ID: 1101456457

View in Genome Browser
Species Human (GRCh38)
Location 12:104836644-104836666
Sequence GAGTCCATCTGGAAACCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101456457 Original CRISPR GAGTCCATCTGGAAACCTGA AGG Intronic
900706898 1:4086614-4086636 GAGGCCTTCTGGAAAACAGAAGG - Intergenic
901092773 1:6653274-6653296 CAGTCCCCCTGGAACCCTGATGG - Intronic
902413510 1:16225847-16225869 CAGGCCATGTAGAAACCTGAAGG + Intergenic
903328955 1:22587315-22587337 GTGTACATCTGGGTACCTGAAGG + Intronic
904877440 1:33667169-33667191 GAGGCCATGTGAAATCCTGAGGG + Intronic
904965590 1:34370035-34370057 AAGGAAATCTGGAAACCTGAGGG - Intergenic
906572875 1:46859667-46859689 GCGTCCATCTGGAAAGGTAATGG + Intergenic
906598893 1:47106226-47106248 GCGTCCATCTGGAAAGGTGATGG - Exonic
910121712 1:83797672-83797694 GAGACCATATGGAAACATGGGGG + Intergenic
911404538 1:97420211-97420233 GAGTCCAGCTGGAACCTAGAGGG + Intronic
913159575 1:116132950-116132972 GAGACCAGCTGGTAAACTGAAGG + Intronic
913691275 1:121282125-121282147 TACTCCCTCTGGAACCCTGAAGG - Intronic
913692384 1:121291361-121291383 GTCTCCACCTGGATACCTGATGG - Intronic
914146268 1:144997856-144997878 TACTCCCTCTGGAACCCTGAAGG + Intronic
915988005 1:160485620-160485642 GAGTGCATTGGGAAACCTGCAGG + Exonic
920478599 1:206300601-206300623 TACTCCCTCTGGAACCCTGAAGG - Intronic
920479704 1:206309718-206309740 GTCTCCACCTGGATACCTGATGG - Intronic
921511868 1:216041504-216041526 GATTCTATATGGAAACCTAAAGG + Intronic
922160944 1:223078860-223078882 GAGGCCCTCAGGAAACCTGGGGG + Intergenic
1066441154 10:35440229-35440251 GAGACAATCTGCAAACATGAAGG - Intronic
1072206260 10:93207746-93207768 AAGACCAGCTGGAAACCTGGAGG + Intergenic
1072570919 10:96656827-96656849 GACTTCACCTGGGAACCTGATGG - Exonic
1072583878 10:96764429-96764451 TACTGCATCTGGAAACCTGGTGG + Intergenic
1073093656 10:100966980-100967002 GATTCCATTTGGAAACCTTCTGG - Intergenic
1075086723 10:119418781-119418803 GAGACCACCTGGTGACCTGAGGG + Intronic
1075530992 10:123229721-123229743 GAGTCCTTCTGGAAACCCTTTGG - Intergenic
1078172652 11:8940520-8940542 AAGGCCATATTGAAACCTGAGGG - Intergenic
1078186299 11:9054597-9054619 CAGTCCATCAGGAAACCTCGAGG - Intronic
1078422272 11:11222388-11222410 GATTCCATTTGGAAGCCTGTTGG - Intergenic
1079612537 11:22451128-22451150 CAGTTTATCTGGAAACCTCAAGG + Intergenic
1080691657 11:34563767-34563789 GAGTCTAACTGGAAGCCAGAGGG + Intergenic
1084791600 11:71478448-71478470 GATTTCATCTCGAAACCTGGCGG + Exonic
1085713969 11:78855421-78855443 GAGTCAATGTGTAACCCTGAAGG + Intronic
1086849594 11:91793622-91793644 GATAGGATCTGGAAACCTGACGG + Intergenic
1089131438 11:116215384-116215406 GATTCCATCAGGCAACCTTAGGG + Intergenic
1089398432 11:118150870-118150892 GAGTCCCTCTGCAGACCAGAGGG + Intronic
