ID: 1101442487

View in Genome Browser
Species Human (GRCh38)
Location 12:104714044-104714066
Sequence CTGAGCTATGCTTAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101442487_1101442494 16 Left 1101442487 12:104714044-104714066 CCTCCCACCTAAGCATAGCTCAG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1101442494 12:104714083-104714105 CATTACATGTCCAGTATGGTGGG 0: 1
1: 0
2: 1
3: 3
4: 84
1101442487_1101442493 15 Left 1101442487 12:104714044-104714066 CCTCCCACCTAAGCATAGCTCAG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1101442493 12:104714082-104714104 CCATTACATGTCCAGTATGGTGG 0: 1
1: 0
2: 0
3: 3
4: 112
1101442487_1101442491 12 Left 1101442487 12:104714044-104714066 CCTCCCACCTAAGCATAGCTCAG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1101442491 12:104714079-104714101 TGACCATTACATGTCCAGTATGG 0: 1
1: 0
2: 0
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101442487 Original CRISPR CTGAGCTATGCTTAGGTGGG AGG (reversed) Intronic
900317529 1:2066325-2066347 CTGGGCTTTGCTTTGTTGGGAGG + Intronic
901073512 1:6536582-6536604 CTGTGGGAGGCTTAGGTGGGAGG + Intronic
901199323 1:7457806-7457828 CAGAGCTCTGCTCAGGAGGGAGG - Intronic
902037034 1:13465343-13465365 CTGAGCTGTGGATGGGTGGGTGG - Intergenic
902722622 1:18314260-18314282 CTGGGCTATGCTTATGAGGAAGG - Intronic
902921176 1:19666629-19666651 CGGAGCTATCCTGTGGTGGGTGG - Intronic
903450175 1:23448286-23448308 TTGAGCCACGCTTAGGTGGCAGG + Intronic
903893180 1:26583830-26583852 CTGAGAAAAGCTGAGGTGGGAGG + Intergenic
904362354 1:29984641-29984663 CAGAGCCCTGCCTAGGTGGGAGG + Intergenic
906364529 1:45195474-45195496 CTTTGGGATGCTTAGGTGGGAGG - Intronic
906561222 1:46758465-46758487 CTGAGGAATGCATTGGTGGGAGG + Intronic
908576866 1:65469166-65469188 CTGAGCTATGCTGAGTCCGGTGG + Intronic
909663656 1:78110617-78110639 CTGAGAGTTGCCTAGGTGGGAGG + Intronic
911363561 1:96909476-96909498 ATGAGGGATGCTTTGGTGGGAGG + Intergenic
912019002 1:105080801-105080823 CTGAGTGATGCTTAGGTTTGAGG + Intergenic
912374798 1:109201376-109201398 CTGAGCAATTCTGAGCTGGGAGG + Intronic
915128203 1:153680062-153680084 CCGAGCTGTGCTAGGGTGGGAGG - Intronic
918199775 1:182256115-182256137 CCCAGCTAGGCTGAGGTGGGAGG + Intergenic
918204098 1:182293977-182293999 CAGACGGATGCTTAGGTGGGAGG - Intergenic
918227807 1:182501877-182501899 CTGAGCTTTTCTTTGTTGGGTGG + Intronic
921192562 1:212723769-212723791 CTGAGCTGGGCTTAGCTGGATGG - Intergenic
922925596 1:229344324-229344346 TTTAGCTATGATGAGGTGGGCGG - Intergenic
924389156 1:243532777-243532799 CTGGGCTTTTCTTTGGTGGGAGG + Intronic
924463823 1:244282851-244282873 CTGAGCTATGCTTGTGAAGGTGG - Intergenic
1064479009 10:15720953-15720975 CTGTGGGAGGCTTAGGTGGGAGG - Intergenic
1065225045 10:23534952-23534974 CTGACATATGCTAGGGTGGGCGG + Intergenic
