ID: 1101455482

View in Genome Browser
Species Human (GRCh38)
Location 12:104826412-104826434
Sequence CTAGGTCAATCCTACATTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 1, 2: 6, 3: 20, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101455482_1101455488 3 Left 1101455482 12:104826412-104826434 CCGACAATGTAGGATTGACCTAG 0: 1
1: 1
2: 6
3: 20
4: 120
Right 1101455488 12:104826438-104826460 CTGTGTTTGCTGTCTCAGGAAGG 0: 1
1: 0
2: 1
3: 30
4: 264
1101455482_1101455484 -1 Left 1101455482 12:104826412-104826434 CCGACAATGTAGGATTGACCTAG 0: 1
1: 1
2: 6
3: 20
4: 120
Right 1101455484 12:104826434-104826456 GCCCCTGTGTTTGCTGTCTCAGG 0: 1
1: 0
2: 5
3: 31
4: 282
1101455482_1101455491 23 Left 1101455482 12:104826412-104826434 CCGACAATGTAGGATTGACCTAG 0: 1
1: 1
2: 6
3: 20
4: 120
Right 1101455491 12:104826458-104826480 AGGCTGCAAGTGGCAAGGCCAGG 0: 1
1: 0
2: 12
3: 65
4: 470
1101455482_1101455490 18 Left 1101455482 12:104826412-104826434 CCGACAATGTAGGATTGACCTAG 0: 1
1: 1
2: 6
3: 20
4: 120
Right 1101455490 12:104826453-104826475 CAGGAAGGCTGCAAGTGGCAAGG 0: 1
1: 0
2: 3
3: 44
4: 368
1101455482_1101455489 13 Left 1101455482 12:104826412-104826434 CCGACAATGTAGGATTGACCTAG 0: 1
1: 1
2: 6
3: 20
4: 120
Right 1101455489 12:104826448-104826470 TGTCTCAGGAAGGCTGCAAGTGG 0: 1
1: 0
2: 1
3: 21
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101455482 Original CRISPR CTAGGTCAATCCTACATTGT CGG (reversed) Intronic
905494950 1:38377635-38377657 CTAGGACAGTCCTACGTAGTAGG - Intergenic
908574605 1:65446221-65446243 CTAGGACTCTCATACATTGTTGG - Intronic
910629204 1:89339194-89339216 CTGGATCAATCCTGCAATGTTGG - Intergenic
913024720 1:114825937-114825959 CTGGATCACTCATACATTGTTGG + Intergenic
916708918 1:167383591-167383613 ATAGGTCAATCCTTTATTTTAGG - Intronic
916743383 1:167665578-167665600 CTGGATCACTCCTATATTGTTGG - Intronic
922793731 1:228326425-228326447 CTGGGTCACTCATACATTGCTGG + Intronic
1066472747 10:35715181-35715203 CTGGGTTACTCATACATTGTTGG + Intergenic
1068303300 10:55174576-55174598 CTAGATCAATTCTACAATGTTGG - Intronic
1068310129 10:55264923-55264945 CTGGGTCAATCTTACACTGTTGG - Intronic
1069187991 10:65450946-65450968 ATTGTTCATTCCTACATTGTAGG + Intergenic
1070268368 10:74926890-74926912 CTGTGTCAATCCTTCATTTTCGG + Intronic
1070687299 10:78496797-78496819 CTAGATCACTCCTACATTGCTGG + Intergenic
1078687324 11:13545681-13545703 CAAAGTCACTCCTACATTTTTGG - Intergenic
1078963307 11:16305434-16305456 CTGGATCACTCATACATTGTGGG + Intronic
1079054303 11:17192270-17192292 CAAGCTAAATCCAACATTGTGGG + Intronic
1081307053 11:41525792-41525814 CTATATCAGTCATACATTGTTGG + Intergenic
1081330265 11:41792637-41792659 CTGGATCAATCCCACATTGTCGG - Intergenic
1083067637 11:59941830-59941852 CTGGGTCACTCATACATTGCTGG - Intergenic
1083348778 11:62012683-62012705 CTATGTCTCTCCCACATTGTTGG + Intergenic
1083944711 11:65917459-65917481 CTAGGTCAGTTCCACGTTGTTGG + Exonic
1084449204 11:69223467-69223489 CTGGGTCACTCCTACATTGCTGG - Intergenic
