ID: 1101448296

View in Genome Browser
Species Human (GRCh38)
Location 12:104754109-104754131
Sequence TTTCCCAGCTTGGAAATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101448296_1101448299 -7 Left 1101448296 12:104754109-104754131 CCAGTTATTTCCAAGCTGGGAAA 0: 1
1: 0
2: 0
3: 17
4: 189
Right 1101448299 12:104754125-104754147 TGGGAAACTCCAGGCCAAGCTGG 0: 1
1: 0
2: 2
3: 26
4: 244
1101448296_1101448301 6 Left 1101448296 12:104754109-104754131 CCAGTTATTTCCAAGCTGGGAAA 0: 1
1: 0
2: 0
3: 17
4: 189
Right 1101448301 12:104754138-104754160 GCCAAGCTGGTTTTACCAAGTGG 0: 1
1: 0
2: 1
3: 68
4: 1447
1101448296_1101448304 27 Left 1101448296 12:104754109-104754131 CCAGTTATTTCCAAGCTGGGAAA 0: 1
1: 0
2: 0
3: 17
4: 189
Right 1101448304 12:104754159-104754181 GGAACCCGAAAATATATATATGG 0: 1
1: 0
2: 0
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101448296 Original CRISPR TTTCCCAGCTTGGAAATAAC TGG (reversed) Intronic
903389671 1:22954953-22954975 TTTGCCAGGTTGGAAATAAACGG - Intronic
904089765 1:27936581-27936603 TCTCCCAGCTGGGAAATGGCAGG + Intronic
907578140 1:55547147-55547169 TTCCACAGCTTGGAAGTTACAGG - Intergenic
907790179 1:57655886-57655908 AGTCACAGCTTGGAAAGAACTGG - Intronic
909697027 1:78479345-78479367 TTTCCCTGTTTGCAAATGACAGG - Intronic
910149689 1:84126725-84126747 TTCCCCAGCTTAATAATAACTGG + Intronic
910547947 1:88440575-88440597 TCTCCCATCTTTCAAATAACTGG - Intergenic
915812583 1:158930393-158930415 TTTCCCACCTTTTAAATGACTGG + Intergenic
916209474 1:162348428-162348450 ATGGTCAGCTTGGAAATAACAGG + Intronic
916709253 1:167387960-167387982 TTTCTCAGATTTGAAGTAACAGG + Intronic
918637886 1:186800769-186800791 TTTCCCAGCTCAGTAATCACTGG - Intergenic
919453524 1:197798766-197798788 CCTCCCAGCTTGGAAACAGCAGG + Intergenic
920944449 1:210515335-210515357 CTTCCCAGCTTGGGAGTAAGGGG + Intronic
922991950 1:229921663-229921685 TTCCCCAGCTGAGAAATGACAGG - Intergenic
1062965491 10:1604399-1604421 GTTCCCAGCCTGGAGATCACAGG - Intronic
1063641432 10:7834425-7834447 TTTCCCAGCGTGGAGACAACTGG - Intronic
1065698700 10:28403874-28403896 TTTTCCAGCTTTGAAATTATGGG + Intergenic
1066620884 10:37348635-37348657 AGTGCCAGCTTGGAAATAAAAGG - Intronic
1068803079 10:61163584-61163606 TTTCCCAGGACTGAAATAACCGG + Intergenic
1070476467 10:76834155-76834177 TTTCCCTGCTTGAAAAAAATGGG - Intergenic
1073391143 10:103177459-103177481 TTTTCAAGATGGGAAATAACAGG - Intronic
1073685904 10:105753242-105753264 TTTGCCAGGTTGGGAATACCTGG + Intergenic
1076501159 10:130937346-130937368 TTTACCTGCTTTGAAATGACTGG - Intergenic
1078700197 11:13672713-13672735 GTTCCTATCTTGGAAATGACTGG + Intronic
1080333221 11:31166334-31166356 TTTCACAGCATTGAAATAACTGG - Intronic
1080992640 11:37557916-37557938 TTTCACAGCTTGAAAAAAAGGGG - Intergenic
1089690864 11:120186051-120186073 TGTTCCAGCTTGGAAAGAAGTGG + Intergenic
1090341277 11:126023078-126023100 TTTCTGAACTTGGAAAGAACAGG - Intronic
1091623106 12:2104838-2104860 TCTCCATGCTTGGAAATAAGTGG + Intronic
1092683179 12:11011887-11011909 TTTTCCATTTTGGAAATTACAGG - Intronic
1094369691 12:29724568-29724590 TTACACAGCTGGGAAATGACTGG + Intronic