1065451187 10:25859240-25859262 CTGAGCTTTTCTTTGTTGGGAGG - Intergenic
1069447753 10:68489575-68489597 TTGAGTAATGCTTAGTTGGGAGG - Intronic
1071430745 10:85604480-85604502 CTGAGCTCTGCTTGTGTGGGTGG - Intronic
1071584660 10:86808008-86808030 ATGAGTTCTGCTGAGGTGGGTGG - Intronic
1072837256 10:98728762-98728784 CTTTGCTAGGCTGAGGTGGGAGG + Intronic
1075696486 10:124439695-124439717 CTGTGCCAGGCTGAGGTGGGAGG - Intergenic
1078883305 11:15474924-15474946 CTGAAGGATGCTTAGGTAGGTGG - Intergenic
1079503803 11:21132334-21132356 CTGAGCAATACTTAGACGGGAGG - Intronic
1083644277 11:64163712-64163734 CTGAGAGAAGCTTAGCTGGGTGG - Intronic
1085299587 11:75450353-75450375 CTGTGCCATGCTGAGGTGGCAGG - Intronic
1089106839 11:116015894-116015916 CTGAGCTTTCCTTTGTTGGGAGG + Intergenic
1089228565 11:116948518-116948540 CTTTGGTATGCTGAGGTGGGAGG - Intronic
1089280634 11:117371909-117371931 CTGAACTATGATGAGGTAGGAGG - Intronic
1090019592 11:123115882-123115904 CTGAGCATGGCTTAGCTGGGTGG + Intronic
1091140109 11:133227587-133227609 CTGAGCAATTCTTAGGTTGCTGG - Intronic
1091237531 11:134032076-134032098 GTGAGCCATGCTTGGGTGGAAGG + Intergenic
1093305982 12:17519532-17519554 ATGAGCTAGGGTTAGGTGTGTGG + Intergenic
1094281808 12:28748301-28748323 GGAAGCTGTGCTTAGGTGGGAGG - Intergenic
1096183319 12:49563210-49563232 CTGGGGGATGCTGAGGTGGGAGG - Intronic
1098364734 12:69690451-69690473 CTGAGCTGTGCTCAGGTCTGAGG - Intronic
1098928800 12:76384877-76384899 CTGAGAGCTGCTTAGTTGGGTGG - Intronic
1100335603 12:93626288-93626310 GTGAGCTGTGCTAAGGGGGGAGG - Intergenic
1100392519 12:94156429-94156451 CTGAGGCATACTCAGGTGGGAGG - Intronic
1100524091 12:95403964-95403986 ATGAGCCATCCTGAGGTGGGGGG - Intergenic
1101043917 12:100785156-100785178 GGGAGCTATGCATATGTGGGAGG - Intronic
1101442487 12:104714044-104714066 CTGAGCTATGCTTAGGTGGGAGG - Intronic
1101503136 12:105322403-105322425 CTGGGCTGGGCTTAGCTGGGTGG - Intronic
1102313636 12:111867594-111867616 CTGAACTATGTTTGGGTGTGTGG - Exonic
1102741259 12:115209438-115209460 CAGAGCTGTGCGTAGCTGGGTGG + Intergenic
1102903271 12:116655647-116655669 ATGAGCTCAGCTTAGGTGGCTGG - Intergenic
1103944575 12:124518848-124518870 CAGAGCTACGCTCAGGTTGGAGG - Intronic
1105561893 13:21500018-21500040 CTGAGCTTTGCTGCAGTGGGAGG - Intronic
1108025226 13:46170497-46170519 CTGAGCGCTGCTGAGGTGGGAGG + Intronic
1108353581 13:49609478-49609500 CTCAGCTAGGCTGAGGTGGGAGG - Intergenic
1108439330 13:50434003-50434025 CTGAGCTTTTCTTTGCTGGGAGG + Intronic
1111819460 13:93195157-93195179 CTAAGCATTGCTTAGGTAGGAGG - Intergenic
1112121913 13:96422226-96422248 CTGAGCTATTCTGAGTTGAGTGG + Intronic
1112718682 13:102216754-102216776 CTAAGCTATGGTTAGATAGGAGG - Intronic
1112990735 13:105510566-105510588 CCGATCTCTGCTTATGTGGGAGG + Intergenic
1115632916 14:35263441-35263463 CTTTGCTAGGCTGAGGTGGGTGG + Intronic
