ID: 1101453444

View in Genome Browser
Species Human (GRCh38)
Location 12:104804195-104804217
Sequence CTGGTCAGCAGCAAAATTTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101453444 Original CRISPR CTGGTCAGCAGCAAAATTTT TGG Exonic
903137871 1:21321195-21321217 CTGGGGAGCAGCAAGATTGTGGG - Intronic
906901341 1:49839899-49839921 CTGGTCAGGACAAAAATTTTGGG + Intronic
909308446 1:74113157-74113179 CTTCTCAGTTGCAAAATTTTTGG - Intronic
910478271 1:87631960-87631982 CTGGTCATCATCATAATTTATGG - Intergenic
912748875 1:112268882-112268904 CAGGTCAGCAATAAAGTTTTTGG + Intergenic
915189631 1:154138046-154138068 CTTGTCAGCAGAAAAGATTTGGG + Intronic
916256327 1:162791167-162791189 GTGGTCAGGAGCAAAATATTGGG - Intronic
917989032 1:180353396-180353418 CTGGTTAACAGAAAAAATTTGGG + Intronic
918176260 1:182048340-182048362 CTGATCAACAGCACAATTGTTGG + Intergenic
924840286 1:247702956-247702978 CTGGTTATCAGCAAATTATTGGG - Intergenic
1063738677 10:8792665-8792687 CTGCTCTGAAGCAAAATTTGGGG + Intergenic
1066722789 10:38356820-38356842 GTGGTCAGGAGCAAACTATTGGG - Intergenic
1070091526 10:73290423-73290445 CTGGGCATGAGGAAAATTTTAGG + Intronic
1071965317 10:90845917-90845939 CTGGTCAGCCACAGAATCTTGGG - Intronic
1073599072 10:104829262-104829284 CTGGTGAGTAGCAAAATTGGAGG + Intronic
1073912681 10:108365063-108365085 CTGGTCACCTGGAATATTTTTGG - Intergenic
1074497247 10:113990897-113990919 TTGGTCAGAACCAAAGTTTTAGG + Intergenic
1076148673 10:128145606-128145628 CTGTTCAACAGCCAGATTTTAGG - Intergenic
1077766979 11:5169421-5169443 CTGGTCAGGAGGAAACTGTTTGG - Intronic
1085959332 11:81441918-81441940 CTGGTTAACAGGAAAATCTTTGG + Intergenic
1086629749 11:89003028-89003050 CTTGTCATGAGAAAAATTTTTGG - Intronic
1087040681 11:93796458-93796480 CTTCTCAGTAGCAAATTTTTGGG - Exonic
1088093433 11:106070698-106070720 ATGGTCAGCAGCATGATTCTTGG - Intronic
1088162583 11:106890591-106890613 GTGGCCAGCAGGAAAAATTTTGG - Intronic
1092914053 12:13173547-13173569 CTGCTCAGCAGCACAGTTTGAGG - Intergenic
1097498173 12:60369482-60369504 CTGGTCAGCAGAAATGTTTATGG - Intergenic
1100170054 12:91964601-91964623 CTGGTCTCCAGCAAAAGCTTGGG + Intergenic
1100974520 12:100108521-100108543 CTTGTCAGGAGATAAATTTTTGG + Exonic
1101453444 12:104804195-104804217 CTGGTCAGCAGCAAAATTTTTGG + Exonic
1103274856 12:119702809-119702831 GTGGTCAGCAGCAATGGTTTTGG + Intronic
1104899104 12:132178623-132178645 CTGGTCAGCAGGTACATTTGAGG - Intergenic
1106596497 13:31145008-31145030 GTGGTCAACAGAAGAATTTTAGG - Intronic
1106892776 13:34264095-34264117 CTTCTCTGCAGCAAAATTTTAGG - Intergenic
1107240240 13:38224100-38224122 CTTCTCTGCAGCAAAACTTTAGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114216517 14:20661347-20661369 TTGGTCATCAGCAAAAGTGTGGG - Intergenic
1115558916 14:34565482-34565504 CTGATCTACAGCAAAACTTTTGG + Intronic
