ID: 1101441393

View in Genome Browser
Species Human (GRCh38)
Location 12:104706689-104706711
Sequence GGCTCTCAACACCACCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 250}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101441393 Original CRISPR GGCTCTCAACACCACCTGCC TGG Intronic
900076303 1:820560-820582 CGCTATCTACACTACCTGCCTGG + Intergenic
900076473 1:821679-821701 AGCTGTCTACACTACCTGCCTGG + Intergenic
900076581 1:822340-822362 CGCTATCTACACTACCTGCCTGG + Intergenic
900076649 1:822760-822782 CGCTATCTACACTACCTGCCTGG + Intergenic
900076761 1:823425-823447 TGCTATCTACACTACCTGCCTGG + Intergenic
900410883 1:2512129-2512151 GGCTCCCCACACCGCCTGCATGG - Intronic
900420756 1:2555018-2555040 GGCCCTCAGCGCCCCCTGCCAGG - Intergenic
901844687 1:11974544-11974566 GGCCCTCAGCACTGCCTGCCTGG - Intronic
902187816 1:14738639-14738661 CGCTCTAAACATTACCTGCCTGG - Intronic
902293690 1:15451582-15451604 GGCTCTCAGCAGCCCCTTCCAGG - Intergenic
903210313 1:21814594-21814616 GGCGCTCAACACCTCCTCCCCGG + Exonic
904681897 1:32234971-32234993 GGCACTGAGCACCACCTGCCTGG - Intergenic
905140292 1:35838260-35838282 GGAGCTCAAGACCACCAGCCTGG - Intronic
906301820 1:44688015-44688037 GTGTCTCAACCCCACCTCCCTGG + Intronic
906708788 1:47914169-47914191 GGCTCACGACGTCACCTGCCAGG - Intronic
907531613 1:55104559-55104581 GGCTTTCTACACTGCCTGCCTGG + Intronic
909044410 1:70691496-70691518 TGCTCTCAATAAGACCTGCCTGG - Intergenic
912181119 1:107220233-107220255 AGCTCTGACCACCAGCTGCCTGG - Intronic
914222001 1:145689644-145689666 TGCTCTTCACACCACCTGCAAGG + Intronic
914909198 1:151770452-151770474 GGCCCCTAACACCACCTGCAGGG - Intronic
914983489 1:152437143-152437165 GGCTCTCAAGACAGACTGCCTGG - Intergenic
915591286 1:156871997-156872019 GGCCCTCAACGCCAGATGCCCGG + Intronic
917601128 1:176575059-176575081 GGCACTCATCACCTACTGCCTGG - Intronic
920566729 1:206980183-206980205 GGCTCTCCAAACCACCTCTCAGG + Intergenic
921106954 1:211990995-211991017 GGCCATCATGACCACCTGCCTGG - Intronic
921911001 1:220548946-220548968 GGCTTTCACTACCACTTGCCAGG - Intronic
922872629 1:228915661-228915683 TGATCTCATCACCTCCTGCCAGG - Intergenic
922901625 1:229141563-229141585 AGGTCTCAACACCACCTGAATGG + Intergenic
1065813388 10:29463352-29463374 TGGTTTCATCACCACCTGCCAGG + Intronic
1066044896 10:31586420-31586442 GGCTCTCCAGGCCACCTGCTTGG - Intergenic
1067726029 10:48771802-48771824 GGCTCTCAACATCAACTTCTGGG - Intronic
1067806098 10:49394837-49394859 GGCCCTGCCCACCACCTGCCCGG - Intronic
1068171713 10:53403438-53403460 GGTTCTCAACACGGGCTGCCAGG + Intergenic
1070675621 10:78409593-78409615 GGCTCTGGACCCCAACTGCCTGG - Intergenic
1070988936 10:80714683-80714705 GGCCCTCATCACCACCTCACGGG + Intergenic