1115857089 14:37642122-37642144 CAGATCTCTGCTTTGGTGGGAGG + Intronic
1122256744 14:100483742-100483764 CTGGGCTGAGCTTAGATGGGTGG - Intronic
1123063276 14:105604040-105604062 CTGAGCCAAGCTTAGCTGGTTGG - Intergenic
1123087338 14:105722826-105722848 CTGAGCCAAGCTTAGCTGGTTGG - Intergenic
1124154040 15:27209615-27209637 CTGGGCTGTGCCCAGGTGGGTGG + Intronic
1124497672 15:30196252-30196274 CTGCGCGAGGCTTGGGTGGGAGG + Intergenic
1124745914 15:32342439-32342461 CTGCGCGAGGCTTGGGTGGGAGG - Intergenic
1125513900 15:40307508-40307530 CGGGGCTTTGCTTGGGTGGGAGG - Intronic
1128335403 15:66782490-66782512 CTGAGCTATTTTTGGCTGGGGGG - Exonic
1129321656 15:74778336-74778358 CTCAGCCAGGCTGAGGTGGGAGG - Intergenic
1129483278 15:75844010-75844032 CTGCGCGAGGCTTGGGTGGGAGG + Intronic
1131116872 15:89801395-89801417 CTGAGGCATGGTCAGGTGGGTGG - Intronic
1132186705 15:99806989-99807011 CTGCGCGAGGCTTGGGTGGGAGG + Intergenic
1132247212 15:100306892-100306914 GTGGGCTATGCTTAGGTGAAAGG - Intronic
1132428982 15:101745722-101745744 CTGCGCGAGGCTTGGGTGGGAGG - Intergenic
1132744339 16:1430480-1430502 CTGAGCTCTGGGCAGGTGGGCGG + Intergenic
1133305871 16:4808351-4808373 CTTAGGTAGGCTGAGGTGGGTGG + Intronic
1135234220 16:20740958-20740980 ATGAGCAATCCTTAAGTGGGAGG + Intronic
1135548909 16:23383620-23383642 CTGAGGGAGGCTGAGGTGGGAGG - Intergenic
1137441567 16:48502949-48502971 CTGTGCTATGCTGAGGCTGGTGG - Intergenic
1137689891 16:50416860-50416882 CTGAGCTTTTCTTTGTTGGGAGG + Intergenic
1138367607 16:56494209-56494231 CTTTGCGATGCTGAGGTGGGAGG - Intronic
1139489878 16:67280373-67280395 CTGTGCCAAGCTGAGGTGGGAGG - Exonic
1142858762 17:2748942-2748964 CTCAGCTTTGCTGAGGTGGAGGG - Intergenic
1143571498 17:7761726-7761748 CTGAGGGAGGCTAAGGTGGGTGG - Intronic
1143802568 17:9396465-9396487 CTGAGGTCAGCTGAGGTGGGCGG + Intronic
1144176816 17:12715416-12715438 CTGAGCTATGCACAGTAGGGAGG - Intronic
1144288489 17:13803002-13803024 CTGATCTGTGCTTTGGTGGGCGG - Intergenic
1144443849 17:15308651-15308673 CTCAGCTACGGTAAGGTGGGAGG - Exonic
1146682457 17:34817948-34817970 CTGAGCTAGACATAGGAGGGAGG - Intergenic
1148851127 17:50555862-50555884 CTCAGCTTTGCTTATGAGGGAGG + Intergenic
1148911719 17:50946576-50946598 CTGAGCCAGGCTCTGGTGGGAGG - Intergenic
1149017961 17:51930870-51930892 CTGTGGTATTCCTAGGTGGGAGG + Intronic
1151196633 17:72436301-72436323 CTGTGGGAGGCTTAGGTGGGAGG - Intergenic
1151296045 17:73186841-73186863 CTGAGCCATGAATAGCTGGGCGG + Intergenic
1151537214 17:74745727-74745749 CTTTGTTATGCTTAGGAGGGAGG - Exonic
1152263195 17:79278302-79278324 CTCAGCTATTCTGAGGAGGGGGG - Intronic
1155612638 18:27684208-27684230 CTGAGGTATGCTTGTGTAGGAGG - Intergenic
1157402454 18:47399868-47399890 CTGACCCATGCTGAGGTAGGGGG - Intergenic
1157798888 18:50602452-50602474 CTGAGCTAGGCTCAGGGGGCAGG - Intronic