1098342451 12:69466890-69466912 TTGCCAAGCTTTGAAATAATGGG - Intergenic
1098469735 12:70829384-70829406 TTTCCCAGCCTAGAAATCCCAGG - Intronic
1099051215 12:77783590-77783612 TTTCCCCATTTGGAAATAACTGG - Intergenic
1099338775 12:81399691-81399713 TTTGCCAACTTGGAAAGAGCAGG - Intronic
1099677687 12:85783339-85783361 TTTGCTACTTTGGAAATAACTGG + Intergenic
1101244652 12:102874176-102874198 TTTCCAAGTGGGGAAATAACAGG + Intronic
1101319779 12:103663461-103663483 TTGCCCAGTCTGGAAATGACAGG + Intronic
1101448296 12:104754109-104754131 TTTCCCAGCTTGGAAATAACTGG - Intronic
1102027694 12:109722979-109723001 TTTCCCAGCTTGGAGGGAGCGGG + Intronic
1103938925 12:124491430-124491452 TTTCACAGCTAGGACATCACTGG + Intronic
1104207298 12:126651558-126651580 CTTCCCAGCTCTGAAATCACAGG + Intergenic
1108768857 13:53670836-53670858 TTTCACAGTTTGGAAAGAAACGG + Intergenic
1110228553 13:73144514-73144536 TTTTCCAACTTGGAAACCACTGG - Intergenic
1111764406 13:92509714-92509736 TTTGCTAGCTTTTAAATAACTGG - Intronic
1111766799 13:92540999-92541021 ATTCCCATATTGGATATAACAGG + Intronic
1111905821 13:94255128-94255150 TTTTCCAGCTTGGACATGGCTGG - Intronic
1112139608 13:96623903-96623925 TTTCCTATCATGGAAAAAACAGG - Intronic
1112296334 13:98190506-98190528 TTTCCCAGCTGGGAAGGAAAGGG - Intronic
1113455147 13:110443461-110443483 TTTTCAAGGGTGGAAATAACTGG - Intronic
1114951591 14:27761453-27761475 TTCCCCAGCTTGGAAGCAGCAGG + Intergenic
1116912663 14:50487536-50487558 TTTCCCAGGTTACAAATAAAAGG - Intronic
1118463018 14:66003836-66003858 TATCCCAGCTAGGAAGTGACAGG - Intronic
1118823806 14:69362573-69362595 TCTCCCAGCTCAGAAATAGCTGG - Intergenic
1119439223 14:74617048-74617070 TTTTCTTGCTTGGAAGTAACTGG + Intergenic
1120224119 14:81770884-81770906 TTTCCCATCCTGGAAATCTCAGG + Intergenic
1122664958 14:103322822-103322844 TTGCCCAGGTTGGAAATAAGTGG + Intergenic
1123197733 14:106632421-106632443 TTGTCCAGCTTGGAAATGATGGG - Intergenic
1125519260 15:40339113-40339135 TTTCCCAGCTCAGAGATGACGGG - Intronic
1125916651 15:43493516-43493538 TTTCCCAGCTTTCTCATAACAGG + Intronic
1126054586 15:44718180-44718202 TTTCCCTGTTTGAAAATAAAGGG - Exonic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1128436945 15:67662044-67662066 TTCCACAGTTTGGAAATAACTGG - Intronic
1130401981 15:83565737-83565759 TTTCCCAGGTTGTAAATTATAGG + Intronic
1132313371 15:100873176-100873198 TTTCCCAACTTAGCAATAAATGG - Intergenic
1135777463 16:25269307-25269329 TTACTTAACTTGGAAATAACCGG - Intergenic
1139494980 16:67309881-67309903 TTTACATGCTTGGAAATAGCAGG - Intronic
1140132796 16:72178838-72178860 TTTCCCCATTTGGAAACAACTGG + Intergenic
1140653767 16:77118307-77118329 TTTACAATCTAGGAAATAACAGG - Intergenic
1144044902 17:11446652-11446674 TTTCCCAGGTTGGACATGGCAGG - Intronic
1150065590 17:62106285-62106307 TTTCCCAGCTTTGACTTACCTGG + Intergenic
1150279031 17:63918272-63918294 TTCCCCCGCTGGGAAATAAGAGG - Intronic
1150516995 17:65824160-65824182 TTCTCCAGCTGGGAAATATCTGG - Intronic
1151452238 17:74205079-74205101 TTTCCCAGCTTGTACATACAGGG + Intronic
1152002488 17:77655411-77655433 TTTCCCAGCTGGGCAAGACCTGG + Intergenic