1072303931 10:94088395-94088417 GTCTGTCAACAGCACCTGCTTGG - Intronic
1072594986 10:96863023-96863045 GGCACCCACCACCACATGCCCGG + Intronic
1073465150 10:103690847-103690869 GACTCTCAACTCCAGCTGTCTGG + Intronic
1074770468 10:116730452-116730474 AGCACTCAACACCCCATGCCTGG - Intronic
1074909273 10:117892795-117892817 GGCTCTCATCAAGTCCTGCCAGG + Intergenic
1075102842 10:119518303-119518325 GGCCCTCTCCAGCACCTGCCAGG - Intronic
1076411695 10:130255985-130256007 GGCTCCCCACACCACATGCATGG - Intergenic
1076550746 10:131276707-131276729 TTTTCTCTACACCACCTGCCAGG + Intronic
1076877968 10:133225854-133225876 GGGGCTCCACACCAGCTGCCTGG - Exonic
1076988492 11:256797-256819 GGCTTTCCACCCCACCTTCCGGG + Intergenic
1079218716 11:18539145-18539167 GGCTCACTGCACCACCTCCCAGG + Intronic
1083401498 11:62426365-62426387 GGATCCCACCACCACCTGCAGGG - Intergenic
1083685052 11:64370705-64370727 GGGTCTCAACGCCACCTTCATGG + Exonic
1084190742 11:67497613-67497635 GGCCTTCCACACCATCTGCCAGG + Exonic
1084775590 11:71372583-71372605 GGCTGACAACACCAACTCCCAGG - Intergenic
1085314546 11:75536471-75536493 GGCTCTCAGCAGCACATGCTGGG + Intergenic
1085386779 11:76162190-76162212 GGGTCTCCCCACCACCTCCCAGG - Intergenic
1086033585 11:82389252-82389274 GCCGCTCACCACCACCTGCCTGG - Intergenic
1086912472 11:92488805-92488827 GGCACTGAAATCCACCTGCCTGG + Intronic
1089328357 11:117672980-117673002 GCCTCCCCAGACCACCTGCCTGG + Intronic
1089328550 11:117674222-117674244 TGCTATCCACAGCACCTGCCAGG - Intronic
1089449314 11:118581238-118581260 TGCTGCCAACAGCACCTGCCAGG - Exonic
1089555904 11:119315936-119315958 GTCACTCGACACCATCTGCCTGG + Intronic
1089991560 11:122865950-122865972 GGCTCTCATCATCTCCTGCATGG + Intronic
1090889219 11:130908069-130908091 GGCACTCACCACCATCTGCAGGG + Exonic
1091035222 11:132227051-132227073 GGCTCTAAACACCACCTGTATGG - Intronic
1091777371 12:3193326-3193348 GACAATCCACACCACCTGCCTGG + Intronic
1092080625 12:5713128-5713150 GGGCCTCATCACCACTTGCCTGG - Intronic
1094492745 12:30971137-30971159 GCCTCTCATCCCAACCTGCCTGG + Intronic
1095925536 12:47575568-47575590 GGCTATCATCACCACCTTCCAGG + Intergenic
1096162749 12:49393886-49393908 GGAGTTCAACACCACCAGCCTGG - Intronic
1096747746 12:53739421-53739443 GGCTCTCACCCTCACCTTCCTGG - Intergenic
1098205860 12:68109166-68109188 AGCTCTGCACACCTCCTGCCTGG + Intergenic
1098330049 12:69343735-69343757 GGCTGCCAAAACCACCTCCCAGG - Intergenic
1100191739 12:92200346-92200368 GGCTCAAAACACCCCCTGCAAGG + Intergenic
1100306501 12:93354752-93354774 CGCTTTCAACACTACCTGTCTGG - Intergenic
1101441393 12:104706689-104706711 GGCTCTCAACACCACCTGCCTGG + Intronic
1102106413 12:110327858-110327880 TGCAGTCATCACCACCTGCCTGG + Exonic
1102257098 12:111422288-111422310 GACTCTTAACACCAAGTGCCTGG - Intronic