1160094724 18:75860964-75860986 CTGAGCCTGGCTGAGGTGGGGGG + Intergenic
1163020412 19:14478311-14478333 CTGAGCTAGGCTCAGGCTGGAGG + Exonic
1163829603 19:19541372-19541394 CTGAGCGATGCCTAGAGGGGAGG + Intronic
1164061475 19:21679244-21679266 CTGATCTCTGCTCAGGTGTGAGG + Intergenic
1164109319 19:22140251-22140273 CTGATCTCTGCTCAGGTGTGAGG + Intergenic
1166186896 19:41145727-41145749 CTTAGCGAGGCTGAGGTGGGTGG - Intergenic
1167513223 19:49907955-49907977 CTGAGCCAGGATGAGGTGGGTGG + Intronic
928916932 2:36482073-36482095 CTGAGCTCTGTTGAGGTGGAGGG - Intronic
930041246 2:47126432-47126454 CTCAGCGAGGCTAAGGTGGGAGG - Intronic
930691071 2:54365203-54365225 CTGAGCTATGCACAGGAGTGGGG + Intronic
931671217 2:64649820-64649842 CTGAGCTATGCGGAGGCGTGGGG - Intronic
932076542 2:68669643-68669665 CTGGGGTAGGCTGAGGTGGGTGG - Intergenic
932598370 2:73108049-73108071 CTGAGACCTCCTTAGGTGGGTGG - Intronic
935286693 2:101570664-101570686 CTGGGCTTTGCTTTGCTGGGAGG + Intergenic
936230194 2:110693832-110693854 TTGACCTATTCGTAGGTGGGAGG - Intergenic
939580366 2:143939281-143939303 CTGTGCTATTCTTTGGTGGGTGG - Exonic
941876227 2:170436226-170436248 ATGAGCAATGCTTAGCTGGGAGG + Intronic
943069507 2:183124321-183124343 CTGCGCTATGCTTAAGTTGTAGG - Intronic
948280874 2:236747198-236747220 CAGAGAAATGCTTAGGTGAGGGG - Intergenic
1169461409 20:5798859-5798881 CTGAGGGAGGCTGAGGTGGGCGG - Intronic
1170749038 20:19128722-19128744 CTGAGCTTTTCTTTGTTGGGTGG + Intergenic
1172976837 20:38912422-38912444 CTGAGGGAGGCTGAGGTGGGAGG + Intronic
1174393140 20:50230408-50230430 TTGAGCTGAGCTGAGGTGGGTGG - Intergenic
1175136562 20:56828709-56828731 CTCAGCTGTGCTTGGCTGGGTGG - Intergenic
1175186682 20:57183704-57183726 GGCAGGTATGCTTAGGTGGGAGG - Exonic
1175427287 20:58876540-58876562 CTGAGTCATGCTTGGGTGGGGGG - Intronic
1177294604 21:19158586-19158608 CTTTGGTATGCTAAGGTGGGTGG + Intergenic
1179094359 21:38299088-38299110 CTGATCTATACTTAGGTGGTCGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1183482126 22:38070877-38070899 CTGAGCTATACAAAGGTGGGTGG + Exonic
1184425527 22:44406991-44407013 CTGAGCCCTGCTAAGCTGGGAGG + Intergenic
1185094030 22:48796281-48796303 CTGAGCTGTCCTTAGTTGAGTGG + Intronic
950171904 3:10844513-10844535 CTGAACTGTCCTGAGGTGGGCGG - Intronic
950579460 3:13852965-13852987 CTGAGCTTTCCTGAGATGGGAGG + Intronic
951359860 3:21712367-21712389 ATGGGCTATGCTAGGGTGGGTGG - Intronic
957066006 3:75522847-75522869 ATGAGCTGTGCCTATGTGGGGGG - Intergenic
959943255 3:112101798-112101820 CTGAGAAAGGCGTAGGTGGGAGG - Intronic
962368474 3:134801771-134801793 CTTAACTATGCTTGGGTGGGGGG + Intronic
963498885 3:146100122-146100144 CTTTGCAAGGCTTAGGTGGGTGG - Intronic
968321521 3:197773207-197773229 ATGTGCTATGCTTCGGAGGGAGG + Intronic
969496715 4:7530401-7530423 CTGAGCTATGCTGAGCTCAGGGG - Intronic