1153358993 18:4172541-4172563 TTGATCAGCTTTGAAATAACTGG - Intronic
1153418632 18:4879204-4879226 TTTTCAAGCATGGAAATCACAGG - Intergenic
1153710169 18:7790787-7790809 TTTATCAGCTTAGAAAGAACTGG - Intronic
1155532178 18:26778306-26778328 CTTCCCAGGTTGAAAATCACTGG - Intergenic
1160359543 18:78261180-78261202 TCTCCTTGCTTGGAAATGACTGG - Intergenic
1160362437 18:78295322-78295344 TTTCCCAGCCTGAAACTAATTGG - Intergenic
1160539745 18:79614111-79614133 TTTCCCAAGTTGGAAAGAATCGG + Intergenic
1162141339 19:8587112-8587134 TTTTACAGCTAGGAAATGACTGG + Intronic
1164237793 19:23352107-23352129 CCTCCCAGCTGGGAAAGAACAGG - Intronic
926632935 2:15153930-15153952 TTTAGGAGCTTGGAAATAAAGGG + Intergenic
929257924 2:39832551-39832573 TTTCCCTGTTTGCAAATGACAGG - Intergenic
930364396 2:50421080-50421102 TCTCCCACCTAGCAAATAACAGG - Intronic
931802504 2:65772361-65772383 TTTTCCAGCTTTGCAATATCTGG - Intergenic
933862462 2:86483599-86483621 TATTCCTGCTTGGCAATAACAGG + Intronic
936069368 2:109355119-109355141 TTTCAAAACTTGGAAATACCAGG + Intronic
936399547 2:112155152-112155174 TTTCTCAGCTTGGAAAAAGGGGG + Intronic
939044494 2:137234017-137234039 TCTCCCAGCTTGAAAATTCCTGG - Intronic
939230744 2:139422933-139422955 TTTCTCAGCATGGAAGTGACAGG - Intergenic
939631867 2:144535298-144535320 TTGCCCAGTTTGGAAAAAAAGGG + Intergenic
942446325 2:176080974-176080996 TTTCCCAGCTGGGAGACCACAGG - Intronic
942931174 2:181494539-181494561 TTTTCCAGCTTGAAATGAACAGG - Intronic
945680516 2:212908359-212908381 TTCACAGGCTTGGAAATAACCGG + Intergenic
946457673 2:219841135-219841157 TCTCCCAGCTTGGCACTAACTGG + Intergenic
947328986 2:229008639-229008661 TTTCCCAGATGTGAAAGAACAGG - Intronic
947493734 2:230617769-230617791 TTTCCAAACTTATAAATAACTGG + Intergenic
1169803732 20:9538015-9538037 TTTCCCAGTTTGGTAACAAATGG + Exonic
1170154887 20:13260441-13260463 TTACCCAGCTTTGAGCTAACAGG + Intronic
1170388123 20:15842353-15842375 TTTCTCATCTTTGAAATAAATGG - Intronic
1170710159 20:18783398-18783420 CTGCCCATCTTGGAGATAACAGG + Intergenic
1171195772 20:23197995-23198017 TTTTCCATCTTGGTAAGAACAGG + Intergenic
1174128160 20:48323607-48323629 TTTGCCAGTTTGTAAATAAGGGG - Intergenic
1175112722 20:56660069-56660091 TTTTCCAGCTGGGAGATAAAAGG + Intergenic
1175295478 20:57905925-57905947 TATTCAAGCTTGGAAATAAGGGG - Intergenic
1177684847 21:24422629-24422651 TTTTCTAGCCAGGAAATAACAGG - Intergenic
1177944024 21:27444929-27444951 TTTGCCAGCCTGCAAATAACTGG - Intergenic
1179278667 21:39914943-39914965 TTTCACAGCTTTGGAATAATTGG - Intronic
1181945659 22:26515468-26515490 TTTCCCCTCTAGGAAATGACAGG - Intergenic
1182378803 22:29869754-29869776 ATTCCCAGCTAAAAAATAACTGG - Intergenic
1182875931 22:33690982-33691004 TTCCAGAGCTAGGAAATAACTGG - Intronic
951045161 3:18029363-18029385 TTTGCCAGAGTGGCAATAACTGG + Intronic
951507592 3:23465702-23465724 CTTCCCAGCTTGAGCATAACTGG + Intronic
951765709 3:26196055-26196077 TTTCCTAGCATGGAAATAAATGG + Intergenic
957990210 3:87617392-87617414 TTTTCCTACTTGAAAATAACAGG + Intergenic
958969993 3:100600894-100600916 CCTCCCAGCTTGGAAAGAAAAGG + Intergenic