1116544527 14:46147852-46147874 CTGGGTAGGAGGAAAATTTTAGG + Intergenic
1121063668 14:90940537-90940559 CTGGGGAACAGCAAAATGTTAGG - Intronic
1123568597 15:21578458-21578480 CTGGTCAACAGTATATTTTTGGG + Intergenic
1123604706 15:22013780-22013802 CTGGTCAACAGTATATTTTTGGG + Intergenic
1126180799 15:45783249-45783271 CTGGTCAGGAGCATGAGTTTTGG + Intergenic
1126268281 15:46780854-46780876 CTGGCCATCAGAAAAATCTTAGG - Intergenic
1129120744 15:73394938-73394960 CTGGTCAGGAGCCAATCTTTTGG - Intergenic
1130114309 15:80993118-80993140 CTGGTCACCACCATTATTTTTGG + Intergenic
1130882533 15:88067530-88067552 GTGCTCAGCAGCTAAATTTGTGG + Intronic
1131557942 15:93415509-93415531 CTGCTCAGCAGCACAAACTTTGG - Intergenic
1202976952 15_KI270727v1_random:305546-305568 CTGGTCAACAGTATATTTTTGGG + Intergenic
1134341655 16:13352390-13352412 CAAGTCAACAGCAAAATTTCTGG + Intergenic
1135313207 16:21421673-21421695 CTGGTCAGCAGCAACATAGCTGG - Intronic
1135366131 16:21853951-21853973 CTGGTCAGCAGCAACATAGCTGG - Intronic
1135445684 16:22517213-22517235 CTGGTCAGCAGCAACATAGCTGG + Intronic
1135564481 16:23500825-23500847 ATGGTCAGAAGCAAAATATTTGG - Intronic
1135593629 16:23723937-23723959 ATACTTAGCAGCAAAATTTTTGG + Intergenic
1135774002 16:25240254-25240276 CTGGTGGGCACCAAAATTTGAGG + Exonic
1136152361 16:28359402-28359424 CTGGTCAGCAGCAACATAGCTGG - Intronic
1136194384 16:28641789-28641811 CTGGTCAGCAGCAACATAGCTGG + Intronic
1136210720 16:28755879-28755901 CTGGTCAGCAGCAACATAGCTGG + Intronic
1136309877 16:29400388-29400410 CTGGTCAGCAGCAACATAGCTGG - Intronic
1137845985 16:51688698-51688720 CACGTTTGCAGCAAAATTTTGGG + Intergenic
1138565012 16:57826874-57826896 CTGCTCAGCAGCCACATTCTGGG - Intronic
1145220565 17:21085160-21085182 GTGAGCAGCAGCAAAATTTATGG + Intergenic
1145742063 17:27283187-27283209 CTTGTTAGCACTAAAATTTTAGG + Intergenic
1147343054 17:39766656-39766678 CTGGTCGGCAGCAACGTGTTTGG + Intronic
1149357669 17:55859611-55859633 CATTTCAGCAGCAACATTTTTGG - Intergenic
1150051525 17:61969046-61969068 CTGGTCTGCATTTAAATTTTTGG + Intronic
1151135171 17:71939431-71939453 CTGTTGAGTAGCAAAACTTTAGG - Intergenic
1151962786 17:77415927-77415949 CTTGTCAGGAGCAAAATGTAAGG + Intronic
1152061571 17:78079798-78079820 CTGGTCAGAAGCAATATTGAGGG + Intronic
1154198381 18:12282349-12282371 CTGGCCAGGAGCATCATTTTAGG + Intergenic
1154248525 18:12722155-12722177 TTGGTCAGAAGCAAAAGTTTAGG - Intronic
1155107596 18:22683140-22683162 TGGGTCAGCAGCAAAGGTTTGGG + Intergenic
1157129149 18:44987276-44987298 GTGGTCAGCAGGAAAACTCTGGG - Intronic
1157439428 18:47698853-47698875 GAGGTAATCAGCAAAATTTTAGG + Intergenic
1158795227 18:60837962-60837984 CTGCTTAGCAGCAAAATCATAGG - Intergenic
1164528764 19:29031181-29031203 CTTTTCAGCTGCTAAATTTTGGG + Intergenic
1165322340 19:35093865-35093887 GTGATTAGCAGCACAATTTTGGG - Intergenic