971343129 4:25788895-25788917 CTGAGCTCTGCTGGGTTGGGGGG - Intronic
972488283 4:39562885-39562907 CTTTGCGAGGCTTAGGTGGGTGG - Intronic
974351752 4:60756485-60756507 CTGGGCTTTCCTTTGGTGGGAGG + Intergenic
974442133 4:61932804-61932826 CTGAGCTTTTCTTTGTTGGGAGG + Intronic
977739291 4:100458224-100458246 CTGAGCTTTTCTTTGTTGGGAGG + Intronic
979138499 4:117142022-117142044 CAAAGCTATGGTTAGATGGGAGG + Intergenic
979673552 4:123386076-123386098 CTGAGCTTAGCTTTGGTGGATGG - Intergenic
981312848 4:143313723-143313745 CTGAGCTAGGCTTTGATGGGTGG - Intergenic
982203177 4:152977549-152977571 CTGAGGGAGGCTGAGGTGGGAGG - Exonic
983629578 4:169836456-169836478 CTTAGAGAGGCTTAGGTGGGAGG + Intergenic
985833387 5:2252164-2252186 CTGAGCCCTGCTTTAGTGGGAGG + Intergenic
987086518 5:14474769-14474791 CTGAGAGATGCTGAGGCGGGAGG - Intronic
990237122 5:53780357-53780379 CTGAGCTATGCTTAGGTATGAGG + Intergenic
992710349 5:79446895-79446917 CTTTGATAGGCTTAGGTGGGAGG - Intronic
994914490 5:105956592-105956614 CTTTGCTATGCTTGTGTGGGTGG + Intergenic
996781911 5:127196944-127196966 CTGAGCTTTTCTTTGTTGGGAGG - Intergenic
997651672 5:135526404-135526426 CTGAGGTAGGCTGAGGTGGGAGG + Intergenic
1001150063 5:169219572-169219594 CTGAGCTGTGCAGAGGTGGCAGG + Intronic
1003350639 6:5314365-5314387 ATGAGTTGAGCTTAGGTGGGTGG + Intronic
1008125556 6:47664259-47664281 GAGAGCTAAGCCTAGGTGGGTGG - Intronic
1010857887 6:80865431-80865453 CTGAGCTTTTCTTTGATGGGAGG - Intergenic
1011367210 6:86596107-86596129 GTGAGTTTTGCTTAGGAGGGAGG - Intergenic
1013893944 6:115062380-115062402 CTGAGCTATTCTTTGCTGGAAGG + Intergenic
1014322073 6:119942519-119942541 CAGAGGTATGCCTAGGTGTGTGG + Intergenic
1015155491 6:130090702-130090724 CTCAGTTATGCTGAGGTGGGAGG - Intronic
1016246385 6:141986206-141986228 CTTTGGTAGGCTTAGGTGGGAGG - Intergenic
1019707313 7:2502784-2502806 CTGAGCAATGCTGGGGTGAGGGG + Intergenic
1021289304 7:18823436-18823458 TTTAGATATGCTTAGGTGCGGGG + Intronic
1022172977 7:27847231-27847253 CTGTGGGATGCTGAGGTGGGTGG - Intronic
1022384827 7:29890893-29890915 CTGCCCTGTGCTCAGGTGGGGGG + Intronic
1023638404 7:42236446-42236468 CCGGGCTATGCTTCGGAGGGCGG - Intronic
1023759838 7:43455053-43455075 CTGAGCTGGGGTGAGGTGGGTGG - Intronic
1024541952 7:50482107-50482129 GTGAGCTATGTTAAGGTTGGAGG + Intronic
1025818616 7:64943036-64943058 CTGATCTCTGCTCAGGTGTGAGG - Intergenic
1030045304 7:105489873-105489895 CTGTGGGATGCTGAGGTGGGTGG + Intronic
1031923701 7:127619507-127619529 CTTAGCCATGCTTGGGTGGGAGG + Intergenic
1032678962 7:134162199-134162221 CTGAGCCAGGCTCAGCTGGGAGG + Intronic
1033223343 7:139543109-139543131 CTAAGCCATCCTCAGGTGGGAGG - Intronic
1033497722 7:141916536-141916558 CTGAGCTATGCTCAGGAGACAGG - Intronic
1034284732 7:149877296-149877318 CAAAGCTAGGCTGAGGTGGGAGG - Intronic
1036491698 8:9232415-9232437 CTGAGCTATGCTTTAGAAGGCGG - Intergenic
