ID: 1101453499

View in Genome Browser
Species Human (GRCh38)
Location 12:104805235-104805257
Sequence CACCCAATGCTGTTAGGTAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101453492_1101453499 24 Left 1101453492 12:104805188-104805210 CCAAAGAAAATGAAAACTTAAGG 0: 1
1: 0
2: 9
3: 81
4: 820
Right 1101453499 12:104805235-104805257 CACCCAATGCTGTTAGGTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101453499 Original CRISPR CACCCAATGCTGTTAGGTAG GGG Exonic
901494651 1:9614055-9614077 CTCCCAATGCTGTGAGGCAGCGG + Exonic
907832471 1:58078101-58078123 CACCCTATGCTGGAAGGCAGGGG - Intronic
908392352 1:63695286-63695308 CACAACATGCTGTGAGGTAGGGG + Intergenic
910169409 1:84361454-84361476 TACCCTGTGCTGTGAGGTAGGGG + Intronic
915713081 1:157919956-157919978 CACCCAATGCTGTCAGTGTGTGG - Intergenic
922545243 1:226451868-226451890 GAACAAAGGCTGTTAGGTAGGGG + Intergenic
1066333768 10:34454976-34454998 CACCCAATGCCTTGAGATAGAGG + Intronic
1067106716 10:43371520-43371542 CACCCAGGGCTGTTGGGGAGGGG - Intergenic
1069412572 10:68168515-68168537 CACCCAAGGCAGTCAGGTTGCGG + Intronic
1069472952 10:68709208-68709230 CACTCAATCCTGGTAGGCAGAGG - Intergenic
1073052453 10:100676905-100676927 CGGCCAAGGCTGTTAGGGAGAGG + Intergenic
1087205671 11:95391444-95391466 CTCCCAATGCTGTTACATTGGGG + Intergenic
1087693997 11:101354664-101354686 CACCAAAAGCTATTATGTAGTGG + Intergenic
1094300708 12:28962091-28962113 ATCCCAATGCTGTGTGGTAGGGG + Intergenic
1094802124 12:34048791-34048813 GACTCAGTGCTGTTAGGTGGAGG + Intergenic
1100522174 12:95385619-95385641 CAGCCCATGCAGTTAGGAAGAGG - Intergenic
1101453499 12:104805235-104805257 CACCCAATGCTGTTAGGTAGGGG + Exonic
1102562962 12:113775883-113775905 CAGCCAATGCTGTTTGATACAGG - Intergenic
1105415995 13:20211656-20211678 CACCTCATGCTGTCAGGTGGAGG - Intergenic
1116850826 14:49907197-49907219 CATCCCGTGTTGTTAGGTAGGGG + Intergenic
1119024704 14:71143354-71143376 CACCCAATGCTGTTGCATTGGGG + Intergenic
1119221206 14:72909011-72909033 CACCCAATGCTGTGAACTTGAGG - Intergenic
1123199987 14:106653535-106653557 CATACAATACTGTTAGGTATTGG + Intergenic
1125033017 15:35091898-35091920 CACCTAATGCTCTTCAGTAGGGG + Intergenic
1128659142 15:69485060-69485082 CACCCAGTGGTGTGAGGGAGTGG - Intergenic
1128839515 15:70838590-70838612 CACCTAATGATCTTAGGGAGAGG - Intronic
1140456214 16:75107127-75107149 CACCCAGTGCTGTGGGATAGAGG - Intronic
1147430299 17:40366769-40366791 CACCCATGGCTGATAGGGAGAGG - Intergenic
1148949410 17:51297047-51297069 CACCCATTGCTGTCAGTTGGTGG + Intronic
1152698658 17:81808367-81808389 GACCCAATGCTCTTGGGTGGGGG - Intronic
1154250030 18:12736657-12736679 CAGCAAATGCTGTTAGGCAGTGG - Intergenic
1154966558 18:21363342-21363364 CACCCAATGCTTTTATATCGGGG - Intronic
1157508548 18:48250401-48250423 CACATAGTGCTGTGAGGTAGGGG - Intronic
1158450135 18:57556825-57556847 CACCCAAGTCTGGTAGGTCGAGG + Intronic
929058693 2:37901234-37901256 CAACAAATGAAGTTAGGTAGGGG + Intergenic
931620803 2:64207498-64207520 TCCTCAATGCTGTTGGGTAGGGG + Intergenic
936280482 2:111135798-111135820 CACCCGTTGCTGTTTAGTAGAGG + Intronic
937413701 2:121697772-121697794 CACCCTATCCTGTTCTGTAGTGG + Intergenic
945624052 2:212178191-212178213 CACTGAAGGCTGTTAAGTAGGGG + Intronic
1170374948 20:15690048-15690070 CATCTAATGGTTTTAGGTAGAGG + Intronic
