6:137665492-137665514 CAGTAATCCTTCAAAGAAGAAGG + Intergenic
1018377559 6:163227562-163227584 CTCTGCTCCTTCATGAAGGACGG - Intronic
1018967934 6:168503198-168503220 CTGTAATCCATCCACATGGAAGG - Intronic
1019404011 7:873387-873409 CTGGAATCCTTCATGGACGAGGG + Exonic
1023682053 7:42697125-42697147 CTGAAATAATTCAAGGAGGAAGG + Intergenic
1023707057 7:42952213-42952235 CTGTAATTCAGCAAGAAGTATGG - Intergenic
1024886064 7:54144224-54144246 TTGTAATCCTCCAAGGAGGGAGG + Intergenic
1028354198 7:89886774-89886796 CTGGAAATCCTCAAGAAGGATGG - Intergenic
1032171035 7:129584774-129584796 CTGTCTGCCTTCAAAAAGGAAGG + Intergenic
1033141358 7:138829828-138829850 AAATAAACCTTCAAGAAGGAGGG - Intronic
1035635003 8:1137991-1138013 CTGTAATCCTACATGATGGGAGG - Intergenic
1035993796 8:4522754-4522776 CAGGACTCCTTCATGAAGGATGG - Intronic
1036489943 8:9215534-9215556 GTCTAATCCTTGAAGAAAGAGGG - Intergenic
1038381467 8:27098674-27098696 TTGTAAACCTGCAAGAAGAATGG - Intergenic
1038526827 8:28281728-28281750 ATGTAATCCTTCATTCAGGAGGG + Intergenic
1038675454 8:29618711-29618733 CTTTAATCCTTCATGAACAATGG - Intergenic
1040660578 8:49570442-49570464 CTGTAACAATCCAAGAAGGATGG - Intergenic
1041302325 8:56425325-56425347 CCGTGATGCTTCAAGAAGGAGGG + Intergenic
1041829882 8:62142539-62142561 CTGTAATTCTTCAGAAAGGGTGG - Intergenic
1041942491 8:63403860-63403882 CTGTAAGCCATCAAGGAGGTTGG + Intergenic
1042574632 8:70204509-70204531 CTGTAATCCTTGTGCAAGGATGG + Intronic
1042911479 8:73831807-73831829 CTGTAATCCTTTGAGAAAGCAGG - Intronic
1043301595 8:78741443-78741465 ATGTCATCCTTCAAAAAAGAAGG + Intronic
1043777430 8:84287450-84287472 CTGAAATCCTCAAGGAAGGAGGG + Intronic
1045379619 8:101610371-101610393 TAGTAATCCTACAGGAAGGAGGG + Intronic
1045747489 8:105440749-105440771 CTGAAGACCATCAAGAAGGAAGG + Intronic
1047285752 8:123485878-123485900 TTGTAAGCCCTCAAGAGGGACGG + Intergenic
1047462523 8:125080759-125080781 CTGTGATTCTTCAGGAAGTAAGG - Intronic
1047749350 8:127868089-127868111 CTGTAGTCCTTCTAGAAGCTAGG + Intergenic
1048056529 8:130871806-130871828 GGGTAATCTTTCAAGAAGCAAGG - Intronic
1048908960 8:139115973-139115995 CTTTGTTCCTTCAGGAAGGATGG + Intergenic
1049741297 8:144242269-144242291 CTGAAATCCTCCCAGAAGAAGGG - Intronic
1050454041 9:5815527-5815549 TTGGAATTCTGCAAGAAGGAAGG - Intronic
1052563561 9:30117138-30117160 CTGAATTCCAACAAGAAGGAAGG + Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1055897064 9:81189893-81189915 TTGAAATGATTCAAGAAGGAAGG - Intergenic
1056031087 9:82554109-82554131 TTGTAATCATTCCAGAAAGAAGG - Intergenic
1057997694 9:99834470-99834492 TTGTTTTCCTTCAAGTAGGAGGG - Intronic
1057997969 9:99837293-99837315 ATGTAAAACTTTAAGAAGGAAGG - Intronic
1061027468 9:128059414-128059436 CTGAGATCCCTCCAGAAGGAAGG + Intergenic
1187505775 X:19877067-19877089 CTGTGATCCATGAAGCAGGATGG - Intronic
1189224501 X:39401451-39401473 CTGGATTCATTTAAGAAGGAGGG + Intergenic
1194895776 X:99437666-99437688 AGGTTAACCTTCAAGAAGGAAGG + Intergenic
1201558598 Y:15291001-15291023 CTGAGATGCTTCAAGAAGGTTGG + Intergenic
1202029528 Y:20557291-20557313 CTATAATCCTTCAATAAGAATGG + Intergenic