1090366069 11:126206722-126206744 AAGTCCATCTGGGTACCTGGTGG + Intronic
1090905090 11:131067926-131067948 GAGACCAACTGGACACTTGAAGG + Intergenic
1091301009 11:134508289-134508311 GAAACCAGCTGGAAGCCTGAGGG - Intergenic
1092236898 12:6816049-6816071 GAGGCCTTCTGGAAAGCTGGAGG - Exonic
1093806034 12:23434387-23434409 GAATCCAACTGGAAGCCAGATGG - Intergenic
1095225281 12:39671629-39671651 AATGCCACCTGGAAACCTGAGGG - Intronic
1099482961 12:83191288-83191310 GTGACAAACTGGAAACCTGAGGG - Intergenic
1101456457 12:104836644-104836666 GAGTCCATCTGGAAACCTGAAGG + Intronic
1102241940 12:111329943-111329965 GGGGCCAGCTGGAAAACTGACGG - Intronic
1102295535 12:111733738-111733760 GAGTCCAGCTGGAAGCCAGAGGG + Intronic
1102332833 12:112049666-112049688 TAGTCCTTCTTGAAACCTGCAGG - Intronic
1103636952 12:122314726-122314748 GAGTCATTTTGCAAACCTGAAGG - Intronic
1104222486 12:126798482-126798504 GAGGCCACCTGGACACCTGTGGG + Intergenic
1115084922 14:29503202-29503224 GAGTCCATAAGTAAACATGAGGG - Intergenic
1122094877 14:99363467-99363489 GGTTCAGTCTGGAAACCTGAAGG - Intergenic
1122374314 14:101248240-101248262 GAGCCCAGCTGGAATCCTGGAGG + Intergenic
1127476565 15:59339358-59339380 GTCTCCATTTGGAAACCAGAAGG - Intronic
1127829337 15:62736841-62736863 GAGTCTAATTGGAAATCTGATGG + Intronic
1130578854 15:85117086-85117108 GTGGCCAGCTGGAAACCTCAGGG + Intronic
1130646462 15:85731528-85731550 GAATCCAGCTGCAAATCTGAAGG - Intronic
1133224311 16:4333340-4333362 GAGTTCAGCAGGAAGCCTGAGGG - Exonic
1135622601 16:23968600-23968622 GAACCCAGCTGGAAACCAGAAGG + Intronic
1140226298 16:73080075-73080097 GAGTCAAACTGGAAACAGGAAGG - Intergenic
1143760122 17:9096142-9096164 GAAACCATGTGGATACCTGATGG - Intronic
1144003332 17:11075960-11075982 GTGGCCGTCTGTAAACCTGAAGG - Intergenic
1145006137 17:19339041-19339063 GAGGCCATCTGGGATCATGATGG + Intronic
1145870925 17:28272348-28272370 GAGTTCATCTGGACTTCTGAAGG + Intergenic
1146991589 17:37278502-37278524 GAGTTTATCTGGAATACTGAGGG + Intronic
1147266434 17:39237476-39237498 GGGCCAATCTTGAAACCTGAGGG + Intergenic
1151407762 17:73900584-73900606 GAGCCCATCTGGAAAACTGTGGG - Intergenic
1154331404 18:13432046-13432068 GAATCCCTCTGGGAACCTGAGGG - Intronic
1155346214 18:24859754-24859776 GAAGCCAGCTGGAAGCCTGAGGG + Intergenic
1156757936 18:40551339-40551361 TATTCCTTCTGGAAACCTTAGGG + Intergenic
1159996329 18:74969003-74969025 GATACCATCAGCAAACCTGAGGG - Intronic
1160006631 18:75073313-75073335 GAGTCCCTCCTGGAACCTGAGGG + Intergenic
1161698764 19:5784038-5784060 GGGGCCATCTGGAAACCTGTGGG + Exonic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1168193393 19:54756152-54756174 GAGTCCTTCTCCAAACCTTAGGG + Intronic