1102954810 12:117052607-117052629 GGCTCTCACCACCCCATACCTGG + Intronic
1103320025 12:120087052-120087074 TGCTCTCGGCGCCACCTGCCGGG + Intronic
1104527097 12:129534335-129534357 GGGTATCAACAAAACCTGCCTGG + Intronic
1104732992 12:131118900-131118922 GACCCTCAAGACCACCTGCCTGG - Intronic
1104895963 12:132163742-132163764 GGCTCTGCACAGCACCTACCTGG - Intergenic
1105009179 12:132744086-132744108 AGGTCTCCACACCATCTGCCTGG + Intronic
1111668716 13:91301789-91301811 GGCACTCACCACCACATGCCTGG + Intergenic
1112553319 13:100443378-100443400 AGCTCTCCACAGCAACTGCCTGG - Intronic
1113212809 13:108002512-108002534 GACTCACAATTCCACCTGCCTGG - Intergenic
1113445500 13:110363222-110363244 GGCTCTCAGCTGCAGCTGCCAGG - Intronic
1113468095 13:110525985-110526007 TGCTCCCAACCACACCTGCCGGG + Intronic
1116252031 14:42498754-42498776 CGATCTAAACACCTCCTGCCAGG - Intergenic
1117434351 14:55701971-55701993 GGCTCTCATCACCTCTTCCCTGG - Intergenic
1117647263 14:57865586-57865608 CGCTGTCAACACCGCCTTCCTGG - Intronic
1119191139 14:72682796-72682818 GACTCTCAGCACCAACTTCCCGG - Intronic
1120069344 14:80085540-80085562 GGCTCTCACAACCACCTCCTAGG + Intergenic
1120961996 14:90133673-90133695 GGCTCTGAACTCAACTTGCCTGG - Intronic
1121782003 14:96627972-96627994 GGCTCTCCACACTGCCTGGCAGG + Intergenic
1122799847 14:104224030-104224052 GGGCCTCAACCCCACCTACCCGG + Intergenic
1123028046 14:105437854-105437876 GGGTGTCAGCACCACCAGCCTGG + Intronic
1123062606 14:105601071-105601093 GACTATCAACATCACCTGGCTGG - Intergenic
1125485149 15:40106293-40106315 GGCTCTCCACACCTCTTCCCTGG + Intronic
1127282056 15:57501201-57501223 GGCTCTCAACTCTGGCTGCCTGG + Intronic
1127342190 15:58058912-58058934 GGCTCTAAACAACACTTCCCTGG - Intronic
1127555989 15:60088264-60088286 GTCTCTCATCACCACCTGTTTGG - Intergenic
1128052398 15:64675581-64675603 GGCTCTGAACCCCAGCAGCCAGG + Exonic
1128698680 15:69788230-69788252 GCCCCTCATCATCACCTGCCTGG + Intergenic
1131067434 15:89443162-89443184 GGGTCTGCACATCACCTGCCCGG + Intergenic
1131078711 15:89515705-89515727 GGTACTCAGCACCACCAGCCTGG - Intergenic
1131506766 15:93026471-93026493 AGCTCTCAACACAAGCTTCCGGG - Exonic
1132344613 15:101100800-101100822 GGCTTCCAACTCCCCCTGCCAGG - Intergenic
1132645707 16:998403-998425 GGCTCTGGGCGCCACCTGCCTGG - Intergenic
1133018210 16:2954736-2954758 GGCCCCCAACACCGCCTCCCAGG - Intergenic
1133066392 16:3210430-3210452 TGACCTAAACACCACCTGCCAGG - Intergenic
1133509643 16:6445015-6445037 GGGTCTCATCATCTCCTGCCTGG - Intronic
1135208531 16:20503630-20503652 TGCTACCAAAACCACCTGCCTGG + Intergenic
1135422409 16:22314005-22314027 TTCTCTCAACCCCACCCGCCAGG - Intronic
1135767417 16:25189618-25189640 GGCTCTAAAGCCAACCTGCCTGG - Intergenic