961097194 3:124167464-124167486 TTTCCCATCTGTGAAATAAAGGG + Intronic
961221124 3:125200977-125200999 TTTCCCAGTTTGCAGATATCCGG - Intronic
961433282 3:126898296-126898318 CTTCCCAGCTGGGGAATAAAGGG - Intronic
963591467 3:147265504-147265526 TTTCCCATCTTTGAAATAAAAGG - Intergenic
967257564 3:187609258-187609280 CCTCCCAGCTTCGAAAGAACAGG + Intergenic
968539049 4:1153655-1153677 TTCCCCTGCGTGGAAATAAAAGG + Intergenic
971187611 4:24395669-24395691 TGTCCCAGCTTGAAAACACCTGG - Intergenic
972931344 4:44075211-44075233 TTTGCCAGAAAGGAAATAACTGG - Intergenic
974341993 4:60626001-60626023 TTTCCCACATTTGAAAAAACTGG - Intergenic
974368029 4:60977457-60977479 TTTCCCCACTTGGAAACAAAAGG - Intergenic
974462263 4:62203667-62203689 TTTCTCAATTTGGATATAACAGG - Intergenic
975175517 4:71284114-71284136 TTTCCCAGAATGGAAATAAATGG + Intronic
977818780 4:101447351-101447373 TTTATCATATTGGAAATAACAGG + Intronic
980202587 4:129675618-129675640 ATGCCCAGCTGGGAAATGACTGG + Intergenic
981035598 4:140165319-140165341 GTTGCCAGCTTTGATATAACAGG + Intergenic
983695826 4:170529036-170529058 TTTCTCACCATGGAAATACCTGG + Intergenic
984389570 4:179111363-179111385 TTTACCAGAGTGGAAATAATAGG - Intergenic
984561141 4:181272098-181272120 ACTCACAGGTTGGAAATAACAGG - Intergenic
986186010 5:5439028-5439050 TTTCCCATCTTGAAAAAAATGGG - Intronic
986984615 5:13486115-13486137 TGTCTCACCTTGGCAATAACAGG + Intergenic
991111484 5:62904905-62904927 TTTCACAGGGTTGAAATAACAGG - Intergenic
991389028 5:66122668-66122690 TTTCCCATCTCAGCAATAACTGG - Intergenic
991617494 5:68512201-68512223 TTTCCCAAATTGGAAAAAAATGG - Intergenic
993052526 5:82942231-82942253 TTTCCCAGAATGGATGTAACAGG - Intergenic
995987364 5:118194581-118194603 TTTCCTATCCTGAAAATAACAGG + Intergenic
996183574 5:120450201-120450223 TCTCCCAGCATGCAAATAAGAGG + Intergenic
998183831 5:139963961-139963983 TTTCCTGGCTTGGAAATAATAGG - Intronic
998799612 5:145856193-145856215 TTTCCTCTCTTGGAAATACCTGG - Intergenic
998940795 5:147280316-147280338 GCTCCCAGCTGGGAAATAAAAGG - Intronic
999420815 5:151440804-151440826 TCACCCAGCTGGGAAATAAGGGG + Intronic
999664862 5:153902016-153902038 TTTCCCATCTGGGAAAAAAGAGG + Intergenic
1001822172 5:174719092-174719114 TTTCACAGCTAGAAAATACCTGG - Intergenic
1002922111 6:1580225-1580247 TTTTCCAGCTTTGAAATCAATGG + Intergenic
1003603069 6:7535944-7535966 TTTACCAGTTTTTAAATAACTGG + Intergenic
1004838852 6:19559808-19559830 TTTCAAAGCTTGGGAATAAGTGG + Intergenic
1005880626 6:30056646-30056668 TTTCCCCACTTGGAAAGACCGGG - Intergenic
1006401039 6:33817557-33817579 TGTCCCAGCTTGGAAGGAAGGGG - Intergenic
1007101517 6:39250811-39250833 TCTTCCACCTTGGAAATAAGAGG - Intergenic
1008281905 6:49605923-49605945 TATTCAAGCTTGGAAAGAACTGG + Intronic
1010495692 6:76532215-76532237 TTTCCCAGCTTGGAGGCAGCAGG + Intergenic
1010751476 6:79620603-79620625 TTTCCCAGCCTGAAAAAAAGGGG + Intergenic
1015019238 6:128452236-128452258 TTTCCCAACTTGCATATAAAAGG + Intronic
1016212539 6:141556219-141556241 TTTCACATCTTTGAAATAAATGG - Intergenic
1017898182 6:158699439-158699461 TTTCTCAGCCTAGAAATAATAGG - Intronic
