ID: 1101451506

View in Genome Browser
Species Human (GRCh38)
Location 12:104783648-104783670
Sequence CATTTTGCACTCATTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101451506_1101451512 19 Left 1101451506 12:104783648-104783670 CCAAGCTCAATGAGTGCAAAATG No data
Right 1101451512 12:104783690-104783712 CATGATGTTTTGGAACATGGAGG No data
1101451506_1101451509 9 Left 1101451506 12:104783648-104783670 CCAAGCTCAATGAGTGCAAAATG No data
Right 1101451509 12:104783680-104783702 GCTATAGTACCATGATGTTTTGG No data
1101451506_1101451510 16 Left 1101451506 12:104783648-104783670 CCAAGCTCAATGAGTGCAAAATG No data
Right 1101451510 12:104783687-104783709 TACCATGATGTTTTGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101451506 Original CRISPR CATTTTGCACTCATTGAGCT TGG (reversed) Intergenic
No off target data available for this crispr