1136231596 16:28888794-28888816 TGCAGTCATCACCACCTGCCTGG + Exonic
1137540319 16:49357222-49357244 GGCTCCCAAAGCCCCCTGCCGGG + Intergenic
1139259634 16:65579243-65579265 GTCTTTCAACTCCCCCTGCCCGG + Intergenic
1139957843 16:70701555-70701577 GGCTGTCAGCATCTCCTGCCTGG + Intronic
1139963920 16:70734918-70734940 GGCTCTGAAGACCAGCTGCCTGG - Intronic
1142328703 16:89435990-89436012 TGCTCTCAGCAGCACCTGCTGGG - Intronic
1142957305 17:3530649-3530671 GTCTCTCGTCACCACCTGCCTGG - Intronic
1143027121 17:3947528-3947550 GGCTGTCATCACTACATGCCTGG - Exonic
1143045486 17:4075516-4075538 GGCTGTCAAGGCCATCTGCCTGG - Intronic
1144284305 17:13758024-13758046 GGCTCTAGAAGCCACCTGCCGGG + Intergenic
1146736375 17:35242491-35242513 GGCTCGGACCAGCACCTGCCAGG - Intergenic
1149571539 17:57675669-57675691 GGATCCCCACACCACCTCCCGGG - Intronic
1150648887 17:66997147-66997169 TTCCCTCAAAACCACCTGCCAGG - Intronic
1151498073 17:74471633-74471655 GGCTCTCAGCAGCAATTGCCAGG - Intronic
1152361488 17:79835083-79835105 GGCGCCCAGCCCCACCTGCCCGG - Exonic
1152406248 17:80099658-80099680 GGCTCTCATCGCCACCATCCTGG + Exonic
1153472536 18:5463139-5463161 GGTTCTCAGCATCTCCTGCCTGG + Intronic
1155190159 18:23422524-23422546 GGCTCTCATCATCTCATGCCTGG + Intronic
1156980153 18:43277257-43277279 GGCTCCGATCACCACCAGCCGGG - Exonic
1157471514 18:47992457-47992479 TGCTCACAACTCCTCCTGCCAGG - Intergenic
1159013583 18:63082729-63082751 TGCCCTCACCCCCACCTGCCAGG + Intergenic
1160700008 19:501694-501716 GCCTCCCGACACCACCTCCCCGG + Exonic
1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG + Exonic
1160700025 19:501742-501764 GTCTCCCGACACCACCTCCCAGG + Exonic
1160700032 19:501766-501788 GCCTCCCGACACCACCTCCCCGG + Exonic
1160933083 19:1579831-1579853 GGATCTCAACTCCGCCTCCCAGG + Intronic
1161182998 19:2898086-2898108 GAGGCTAAACACCACCTGCCGGG + Intergenic
1161478369 19:4498580-4498602 GCCTCCACACACCACCTGCCGGG - Intronic
1161717035 19:5882102-5882124 GCCCCTCATCACCACCTCCCAGG + Intronic
1162058240 19:8078435-8078457 GCCTCACACCACCATCTGCCTGG + Intronic
1162364935 19:10242827-10242849 GGTTCTCGCCAACACCTGCCTGG + Intergenic
1163296675 19:16417218-16417240 GGCTCTGCCCACGACCTGCCTGG + Intronic
1163296684 19:16417259-16417281 GGCTCTGCCCACGACCTGCCTGG + Intronic
1163418299 19:17200379-17200401 GGCTTCCAGCACCACGTGCCCGG - Exonic
1164627190 19:29737503-29737525 GGCTCCCAGGACCACATGCCAGG + Intergenic
1165333803 19:35155422-35155444 GGCTTCCAAGACCCCCTGCCAGG - Exonic
1165819402 19:38665102-38665124 TGCTCTCAACACCCCCTCCCGGG - Intronic
1167284017 19:48588757-48588779 GGCTCCCACCATCACCTCCCGGG - Intronic
1167485735 19:49761976-49761998 GGCCCTCCACACCACCCGCTGGG - Intronic
1167512577 19:49903549-49903571 GGCTCTCCACAGAACCTCCCAGG - Intronic