1168593362 19:57654584-57654606 CTGGCCATCTGGAAAGCTGATGG + Intergenic
926569322 2:14512144-14512166 CATTCCTTCTGGAGACCTGAGGG + Intergenic
928364366 2:30690066-30690088 GAGTTCATCTGGAATCCCCAAGG + Intergenic
929323590 2:40577798-40577820 GAGTCCATTTGGAAACTAGAAGG + Intronic
933780022 2:85794959-85794981 GGGTCCCTCTGGGAACCCGAAGG + Intergenic
934553467 2:95275844-95275866 GAGTCCAGAGGGAAACCAGAAGG - Intronic
937664164 2:124465277-124465299 TAGTCCATCTGGTAACTTGCTGG - Intronic
937982539 2:127623933-127623955 GAGCCCGTGTGGACACCTGAAGG - Intronic
939838971 2:147164690-147164712 TGTGCCATCTGGAAACCTGAGGG - Intergenic
940149871 2:150588024-150588046 GATGCCATTTGGTAACCTGAAGG - Intergenic
944847204 2:203680964-203680986 GAGCCCAGCTGGAAGCCAGAAGG + Intergenic
946822749 2:223647239-223647261 GAGGCTGGCTGGAAACCTGATGG + Intergenic
1172094188 20:32452657-32452679 GACTTCATCTGGAGACCAGAGGG - Intronic
1172385327 20:34530120-34530142 GAGTTCATGTGGAAGCCTGGGGG - Intronic
1173317871 20:41961305-41961327 GAACCCATCTGGAAACCAGAAGG - Intergenic
1177222450 21:18211565-18211587 CAATCCATCTTGAAACCTGTGGG - Intronic
1179203337 21:39247903-39247925 AAATCCTTCTGGAAACTTGACGG - Intronic
1179290660 21:40015211-40015233 GTGTCCATCTGGAATTCTGAAGG + Intronic
1183950270 22:41348836-41348858 GAATCAAGCTGGAAACCTGAGGG + Intronic
1184805324 22:46791707-46791729 GAGTAAATTTGGAAAACTGATGG - Intronic
953815836 3:46155380-46155402 GAGTCCATGGGGAAACCAGAAGG + Intergenic
954502602 3:51032988-51033010 TAGTCCATCTTGAGAACTGAGGG + Intronic
954634632 3:52064878-52064900 GAGCCCACCTGGGAGCCTGAGGG + Intergenic
957595972 3:82266821-82266843 AAGTCCATCTGTCAACCTTAAGG + Intergenic
957805267 3:85140109-85140131 GAGCCCATCTTTTAACCTGATGG - Intronic
959413703 3:106058498-106058520 GTGGCAATCTGGAAACCTAAAGG + Intergenic
959474265 3:106790374-106790396 GAGGCCATCAGTAAACATGAAGG + Intergenic
963263347 3:143214687-143214709 GAGACCAACTGGAATCCTGGAGG + Intergenic
963501320 3:146130909-146130931 AAGACCATCTGGAAACCATATGG - Intronic
964543544 3:157806878-157806900 GAGTCCATCTGGCAAGAAGAAGG + Intergenic
968345043 3:197996394-197996416 AAGTGCATCTGGAGAGCTGAAGG - Intronic
968600682 4:1507883-1507905 GAGTCCATGTGGAAAAGTGGAGG - Intergenic
969592234 4:8128523-8128545 GAGTACATCTGGTAACCAGCAGG - Intronic
970036457 4:11741190-11741212 ATGTCCATCTGGAAACCTTCAGG - Intergenic
972939231 4:44177220-44177242 GAATCCATCTGAAAGCCAGAAGG - Intronic
974980512 4:68951286-68951308 GATTCCCTGTGGAGACCTGATGG - Exonic
978354747 4:107859781-107859803 GTGTCCATCTGCCATCCTGAAGG - Intronic
981003976 4:139856002-139856024 AGGTCCATCTGGAGTCCTGAGGG - Intronic
983503554 4:168527785-168527807 TAGCCCAACCGGAAACCTGAAGG - Intronic