928196630 2:29220993-29221015 CTGCTCACCAGCAAGATTCTGGG - Intronic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
932099501 2:68884942-68884964 CTTGTCTGCAGTAGAATTTTGGG + Intergenic
933876333 2:86624211-86624233 CTGGTGAACAGGGAAATTTTTGG + Intronic
937440293 2:121909327-121909349 CAGGTCAGCAGGAAAAATTGGGG - Intergenic
942272062 2:174286382-174286404 CTGGTGAGCAGCTGAATTCTAGG + Intergenic
1169150946 20:3288893-3288915 CTGGTCAGCAGGGAAATTCAGGG - Intronic
1174332256 20:49829736-49829758 CTTGTCATCAGCAGAATTGTGGG - Intronic
1177061262 21:16377146-16377168 CTGGTCTGCTACCAAATTTTTGG - Intergenic
1177081261 21:16641331-16641353 CTGGCCAGCAGTAAAATTGATGG + Intergenic
1177880186 21:26684702-26684724 CTGTTCAGCAACAAGATTTGGGG + Intergenic
1179117954 21:38511754-38511776 CTTGGCAGCATCAACATTTTGGG + Intronic
1179588571 21:42389827-42389849 CTGGGCAGCAGCAAAATGCTGGG + Intronic
1183308176 22:37094987-37095009 CTGGTCAGCTGAAAGATTGTGGG + Intronic
951613514 3:24519028-24519050 CTGTTCTGCAGCATCATTTTAGG - Intergenic
952054954 3:29433048-29433070 TTGGTCAGCAGCAGAAGTTTTGG + Intronic
952737779 3:36707261-36707283 CTCCTCAGCTGCAAAATTTAAGG + Intergenic
952830126 3:37557885-37557907 CTGGTAAGCAGCCAAGTCTTGGG + Intronic
955491483 3:59487625-59487647 CAGGTCAGTGGCAAAAGTTTTGG + Intergenic
959537033 3:107498069-107498091 CTGATCTGCTGCAAAATTTTTGG - Intergenic
961170403 3:124793704-124793726 CTGGTTAGTAGAAAAAGTTTGGG - Intronic
962085520 3:132187549-132187571 CTGGACAGCAGGAACATGTTGGG - Intronic
964661791 3:159127859-159127881 CTGCACTGCAGCAAAATCTTTGG - Intronic
970575742 4:17425526-17425548 CTGGTAAGCAGCACAAGATTTGG - Intergenic
970736244 4:19171940-19171962 CTGGTTAGCAGCATAGGTTTGGG + Intergenic
972197318 4:36669861-36669883 CTGATCATCAACAAAATTGTTGG - Intergenic
973336423 4:48961333-48961355 CTGGTCTGCAGTGAAATTTGAGG + Intergenic
976205183 4:82617460-82617482 CTGAACAGCAGCAAAAACTTAGG - Intergenic
977345983 4:95816749-95816771 CTGGCTACCAGCAGAATTTTAGG + Intergenic
978710951 4:111780364-111780386 CTAGTAAGCAGTAAGATTTTGGG - Intergenic
979712049 4:123791312-123791334 CTGGCCAACAGCAAATATTTAGG - Intergenic
985357227 4:189134433-189134455 ATGATTAGCAGCAAAATTTTCGG - Intergenic
991955395 5:71989089-71989111 CTGATCAGCAGTAAAAGGTTGGG + Intergenic
992023267 5:72646401-72646423 CTGGCCAGCAGCAATGTGTTTGG - Intergenic
993411652 5:87581253-87581275 CTGGACAACAGCAAAATGCTGGG - Intergenic
994569411 5:101495725-101495747 CTGATAAGCAGCAAAAACTTAGG - Intergenic
1000879033 5:166675649-166675671 CAGGTCAGAAGCAAAGATTTAGG - Intergenic
1001138590 5:169123794-169123816 CTGGTCAACAGCAAAAGTCATGG + Intronic
1003240444 6:4340927-4340949 GTGGTCAGAATCAAAAGTTTGGG - Intergenic
1005881490 6:30065568-30065590 CTGGTCAACAGTAAAGTTTTGGG + Intergenic
1006244858 6:32723657-32723679 TTGGTCATCAGGAAAATCTTAGG + Intergenic