1167610729 19:50506649-50506671 GGCCCTCACCACCACCAGCCTGG - Intronic
925190191 2:1876323-1876345 GTCTGTCAACACCTACTGCCTGG + Intronic
927278883 2:21286418-21286440 GGCCATCTACACCACCTCCCTGG - Intergenic
927885049 2:26713139-26713161 TGCCCTCACCACCATCTGCCAGG - Intronic
932496259 2:72147330-72147352 GGCGCTCCACGCCCCCTGCCAGG + Intronic
933759101 2:85662028-85662050 GGATGCCCACACCACCTGCCAGG - Exonic
935172722 2:100623164-100623186 TGCTCTCAACACCTCCTGTGAGG + Intergenic
936970846 2:118175091-118175113 GGCACTCATCACCACCAGCTTGG - Intergenic
937980017 2:127609302-127609324 GGCTCTCTACACACCCTGCCGGG - Intronic
938072627 2:128316656-128316678 GGCTCAGAACATCACCTCCCAGG + Intronic
942119867 2:172766002-172766024 GGCTTTCAACACCACAGTCCAGG - Intronic
943766131 2:191664488-191664510 GGTCCTCAAGACCACCTACCAGG - Intergenic
945437917 2:209840573-209840595 GGTCCTCCACACCATCTGCCAGG - Exonic
946171443 2:217898325-217898347 GGCTCCCAACACTGGCTGCCTGG + Intronic
947300350 2:228682260-228682282 GGCTTCCAAGACCACCTCCCTGG - Intergenic
947592679 2:231394498-231394520 GGCTCTGAACCCTTCCTGCCTGG - Intergenic
947708161 2:232293071-232293093 GGCCCTAATCACCACCTGCAGGG - Intronic
948420744 2:237858945-237858967 GGCCCTCACAACCTCCTGCCAGG + Intronic
1171750340 20:29043149-29043171 GGCTCCGAACACCAGATGCCAGG - Intergenic
1172272397 20:33662220-33662242 GGCTCTGAGCACCGCCTTCCAGG - Intronic
1173362785 20:42359694-42359716 GCCTCTGAACAGCATCTGCCAGG + Intronic
1173662564 20:44744763-44744785 GGCGCCCAACTCCACCTCCCCGG + Intergenic
1175460966 20:59151633-59151655 GGCTTTCAACACCAGCTCCTGGG + Intergenic
1178440346 21:32593335-32593357 TGCACATAACACCACCTGCCAGG - Intronic
1179002644 21:37477557-37477579 GGCTCTCGACACCATCTGACAGG - Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179842637 21:44087299-44087321 GGCTCTCAACAGCACCTGCAAGG - Intronic
1179995643 21:44972818-44972840 GCGTCTCCACCCCACCTGCCTGG - Intronic
1180996460 22:19968185-19968207 GGCCCTCAACACCCAGTGCCAGG - Intronic
1181146438 22:20851411-20851433 AGCTCACCACACCACCTCCCGGG + Intronic
1181555813 22:23671158-23671180 GGCTCACAACACCTCCCACCCGG - Intergenic
1182297669 22:29319101-29319123 GGCTCCTAACACCAGCTACCTGG + Intronic
1182431350 22:30300768-30300790 AGCTCCCAACATCACCAGCCTGG + Intronic
1184207284 22:43013584-43013606 GGCATTCAACACTGCCTGCCTGG + Intronic
1184583669 22:45433720-45433742 GCCTCCCCACACCTCCTGCCTGG - Intergenic
1184731964 22:46375459-46375481 GGGTCTCCACCCCACCTCCCAGG + Intronic
1184742502 22:46437220-46437242 GGGTCTGAAGACCCCCTGCCCGG - Intronic
1184877826 22:47286629-47286651 GGCACTCCACCCCACCTCCCCGG - Intergenic
950012636 3:9733940-9733962 GGCCCTCATCACCTCTTGCCTGG - Intronic