986303998 5:6501934-6501956 TAGACCACCTGGACACCTGAGGG - Intergenic
987374445 5:17219826-17219848 GCGTCCAGATGGAAATCTGATGG + Intronic
988262821 5:28910760-28910782 AAGCCCATCAGGTAACCTGAGGG + Intergenic
988788333 5:34584535-34584557 GAATCCATCTGGAAGCCAGAGGG - Intergenic
988991702 5:36677827-36677849 TAGGCCATCAGGAAAACTGAGGG + Intronic
992232042 5:74672976-74672998 GAATCCATCTGGAAACATTTTGG - Intronic
994218242 5:97163460-97163482 GTGTCCATCATGAAAACTGATGG + Intronic
994814092 5:104561793-104561815 AAGTACATATGGAAATCTGAGGG - Intergenic
998472033 5:142390872-142390894 GATTCTTTCTGGAAACCTAATGG - Intergenic
1000632796 5:163610162-163610184 GGGTAGATTTGGAAACCTGAGGG + Intergenic
1002048140 5:176553482-176553504 GAATCCATCTTGATACCTGCTGG + Intronic
1005764472 6:28997307-28997329 GAATACAGTTGGAAACCTGATGG + Intronic
1006574339 6:35033271-35033293 AAGTCCTTCTGGAGACCTGTGGG - Intronic
1006963984 6:37963053-37963075 GAGTACATCTGAACACCTGAAGG + Intronic
1007420496 6:41716383-41716405 GAGGCCAACTGGACCCCTGAGGG + Intronic
1008426581 6:51365136-51365158 GAAACCAGCTGGAAACCTGAAGG + Intergenic
1010355310 6:74925711-74925733 GAGCCCAGCTGGAAGCCAGAGGG - Intergenic
1010768880 6:79805951-79805973 AAATCCATCTGGAAGCCAGAGGG + Intergenic
1011559085 6:88597005-88597027 CATTCCATCTGGAAACAGGAGGG + Intergenic
1012952198 6:105530178-105530200 CAGTTCATCTGGAAGCCAGAGGG + Intergenic
1014629315 6:123770069-123770091 GAGACAAACTAGAAACCTGAAGG - Intergenic
1014975424 6:127875492-127875514 GAGTCCCTCTGGAAGTCTCAAGG - Intronic
1018132997 6:160750138-160750160 GGGAACATCTGGAAACATGAAGG - Intronic
1021999880 7:26216431-26216453 GAGTCCAGCTAGGAGCCTGAGGG - Intergenic
1022439463 7:30421288-30421310 CAGTCAATCTGGAAACTTGAAGG + Intergenic
1026067516 7:67088409-67088431 GAGCCCTTCTGGAAAACTGGTGG + Intronic
1027386870 7:77667446-77667468 GCGTCCATCTGGAACACTGGTGG + Intergenic
1028041436 7:86059012-86059034 GTGTTGATCTGGAAACTTGAAGG + Intergenic
1028285813 7:88997636-88997658 GCAGCCACCTGGAAACCTGAAGG + Intronic
1030129796 7:106189295-106189317 CAGTACATCAGGAAATCTGAAGG + Intergenic
1032838803 7:135697872-135697894 GCGACCATGTGGAAACCTGAAGG - Intronic
1032943570 7:136823937-136823959 GAATCCACCTGAAAACTTGAAGG + Intergenic
1033514094 7:142089243-142089265 GAGGCAATTTGGAAATCTGAGGG + Intronic
1035488994 7:159255580-159255602 AAGTCAACCTGGCAACCTGAAGG + Intergenic
1035896243 8:3405804-3405826 GGGTCCTTCTGGAACTCTGAGGG - Intronic
1037549591 8:19957295-19957317 GAATCCAGATGGAAACCTGAGGG + Intronic
1037985613 8:23288891-23288913 CAGTCCATCTGGGACCCAGAGGG + Intronic
1039481567 8:37877400-37877422 GAATCCATTTGGAAAGCTGAAGG - Exonic
1039758656 8:40550183-40550205 GACCCCTTCTGGAAACCAGAGGG + Intronic