1086002908 11:82002099-82002121 TTGGATCAATCCTACATTGGTGG + Intergenic
1086702412 11:89914632-89914654 CTAAGTCAATAATACATTTTGGG - Intronic
1086703755 11:89929818-89929840 CTAAGTCAATAATACATTTTGGG + Intergenic
1087455744 11:98383910-98383932 CTGGATCAATCCTACATTGTTGG - Intergenic
1090715672 11:129428540-129428562 CTGGGTCAATGCTACTTTGTTGG + Intronic
1092446929 12:8566728-8566750 CTGAATCAATCCTACAATGTTGG + Intergenic
1092821635 12:12358391-12358413 CTAGTTCAGACCTACATTCTGGG + Intronic
1093193126 12:16098026-16098048 CCAGATCAAACCTACAATGTAGG + Intergenic
1093369946 12:18354487-18354509 ATGGATCAATCCTACACTGTTGG + Intronic
1093881563 12:24409652-24409674 CTAGCTCATTCAGACATTGTTGG - Intergenic
1094341469 12:29416681-29416703 CTAGGTCACTCACACATTGCTGG + Intronic
1094687002 12:32727570-32727592 CTAGGTCAATGCCAAATTTTAGG - Intronic
1099753562 12:86809497-86809519 CTGGGTCAATCATATATTGCTGG - Intronic
1101216994 12:102595049-102595071 CTGGATCAATCCTACACTGTTGG + Intergenic
1101455482 12:104826412-104826434 CTAGGTCAATCCTACATTGTCGG - Intronic
1102203791 12:111076363-111076385 CTAGGTCATCTCTACATGGTAGG - Intronic
1108250267 13:48559881-48559903 CAGGATCACTCCTACATTGTTGG + Intergenic
1109378178 13:61524661-61524683 CTGGATCAATCCTACCCTGTTGG + Intergenic
1111367552 13:87269162-87269184 CTAGGTCAATCCTCCTTCCTAGG + Intergenic
1111468419 13:88646339-88646361 CTAGATCAATCCTACAATGTTGG - Intergenic
1112527595 13:100166864-100166886 CTAGTACACTCATACATTGTTGG - Intronic
1115302817 14:31903359-31903381 CTAGGTCAAACCTACATGCAGGG + Intergenic
1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG + Intronic
1120744991 14:88144785-88144807 CTAGATCAATCCTACATTGTTGG - Intergenic
1120745059 14:88145148-88145170 CTGGATCAATCCTATATTGTTGG - Intergenic
1122642119 14:103166080-103166102 ATGGATCAATCCTACACTGTCGG - Intergenic
1124455608 15:29839860-29839882 CTGGATCACTCCTACATTGGTGG - Intronic
1125347683 15:38734547-38734569 CTAGGAGAATCCTACATTCCAGG + Intergenic
1131896279 15:97034171-97034193 CTGGATCATTCCTACATTGCTGG + Intergenic
1132097602 15:98999458-98999480 CTAGGTCACTCACACATTGCTGG + Intronic
1138223666 16:55274489-55274511 CTGGGTCACTCAGACATTGTTGG + Intergenic
1144953636 17:19007133-19007155 CTGGATCACTCATACATTGTTGG - Intronic
1155839854 18:30631222-30631244 CTGGATCAATCCTACAATGTTGG + Intergenic
1160278769 18:77466279-77466301 CTGGGTCACTCATACATTGCTGG - Intergenic
1161780546 19:6288973-6288995 CTGAATCAATCCTACAATGTTGG - Intergenic
1166217237 19:41343651-41343673 CTAGGTCATTCCTGCCTGGTGGG + Intronic
1167089943 19:47337031-47337053 CCAGGTCACTCTGACATTGTGGG + Intronic
1168279086 19:55294427-55294449 CTAGATCAATCCCACCTGGTGGG + Intronic
932958367 2:76383045-76383067 ATAGGTCAATCATATTTTGTAGG - Intergenic
933762825 2:85684960-85684982 CTAGGTTCATGCCACATTGTTGG - Intergenic
935049956 2:99517074-99517096 CTAGATCACTCATGCATTGTTGG - Intergenic
935348616 2:102133580-102133602 CTAAGCCAATCTTACATTCTTGG - Intronic