954272629 3:49521653-49521675 GGCACTAAACACCATCAGCCTGG - Intronic
954376432 3:50196288-50196310 GGCTCTCAGCTTCCCCTGCCAGG - Exonic
954689610 3:52388697-52388719 GGCTGTCCACACCCCCTCCCTGG + Intronic
954859036 3:53671986-53672008 GGTTCTTAACACCTCCTTCCTGG + Intronic
955354759 3:58222245-58222267 GGCTCCCAACAATTCCTGCCTGG - Intergenic
955669437 3:61387945-61387967 GGCTCCAAACACCTCCTACCAGG - Intergenic
960810257 3:121621510-121621532 GGAACCCAACACCTCCTGCCTGG + Exonic
962198121 3:133380503-133380525 GGCACCCACCACCACCTCCCTGG + Exonic
963141927 3:141953377-141953399 GGCTCTCAACACCACAGTCCAGG - Intronic
964041755 3:152269243-152269265 GTCCCTCAGCACCTCCTGCCCGG + Intronic
964533851 3:157698078-157698100 GGCTCTCTACCTCAACTGCCAGG + Intergenic
964792295 3:160463622-160463644 GGCTTTCCACAGCACCAGCCAGG + Intronic
967567768 3:190991799-190991821 GGTACTCAACAACACCTGACAGG + Intergenic
968067150 3:195764961-195764983 TGATCTCAACCCCACCTTCCCGG - Intronic
968214381 3:196875928-196875950 GGATTTCAAGATCACCTGCCTGG - Intronic
968313147 3:197700739-197700761 GGCTCTCCCCACCTCCTTCCTGG + Exonic
968550056 4:1217459-1217481 GTCTGTCAACGCCCCCTGCCAGG + Intronic
968672337 4:1858240-1858262 GGCAGTCACCACCTCCTGCCTGG - Intergenic
968950259 4:3687827-3687849 GGCTCACGCCACCACCTGCCTGG - Intergenic
969084192 4:4643214-4643236 GGCTCTAGAGGCCACCTGCCTGG - Intergenic
969306445 4:6328692-6328714 GTCTCTCAACCCCACCTGCCTGG - Intronic
970918743 4:21367991-21368013 AACTCTCAACACCTCTTGCCAGG + Intronic
971019131 4:22516268-22516290 GGCTCCCCACAACTCCTGCCCGG - Intergenic
973198708 4:47475922-47475944 GCCTCTCAACTCTGCCTGCCTGG + Intergenic
973871490 4:55171060-55171082 GGCTCACCGCACCACCTCCCAGG - Intergenic
977666802 4:99652707-99652729 GGCTCTGAACATCAGCTCCCGGG - Exonic
980806687 4:137824586-137824608 GGCTTTGAAAACCACCTGGCTGG - Intergenic
982450984 4:155552299-155552321 AGCCCTCCACACCAGCTGCCTGG + Intergenic
985432255 4:189892783-189892805 GGCTCCAAACACCAGATGCCGGG - Intergenic
986096157 5:4555851-4555873 TGCTCTCATCAGCTCCTGCCAGG + Intergenic
992879962 5:81098027-81098049 GGCTCTCAACATCTCTCGCCTGG - Intronic
997456627 5:134022229-134022251 TGCTCTAAACACCAGCTCCCTGG + Intergenic
997947307 5:138213847-138213869 TGCTCTCACCCCCACCTCCCCGG - Intergenic
999453883 5:151698806-151698828 GGTTCTCATCACCCACTGCCTGG - Intergenic
1002426788 5:179181335-179181357 GGCTGCCACCACCACCTGCTGGG + Intronic
1002605411 5:180380209-180380231 GGCTCTCCAAGCCACCTCCCCGG - Intergenic
1003282845 6:4709338-4709360 GGCACTCACCACCCCATGCCCGG + Intronic
1004409009 6:15362955-15362977 CCCTCTCCACACCACCTTCCTGG - Intronic
1004708017 6:18142488-18142510 GCCTCGCAACAGCACATGCCGGG + Intronic
1010790681 6:80061277-80061299 GGCCCTCAGCAATACCTGCCAGG - Intergenic