1040008449 8:42640815-42640837 AAGCCCAGCTGGAAACCAGAGGG + Intergenic
1040859662 8:51986047-51986069 GTGGCCATCTGCAAACCAGAAGG + Intergenic
1041128165 8:54666640-54666662 GAGTACATCTGGAAGCCTAGAGG - Intergenic
1041364079 8:57083100-57083122 GAGTCAATCTGGAGAGCCGAGGG + Intergenic
1042642944 8:70955606-70955628 TTTTCCATCTGGAAACCTGTGGG + Intergenic
1043100840 8:76043231-76043253 GGGTCCATGTGGAAAGATGAGGG + Intergenic
1043750469 8:83927419-83927441 GATTCCATTTGCAAACCTCATGG - Intergenic
1043764136 8:84107726-84107748 CAGTCCCTCTGGAAAGCTTATGG + Intergenic
1044522332 8:93213135-93213157 GAGTACAGCTGAAAACTTGAAGG + Intergenic
1046769101 8:118100798-118100820 CAGTCAACCTGGGAACCTGAAGG + Intronic
1049814553 8:144592250-144592272 CAGACCCTCGGGAAACCTGAGGG + Intronic
1049814568 8:144592299-144592321 CAGACCCTCGGGAAACCTGAGGG + Intronic
1049814583 8:144592348-144592370 CAGACCCTCGGGAAACCTGAGGG + Intronic
1049814614 8:144592446-144592468 CAGACCCTCGGGAAACCTGAGGG + Intronic
1049814657 8:144592591-144592613 CAGACCCTCGGGAAACCTGAGGG + Intronic
1049814672 8:144592640-144592662 CAGACCCTCGGGAAACCTGAGGG + Intronic
1049814687 8:144592689-144592711 CAGACCCTCGGGAAACCTGAGGG + Intronic
1051996255 9:23221102-23221124 GAGGCCATCTGGGCTCCTGAGGG + Intergenic
1052502836 9:29314642-29314664 GATTCCCTATGGAAACATGAAGG + Intergenic
1056021471 9:82442231-82442253 GAGACCATTTGCAAAACTGAGGG - Intergenic
1056412697 9:86347472-86347494 GAGTTCCTCTGAAAACTTGATGG - Intronic
1056877384 9:90347594-90347616 GAGTCAAGCAGGAAACCAGAGGG + Intergenic
1060439798 9:123627821-123627843 GAGGCCAGCAGGAAACCAGAGGG + Intronic
1060735554 9:126064543-126064565 AAATCCATCAGGAAACTTGAGGG - Intergenic
1060987376 9:127827501-127827523 GAGTGACTCTGGAAAGCTGAAGG + Intronic
1061850929 9:133414818-133414840 CTGTCCATCTTGGAACCTGAAGG + Exonic
1185558434 X:1039767-1039789 GAGTCCAACTGGGAAACTGGAGG - Intergenic
1186518444 X:10185053-10185075 GAGTGGCTCTGGAAACCTGATGG + Exonic
1187119725 X:16392571-16392593 GAGACCATCTTGACACCTGATGG - Intergenic
1188124834 X:26354388-26354410 GGGTCCATCTCCAAACCTCAGGG + Intergenic
1190490658 X:50979523-50979545 CAGTCCATCTGGAAAAAGGAAGG - Intergenic
1191697607 X:64005787-64005809 GAGACCATTTTGAAACTTGAAGG - Intergenic
1194244255 X:91492412-91492434 GAGTCCACCAGAAATCCTGAAGG - Intergenic
1199444791 X:147910173-147910195 GAATCCAGCTGAAAACCTTAAGG + Intergenic
1200424698 Y:3008160-3008182 GACTCCACCTGGAAACCAAAGGG + Intergenic
1202170151 Y:22034829-22034851 GAGTTCCTCTGGAAACATGGCGG + Intergenic
1202221215 Y:22551544-22551566 GAGTTCCTCTGGAAACATGGCGG - Intergenic
1202321900 Y:23644118-23644140 GAGTTCCTCTGGAAACATGGCGG + Intergenic
1202548867 Y:26025938-26025960 GAGTTCCTCTGGAAACATGGCGG - Intergenic