1171059545 20:21943156-21943178 CAGTCAAGGTTGTTAGGTAGGGG - Intergenic
1177693430 21:24540157-24540179 CTCCCAATACTGTTGGGTGGAGG + Intergenic
1184795198 22:46728177-46728199 CACTCCATGCTGTCAGGTCGCGG + Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
949343032 3:3050012-3050034 CACCCAGTGCTGGGAGGGAGAGG + Intronic
949983029 3:9515145-9515167 CACCAAATGCTGGTAGGACGTGG - Intronic
955580876 3:60420531-60420553 CATCCAATGCTGTTAGAATGTGG - Intronic
956562465 3:70595389-70595411 CACCAAATGCTGCTATGGAGGGG - Intergenic
961112961 3:124300695-124300717 CACTGAAAGATGTTAGGTAGAGG + Intronic
964371606 3:156005808-156005830 CACCCAATGCTGGGACATAGGGG - Intergenic
968787191 4:2631352-2631374 CACCCAATGCTTTTATCCAGTGG - Intronic
970799301 4:19952615-19952637 AACCTAATGCTGTAAGGAAGAGG + Intergenic
974525962 4:63050476-63050498 CACCCAAGGCCTTTAGGTAAGGG + Intergenic
974931230 4:68363754-68363776 CAACTAATTCTGTTAGGGAGAGG - Intergenic
978489328 4:109294897-109294919 CACCTAATCCTGTTAGTAAGAGG + Intronic
986802345 5:11275171-11275193 CACACAATGCTATGGGGTAGCGG + Intronic
986803152 5:11282198-11282220 CAGTCAATGCTGTTGGGTATTGG + Intronic
989210439 5:38853977-38853999 AACCCTATGCTGTAAGGCAGAGG + Intronic
991396959 5:66214133-66214155 CACCTAAAACTGTTAGGGAGGGG - Intergenic
994669487 5:102749763-102749785 CACACAATGCTGTTATTCAGAGG - Intergenic
1001732961 5:173973661-173973683 CTGCCAATTCTGTGAGGTAGGGG - Intergenic
1001832261 5:174798790-174798812 AACCCAATGATTTTAGGTACTGG - Intergenic
1002629684 5:180563133-180563155 CACCCTGTGCTGTGAGGCAGTGG - Intronic
1004884355 6:20037254-20037276 CACCCAATGATGTTAATAAGTGG - Intergenic
1008159407 6:48059298-48059320 CACTCAATACTGTAAGGTAAGGG + Intronic
1010450893 6:76001617-76001639 CACCCAAAGCTGTTGGCTGGGGG - Intronic
1012241677 6:96879818-96879840 CACTCAAAACTGTTAGGTATGGG + Intergenic
1014710392 6:124799864-124799886 CACCCACTGCTGGTAGGCTGTGG - Intronic
1016711228 6:147174588-147174610 CACAAAGTGCTGTTAGGAAGTGG + Intergenic
1019981142 7:4623140-4623162 CACCCAGTGGTGTTGGGTTGAGG - Intergenic
1024232135 7:47370807-47370829 CAGTGACTGCTGTTAGGTAGTGG - Intronic
1031562399 7:123254399-123254421 CTCCCAATGATGGTAAGTAGTGG - Intergenic
1034409652 7:150933394-150933416 CACACATTGCTGTTTGTTAGTGG - Intergenic
1034549624 7:151812158-151812180 CTCCTAATGCAGTCAGGTAGGGG - Intronic
1034754141 7:153598694-153598716 GACCCCATGCTGCTAGGTATGGG - Intergenic
1035857487 8:2992235-2992257 CACTCATTGCTGGGAGGTAGAGG + Intronic
1038006083 8:23431606-23431628 CAGTCAATGCGGTTAGGAAGAGG + Exonic
1048177794 8:132168815-132168837 AACCCAATGCTACTAGATAGGGG - Intronic
1052144665 9:25034073-25034095 AAGCCAGTGCTGTTAGGTAAGGG + Intergenic
1053442243 9:38126080-38126102 CACCCTAGGCTATAAGGTAGGGG - Intergenic
1059350164 9:113658712-113658734 CAGCTAATGCTGGTAGGAAGTGG + Intergenic
1060093606 9:120766773-120766795 CTCATAATGCAGTTAGGTAGAGG + Intronic
1062104197 9:134743911-134743933 CACCAGAACCTGTTAGGTAGAGG - Intronic
1062497480 9:136838560-136838582 CACCCATTGCTGTGGGGCAGCGG + Intronic
1190064296 X:47229660-47229682 CACTCGGTGCTGTTGGGTAGGGG + Exonic
1198073269 X:133170272-133170294 CATCCAAGGCTCATAGGTAGGGG - Intergenic
1201907518 Y:19100849-19100871 CACCAAATGCTGTTGGGAATTGG + Intergenic