1011132037 6:84061643-84061665 GGCTCTTACCACTACCTGGCTGG - Intronic
1011727602 6:90226130-90226152 GGCTCTCACCTCCAGATGCCTGG - Intronic
1013311866 6:108902006-108902028 CCCTCTCAGCACCTCCTGCCAGG + Intronic
1014009405 6:116459038-116459060 GTCTCTAAACACCACCTCCTGGG - Intergenic
1014776138 6:125511885-125511907 GCCTCTAAACTCCACCTTCCTGG + Intergenic
1017706078 6:157123934-157123956 GGCTCTGCAGACCAACTGCCTGG - Intronic
1017719822 6:157236451-157236473 CGCCTTCAACAGCACCTGCCAGG + Intergenic
1018579185 6:165293222-165293244 GGCAGTCACCACCACGTGCCAGG + Intronic
1018824463 6:167398681-167398703 TGCACACAGCACCACCTGCCAGG - Intergenic
1019430708 7:997668-997690 GGCTCTGATCCCCCCCTGCCGGG - Exonic
1019831613 7:3336317-3336339 CGCTGTCAGCACCACCTGACAGG - Intronic
1022961350 7:35429775-35429797 CCCTCCCAAGACCACCTGCCTGG + Intergenic
1023793458 7:43771804-43771826 GGTGCTCAGCACCACCCGCCAGG + Intronic
1026439654 7:70432964-70432986 GGCTCCCCACACAACATGCCGGG - Intronic
1031026884 7:116689199-116689221 GACACTTAAAACCACCTGCCAGG + Intronic
1031900322 7:127402007-127402029 GGCACACACCACCACCTCCCTGG - Intronic
1032162860 7:129524003-129524025 GGCTCTCAACCCCAGCACCCTGG + Intergenic
1035376400 7:158409684-158409706 GGCTTTCAACCTCACCTGCCAGG + Intronic
1035533664 8:375013-375035 CGCTATCTACACTACCTGCCTGG - Intergenic
1035946858 8:3973233-3973255 AGCTCTCACTCCCACCTGCCAGG - Intronic
1036644079 8:10601294-10601316 GCCTCTCACCACCCCCAGCCAGG - Intergenic
1038531323 8:28320183-28320205 TGCTATCTACTCCACCTGCCAGG - Intronic
1040873569 8:52126013-52126035 GGCTGTCACCACCTCCTGCAGGG - Intronic
1043517098 8:81004940-81004962 GGCTCTATACAGCACCTTCCTGG - Intronic
1046986558 8:120394861-120394883 GGCTTTCAAGTCCAACTGCCTGG + Intronic
1049321047 8:141996596-141996618 GGCTCTCAACGGCACCCACCGGG + Intergenic
1056396556 9:86186756-86186778 GGCCCTGATCACCACCTGCCTGG + Intergenic
1057015142 9:91644717-91644739 GCCCCTCAACACCACCTTCAAGG + Intronic
1057182066 9:93035638-93035660 GGCCTCCAACACCACCTCCCAGG - Exonic
1059507368 9:114812171-114812193 GTCTGGCAACATCACCTGCCTGG - Intergenic
1059762058 9:117347364-117347386 TGCTCTCACCACCACCTGGGAGG + Intronic
1061232057 9:129320822-129320844 GGCTCTCATCTCCGCCAGCCAGG - Intergenic
1062630752 9:137462061-137462083 GGCTCCCCACACCTCCTGACGGG - Intronic
1186777243 X:12877509-12877531 GGCTCTCCACACCGGCTGCACGG - Intronic
1189969983 X:46408293-46408315 GGCTGGCACCACCAGCTGCCTGG - Intergenic
1192245760 X:69370268-69370290 GTCTCTCAACGCCTCCAGCCTGG - Intergenic
1195004501 X:100672578-100672600 GGATTTCAACACCAGCAGCCTGG + Intergenic
1198010615 X:132549872-132549894 TGCTGTCTACACTACCTGCCTGG + Intergenic
1200074691 X:153545127-153545149 GGATCCCAACCCCAACTGCCTGG + Intronic