935822010 2:106902910-106902932 ATGGATCAATCATACATTGTTGG - Intergenic
942913536 2:181275421-181275443 TTAGGTCAAGCCCATATTGTGGG + Intergenic
943383417 2:187176296-187176318 CTGGATCAATCCTACCATGTTGG + Intergenic
945382209 2:209154364-209154386 CTAGGCCTTTCCTACAGTGTAGG + Intergenic
946244514 2:218379226-218379248 CCATGTAAATCCTAAATTGTGGG - Intergenic
1175963112 20:62647008-62647030 CTCAGACAATCCTTCATTGTCGG + Intronic
1177457569 21:21361945-21361967 ATAGGTAAATTGTACATTGTGGG + Intronic
1177513737 21:22121867-22121889 CTGGATCAATCCTACACTGTTGG - Intergenic
1179917757 21:44488794-44488816 CTGGATGAATCCTACACTGTCGG - Intergenic
1182323595 22:29494556-29494578 CTAGGTCAGGCCTACATTGAAGG - Intergenic
951604948 3:24422757-24422779 CTATGTCACCCCTTCATTGTTGG - Intronic
951942498 3:28095109-28095131 CTAATTCAAACTTACATTGTTGG + Intergenic
956410074 3:68970132-68970154 CAAGGGCAATTCTACATTGATGG - Intergenic
958632608 3:96701899-96701921 CTGGATCAATTCTACATTGTCGG - Intergenic
960480153 3:118178148-118178170 TTCAGTCAATCCAACATTGTAGG + Intergenic
961343390 3:126245429-126245451 CTGGATCAATCCTACAGTGTCGG + Intergenic
965300507 3:167000521-167000543 CTGGATCAATCCTACACTATTGG + Intergenic
966098359 3:176234704-176234726 TTAGGTCTCTCCTACATTATTGG + Intergenic
967421451 3:189277771-189277793 CGAGTCCAATCCCACATTGTTGG + Intronic
967608550 3:191477369-191477391 CTAGAGCAATATTACATTGTGGG + Intergenic
968174248 3:196535495-196535517 CTGAGTCACTCCTACATTGGTGG - Intergenic
970167823 4:13258405-13258427 CTTGGTCAAACCCACATTCTAGG - Intergenic
972892273 4:43573459-43573481 CTCGAGCAATCCTACAATGTTGG - Intergenic
972918159 4:43905330-43905352 CTGGATCAACCCTACATTGTCGG - Intergenic
974754450 4:66185299-66185321 CTAAGTCACTTCCACATTGTAGG + Intergenic
977389365 4:96388396-96388418 CTGGCTCAATCCCACACTGTGGG + Intergenic
980716788 4:136638417-136638439 CTGGATCAATCCTACATTGTCGG - Intergenic
981012610 4:139941060-139941082 CTAGACCAAATCTACATTGTAGG - Intronic
983609640 4:169628674-169628696 CTGGATCACTCATACATTGTTGG + Intronic
984081575 4:175254463-175254485 CTGGATCAATCCCACATTGTTGG - Intergenic
985132472 4:186752502-186752524 CTAGGACACTCCTACTTGGTCGG - Intergenic
986365019 5:7021090-7021112 CTGGATCAATCCTACATTGTCGG + Intergenic
987952118 5:24688446-24688468 CTAGGTCCCTCCTACGTTGGAGG + Intergenic
988604436 5:32667641-32667663 CCGGATCAATCCTACAGTGTTGG + Intergenic
989820953 5:45795626-45795648 CTGAATCAATCCTACAGTGTTGG - Intergenic
990600256 5:57351306-57351328 CTGAGTCACTCCTACATTGCTGG - Intergenic
995122432 5:108550478-108550500 CTAGGTGAATTGAACATTGTTGG + Intergenic
997024880 5:130047439-130047461 CAAGTTAAATACTACATTGTAGG + Intronic
1002840016 6:897351-897373 CAAGGTGAATCCTGCATAGTGGG + Intergenic
1002843074 6:922718-922740 CTGGATCAATCCTGCACTGTCGG - Intergenic
1003300451 6:4876453-4876475 CTAGGACATTCATACATCGTTGG - Intronic
1004406550 6:15338555-15338577 CTGGATCAATCCTATATTGTCGG - Intronic