1037298975 8:17431626-17431648 CTCAGCAAGGCTGAGGTGGGAGG + Intergenic
1037521553 8:19684765-19684787 CTGAGCTCTTTTTAGGTGGTTGG - Intronic
1037686458 8:21143653-21143675 ATGAGGTAGGGTTAGGTGGGTGG - Intergenic
1037812759 8:22096629-22096651 CTGGGCCAGGCTGAGGTGGGCGG + Intronic
1040339814 8:46434827-46434849 CTGGGGTATTCTTAGATGGGAGG + Intergenic
1041659180 8:60384464-60384486 CTGTGCGAGGCTGAGGTGGGCGG - Intergenic
1042560845 8:70071265-70071287 CTGAGCCAGGCTTAAGAGGGCGG + Exonic
1042839075 8:73105680-73105702 CTGAGCTGTGGTTAGGGTGGAGG - Intronic
1044557165 8:93575681-93575703 ATCAGCTCTGCTTAGGTTGGTGG - Intergenic
1046487988 8:114910583-114910605 CTTTGCTAGGCTGAGGTGGGCGG + Intergenic
1047327038 8:123849671-123849693 CTGAGCTGTGCATAAGTGGCAGG - Intergenic
1048802333 8:138206053-138206075 CTGAACTATGCATAGATGGCGGG - Intronic
1048803370 8:138215783-138215805 CTGAGCCATTCATGGGTGGGAGG - Intronic
1048854451 8:138674359-138674381 CTGAGCTAAGCAAAGGTGTGTGG - Intronic
1048862061 8:138730866-138730888 CTGAGCCATGGCTAGATGGGAGG + Intronic
1049142121 8:140964333-140964355 CTGAGGGAGGCTCAGGTGGGAGG - Intronic
1049496793 8:142939337-142939359 TTGAGCTTTGCTTCGCTGGGAGG + Intergenic
1050606871 9:7310739-7310761 CTGAGCTTTTCTTTGTTGGGAGG + Intergenic
1052037802 9:23703019-23703041 CTTAGGTATGCTTAAGTAGGAGG - Intronic
1053612081 9:39724316-39724338 CAGAGCCATGCTGTGGTGGGTGG - Intergenic
1053870115 9:42482308-42482330 CAGAGCCATGCTGTGGTGGGTGG - Intergenic
1054086176 9:60746840-60746862 CAGAGCCATGCTGTGGTGGGTGG + Intergenic
1054241437 9:62618077-62618099 CAGAGCCATGCTGTGGTGGGTGG + Intergenic
1054555565 9:66652600-66652622 CAGAGCCATGCTGTGGTGGGTGG + Intergenic
1055531737 9:77191540-77191562 CTTTGCAAGGCTTAGGTGGGGGG - Intronic
1058908843 9:109502550-109502572 CTGTGCGAGGCTGAGGTGGGAGG + Intergenic
1059239640 9:112793244-112793266 CTGAGCTCTACTGAGATGGGGGG - Intronic
1059489505 9:114655578-114655600 CTGAGCCAGGGTTTGGTGGGAGG - Intergenic
1186090427 X:6041248-6041270 CTGGGCTGTGCTCAGCTGGGAGG - Intronic
1187016308 X:15332915-15332937 GTGAGCTAGGCTCAGCTGGGTGG - Intronic
1189008160 X:37015943-37015965 CTGAGCTTTACTTTGTTGGGAGG - Intergenic
1189719457 X:43900340-43900362 CTTAGCTATGCTTAGGTGCACGG - Intergenic
1189927001 X:45965839-45965861 CTGAGCTTTTCTTTGTTGGGAGG + Intergenic
1191833462 X:65439783-65439805 TTGATCTGTCCTTAGGTGGGTGG + Intronic
1192257433 X:69474250-69474272 CTCAGGGAGGCTTAGGTGGGAGG - Intergenic
1194848676 X:98844429-98844451 CTGAGCTTTTCTTTGATGGGAGG + Intergenic
1197373453 X:125653517-125653539 CTGAGCTTTTCTTTGCTGGGAGG + Intergenic
1198773099 X:140151432-140151454 CTGAGATATGCCTAGATGGCTGG + Intergenic
1199511232 X:148625399-148625421 CTGACCTTTGCTTTGGCGGGAGG - Intronic
1200396937 X:155996534-155996556 CTTAGGGAGGCTTAGGTGGGCGG + Intergenic