1010253087 6:73728619-73728641 ATGGTCAGCAGCAATATTTAGGG - Intronic
1011434003 6:87317828-87317850 CAGGTTAGCAGGAAAATTTTTGG - Intronic
1012523878 6:100153978-100154000 ATGATGAGCAGCAGAATTTTTGG + Intergenic
1015490235 6:133816989-133817011 CAGGGCAACAGCAAATTTTTAGG + Intergenic
1016274736 6:142335740-142335762 ATAGACAGCAGCAAAATTTAGGG + Intronic
1016916014 6:149245132-149245154 CAGGTGAGAAGCAACATTTTTGG + Intronic
1018287816 6:162259365-162259387 ATGGTCAGTACCAACATTTTGGG + Intronic
1018401261 6:163422857-163422879 CTGGTCAGTAGCAAATCATTGGG + Intronic
1019075182 6:169381201-169381223 CGGGTGAGCAGCAATGTTTTTGG - Intergenic
1020711216 7:11607915-11607937 CTGGTCAGCAGCTGAATGTGAGG + Intronic
1021058910 7:16085306-16085328 TTGGTCAGCAGGAAAATTTTGGG - Intergenic
1021351891 7:19603628-19603650 CTAGTAAGCAGAAACATTTTTGG + Intergenic
1023702855 7:42910230-42910252 CTGGTCACCTGCAAAAGTTCAGG + Exonic
1024436080 7:49356207-49356229 ATGGACAGCTGCAAAAATTTTGG + Intergenic
1026397295 7:69968358-69968380 CTGTTTAACATCAAAATTTTAGG - Intronic
1028958066 7:96715968-96715990 CTGGTCTGCAGCACACTTTCAGG + Intergenic
1031265182 7:119572399-119572421 CAGGTCAGCAGCCACGTTTTGGG - Intergenic
1031869995 7:127081038-127081060 ATGGTCAGCAGCGATATTTAAGG + Intronic
1035662528 8:1358939-1358961 CTGGTCAGCAGCAGAACCTCTGG + Intergenic
1036947546 8:13108654-13108676 CTGGACAGCAGCAATAGCTTAGG - Intronic
1038208901 8:25497015-25497037 CTGGCCCTAAGCAAAATTTTGGG + Intronic
1038920977 8:32083702-32083724 CAGGTCAGCAACAAAATAATGGG + Intronic
1040708687 8:50161801-50161823 CTGGATAGCAGCAATATTTAAGG + Intronic
1044122182 8:88411582-88411604 CTGCTCAGCAGGAAAATTCAAGG - Intergenic
1046613415 8:116449800-116449822 CTGGTCAGCTTCAAGATTTGGGG - Intergenic
1050893584 9:10856328-10856350 ATGGTCAGCAGAAACATTTAAGG + Intergenic
1055598154 9:77886560-77886582 CTGGTTAGCAGGAAATATTTTGG + Intronic
1056047178 9:82731119-82731141 ATGGTCAGAAACAAAACTTTTGG - Intergenic
1056113813 9:83422417-83422439 TTGATCAGCAGCAATATTTAAGG + Intronic
1186329497 X:8517171-8517193 CTGGACTGCAGCAAAATATTTGG - Intergenic
1187755180 X:22517178-22517200 TTGGTGAGCAGCACAATTTCTGG + Intergenic
1188204792 X:27342556-27342578 ATGATCAACACCAAAATTTTGGG - Intergenic
1189534039 X:41917966-41917988 GTGATCAGCAGCTAAATTGTTGG - Intronic
1191689932 X:63928884-63928906 CTGGTCAGCAGGAACACTTGGGG + Intergenic
1192269190 X:69562777-69562799 TTGGTAAGCAGCAGAACTTTGGG - Intergenic
1195018850 X:100805921-100805943 CTGGAGATCAGCAAGATTTTTGG - Intergenic
1195252210 X:103060197-103060219 CTTGTAAGCTGCTAAATTTTGGG - Intergenic
1196505431 X:116436177-116436199 CTAGTCAGGGGCAAAACTTTGGG + Intergenic
1197855392 X:130908984-130909006 CTGGTGAGCAGCTTAATTTCTGG + Intergenic
1197997804 X:132398389-132398411 GTGGTCACCAACAAATTTTTAGG - Intronic
1200663925 Y:5997017-5997039 TTTGTCAGCAGAAATATTTTAGG + Intergenic