1007715718 6:43854969-43854991 CCAGTTCAATTCTACCTTGTTGG + Intergenic
1009242917 6:61201829-61201851 CTGAATCAATCCTACAATGTTGG + Intergenic
1009725396 6:67531078-67531100 CTGGATCAATCCTACGTTGCTGG + Intergenic
1012439920 6:99253395-99253417 CTGGATCAATCCTACACTGTCGG - Intergenic
1013775779 6:113676926-113676948 CTAGGTCCAGCCTACACTGAAGG - Intergenic
1014277117 6:119399672-119399694 CTGGATCAATCCTACACTGTTGG + Intergenic
1015502622 6:133950204-133950226 CTAGGCCAGTTCTACATTTTAGG + Intergenic
1015603863 6:134936312-134936334 TTAGGTCAGTCCTGGATTGTAGG + Intronic
1016726027 6:147368337-147368359 TTAGGTCAATCCTACTTTCCTGG - Intronic
1017115795 6:150975406-150975428 CTTGGTCAAGCCTGCACTGTGGG + Intronic
1017273952 6:152543945-152543967 CTAGGTGAATTCATCATTGTGGG - Intronic
1018643331 6:165925272-165925294 CTAGATCACTCGTACATTGCTGG + Intronic
1020845699 7:13279272-13279294 CTAGATCACTCATACATTGCTGG - Intergenic
1022957142 7:35391259-35391281 CTAGTCCAATCCTACATGGAGGG - Intergenic
1023634575 7:42197042-42197064 CTAAGTCAGGGCTACATTGTAGG - Intronic
1024264845 7:47598649-47598671 CTAGATCAATCCTACACTGTCGG - Intergenic
1037732522 8:21539756-21539778 CTGGCTCACTCATACATTGTTGG - Intergenic
1039200273 8:35083528-35083550 CTTCATAAATCCTACATTGTAGG + Intergenic
1041935104 8:63324783-63324805 CTGGATCGATCCTACATTGTCGG - Intergenic
1044523704 8:93227821-93227843 CTGGATCACTCCTACATTGCTGG - Intergenic
1044600827 8:94002922-94002944 CTAGATCTCTCATACATTGTTGG - Intergenic
1046138651 8:110062235-110062257 CTGGATCAATCCTACATTGTTGG - Intergenic
1046264157 8:111809427-111809449 CTAGATCACTCATACATTGCTGG - Intergenic
1046860800 8:119089256-119089278 CTAGGTCATGCCTACAATTTTGG + Intronic
1047835898 8:128690448-128690470 CTAGATTACTCATACATTGTAGG - Intergenic
1049076155 8:140397938-140397960 CCAGGTCCCTCCTACAATGTGGG - Intronic
1052396750 9:27948483-27948505 ATATGTAAATCCTACACTGTAGG + Exonic
1055375725 9:75647007-75647029 CTGGATGAATCCTACACTGTTGG + Intergenic
1056444301 9:86650021-86650043 CCAGGTCACTCATACATTGCTGG - Intergenic
1056739384 9:89240891-89240913 CTGAGTCACTCCTACATTGCTGG + Intergenic
1056955870 9:91080648-91080670 CTGGGTCACTCCTACACTGCTGG + Intergenic
1058834221 9:108846947-108846969 CTGGGTCACTCATACATTGCTGG - Intergenic
1060174918 9:121490580-121490602 CTAGGTCAGTCCTGCATTCCAGG - Intergenic
1188249386 X:27874071-27874093 CTAGATCACTCATACATTGCTGG - Intergenic
1189761953 X:44330911-44330933 CTAGATCACTCATATATTGTTGG + Intronic
1194196166 X:90895295-90895317 CCAGGTCATTCCAAAATTGTAGG + Intergenic
1196314985 X:114211736-114211758 CATGGTCAATCCCACATTTTTGG + Intergenic
1198318992 X:135499587-135499609 CTAGTTCATTCATACATTGCTGG - Intergenic
1198328188 X:135595538-135595560 CTAGGTGAATGCTTCCTTGTGGG - Intergenic
1199813847 X:151379059-151379081 CTAGGTCTAGCCCACATTCTAGG - Intergenic
1200542010 Y:4469487-4469509 CCAGGTCATTCCAAAATTGTAGG + Intergenic
1201241389 Y:11960230-11960252 CTAGGTGGATGCTACATTGTTGG - Intergenic