1019168992 6:170117997-170118019 TTTTCCAGTTTGGCAAAAACTGG - Intergenic
1020959128 7:14780140-14780162 TTTGCCAGCTGGGAAATGAGCGG + Intronic
1022463221 7:30631910-30631932 TTTCCCAGCTCTGAAATAAGTGG - Intronic
1024154532 7:46606790-46606812 TTTCCTACTTTGGAAATAATTGG - Intergenic
1024950732 7:54857884-54857906 TTTCACATCTTGGGAATAAGAGG + Intergenic
1029146141 7:98447452-98447474 TTTTCCAGATGGGAAATATCGGG + Intergenic
1029811674 7:103055395-103055417 TTTCCCAACTTGAAATAAACCGG + Intronic
1030469137 7:109940634-109940656 TTTACCAACATGGAAATAATTGG + Intergenic
1032156315 7:129471690-129471712 TTTCTCATCTTTGAAATAAGGGG - Intronic
1032635923 7:133708707-133708729 TTACACAGCTTGTAAGTAACTGG + Intronic
1034907997 7:154967575-154967597 TTTTTCAGCTTGGAAATTCCAGG - Intronic
1037156934 8:15712959-15712981 TTTAACAGCATGGAAATAACTGG - Intronic
1043182379 8:77102349-77102371 TTTTTAAGGTTGGAAATAACAGG - Intergenic
1043496459 8:80806250-80806272 TTTCCCATCTTTCAAATAAGGGG + Intronic
1043563526 8:81522530-81522552 TTTCCCAGCTTAAAAAGAACAGG + Intergenic
1044839609 8:96326697-96326719 TTTCCCCGCTTGAAAATTGCTGG - Intronic
1047028637 8:120851958-120851980 TTTGAAAACTTGGAAATAACTGG + Intergenic
1047803903 8:128338761-128338783 GTCCCCAGCTTGGAAATTACTGG + Intergenic
1048273274 8:133046311-133046333 TTTCCCATCTTTAAAATAATTGG - Intronic
1048952438 8:139507598-139507620 TTTCCCAGATTAGACATGACTGG - Intergenic
1050828894 9:9986244-9986266 TTCCACATCTAGGAAATAACTGG + Intronic
1051381169 9:16460274-16460296 TCTCCCTTCTTGGAAATAAGTGG + Intronic
1058311132 9:103504265-103504287 TTTTCCAGCTTGGAAGCAATGGG + Intergenic
1058843362 9:108932747-108932769 TTTCCTAGCCTGGAAAGAAGTGG - Intronic
1059123873 9:111665117-111665139 TTTCCAAGCCTCCAAATAACTGG - Intronic
1061348335 9:130043757-130043779 TTTCAGAGATTGGAAATCACTGG - Intergenic
1061475198 9:130860663-130860685 ACTCCCATCTTGGAAATCACTGG - Intronic
1185447067 X:264107-264129 CTTCCCTGCGTGGAAACAACAGG + Intergenic
1186978559 X:14934405-14934427 ATTCCCAGCGTGGAAGAAACAGG + Intergenic
1188717712 X:33480797-33480819 GTTCTCAGCTTGGAAATTATTGG - Intergenic
1192346043 X:70306877-70306899 TTTCCCAGGTTGGAAAGCAATGG + Intronic
1192691661 X:73371962-73371984 CTTCCCTGCTTGGGAGTAACAGG + Intergenic
1193196558 X:78639250-78639272 TTTCCCAGCTTGGGAGCAGCAGG + Intergenic
1193431520 X:81412282-81412304 CTTCCAAGCTTTGAAATATCTGG + Intergenic
1193913065 X:87328462-87328484 TTTCCCAGCTTGGAGGCAAGAGG - Intergenic
1197605992 X:128586115-128586137 TTTTTCAGCTCGGAAATAGCAGG - Intergenic
1198016729 X:132619028-132619050 TTTCCTAGCTTGGCAGTATCAGG + Intergenic
1198741315 X:139846219-139846241 TTCACCAGGTTGGAAACAACTGG - Intronic
1200773626 Y:7150384-7150406 TTTCCTTGATTGGAAATCACTGG - Intergenic
1201055253 Y:9982545-9982567 TTTTTCAGCTTGTAAAAAACAGG - Intergenic
1202273030 Y:23088614-23088636 TTACACAGCTTGGAAATGAGAGG - Intergenic
1202292996 Y:23332068-23332090 TTACACAGCTTGGAAATGAGAGG + Intergenic
1202426027 Y:24722358-24722380 TTACACAGCTTGGAAATGAGAGG - Intergenic
1202444762 Y:24947728-24947750 TTACACAGCTTGGAAATGAGAGG + Intergenic