ID: 1101464474

View in Genome Browser
Species Human (GRCh38)
Location 12:104933906-104933928
Sequence CTGGAGACTCAGAAAGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1018
Summary {0: 4, 1: 11, 2: 68, 3: 216, 4: 719}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101464474 Original CRISPR CTGGAGACTCAGAAAGGGGG AGG Intronic
900137204 1:1122606-1122628 CTGGCGACTCAGCGAGGTGGGGG + Intergenic
900476903 1:2880250-2880272 GTGGAGGCTCAGGGAGGGGGCGG + Intergenic
901064515 1:6488580-6488602 CTGGGTACTCAGCAAGGGTGGGG + Intronic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
901948388 1:12721834-12721856 CTGGAGCCTCAAAGAGGGCGTGG + Intronic
902409739 1:16205902-16205924 CTGGGGGCTCTGAAAGGGGCGGG - Intronic
902553940 1:17235682-17235704 ATGCAGACTCAGGAAGGGGAGGG + Intronic
903281109 1:22250485-22250507 CTGGTGACTCAGATGGGGAGGGG + Intergenic
903734725 1:25522860-25522882 CTGGAGGCTCAGAGAGGGCAAGG - Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903950063 1:26991515-26991537 GTGGAGACTCAGTGAGGGGAAGG - Intergenic
904756362 1:32770795-32770817 CTGGTGGCTCAGAAGGGGCGGGG + Exonic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
904913112 1:33950084-33950106 CTGGAGCCTGAGCAATGGGGTGG - Intronic
904940878 1:34164444-34164466 TTGCAGACGCAGAAATGGGGAGG + Intronic
905123677 1:35702324-35702346 AAGGAGGCTCAGAAAGGGGCAGG + Intergenic
905233558 1:36530290-36530312 CTGGAGACTGAGGCAGGGCGGGG - Intergenic
906077581 1:43063342-43063364 ACCGAGACTCAGAAAGGGGCAGG + Intergenic
906310931 1:44753918-44753940 CTGGAGCCTCAGAAATGCTGGGG - Intronic
906681059 1:47725640-47725662 CTGAGGGCTCAGAAAGGGGAAGG - Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906994254 1:50773315-50773337 CTGCAGACTCAGAAGTGGGATGG - Intronic
907941557 1:59093229-59093251 CTGGAGACAGGGTAAGGGGGAGG + Intergenic
907944922 1:59127115-59127137 CTGAAGACACAGAAAGGTGTGGG + Intergenic
908336164 1:63126126-63126148 CTGAAGAGTCAGATAGGAGGAGG - Intergenic
908595038 1:65678937-65678959 TTGGAGACTCAGAATAGGAGAGG - Intergenic
908771778 1:67603921-67603943 TTGGAGACTCAGAAATGGGGAGG + Intergenic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909416265 1:75409168-75409190 CTGGAGACTCTAAAAGATGGGGG + Intronic
909940133 1:81602059-81602081 CTTGAAACTCAGGAAGGGGCAGG - Intronic
910086935 1:83414212-83414234 TTAAAGACTCAGAAAGGGGTGGG + Intergenic
910393244 1:86765689-86765711 CTGGAGACTAATATAGGGGGAGG - Intergenic
910839227 1:91546038-91546060 CAGGAACCTCAGAAAGGAGGGGG - Intergenic
911709120 1:101048895-101048917 CTGGGGACTCCAAAAGGGGGAGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912262221 1:108121634-108121656 CAGGAGCCTCAGGAAGGGGAGGG + Intergenic
913076786 1:115346973-115346995 CTGAAGTCTCAGAAATGAGGTGG - Intergenic
915145443 1:153793780-153793802 CTGGAAGCTGAGAAAGGGGCGGG + Intergenic
915565123 1:156708661-156708683 CTGGAGACTCAGTGAGGGGAGGG + Intergenic
916091044 1:161308243-161308265 CTGGAGAGTCAGGAAGGGAAGGG + Intronic
916375578 1:164149814-164149836 TTGGAGATTCTAAAAGGGGGAGG + Intergenic
916415389 1:164587883-164587905 CAGGAGATTCAGAAAAGGGGTGG - Intronic
916453244 1:164941860-164941882 TTGGAGACTCTGAAGGGAGGAGG - Intergenic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917443627 1:175088257-175088279 GGGTAGCCTCAGAAAGGGGGTGG - Intronic
917917569 1:179718878-179718900 CTGGAGACTCCAAAAGGGGAGGG - Intergenic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918941779 1:191009198-191009220 CTGGAGACTCCAAAAGGGTAGGG - Intergenic
918997574 1:191781905-191781927 CAAGAGACTCAGAATAGGGGAGG - Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919613993 1:199782164-199782186 TTGGAGACTGAGAAGAGGGGGGG + Intergenic
919778300 1:201207894-201207916 GTGGAGTCTGAGGAAGGGGGTGG + Exonic
919804307 1:201371987-201372009 GTGGAGAGCCAGAAAGGGGCAGG - Intronic
920268121 1:204742208-204742230 AAGGAGACTCTGAAAGGTGGAGG - Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920894667 1:210034596-210034618 CTGAAGATTCAGAAAAGTGGAGG - Intronic
920990599 1:210935353-210935375 CTAGAGACTGAGAAGGGGAGAGG + Intronic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922456149 1:225775211-225775233 CTGGTGACTCCAAAAGGGGGAGG + Intergenic
922461459 1:225817167-225817189 CTGGAGACTCAGGATGGAAGAGG - Intronic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
923060644 1:230469827-230469849 GTAGAGACTCAGAAGGGGCGGGG - Intergenic
923085346 1:230698952-230698974 CTGGAGACTCTAAAAAGGGGAGG - Intergenic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923463757 1:234230940-234230962 CTGGAGATTCCTACAGGGGGAGG - Intronic
923561108 1:235042745-235042767 GTGAAGACTCAGAACGGAGGCGG - Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
1063131956 10:3185853-3185875 CAAGGGACTCAGAAAGGGGCTGG - Intergenic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1065187739 10:23185411-23185433 TTGCAGACTCAGAAGTGGGGTGG + Intergenic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1065773422 10:29098450-29098472 CTGGGGACTAATAGAGGGGGAGG - Intergenic
1065954569 10:30682545-30682567 ATGGTGACTCAGAAAGATGGTGG - Intergenic
1066173198 10:32874439-32874461 CTGGAGGCTCAGAAGGGGAGAGG - Intronic
1066355855 10:34683224-34683246 CTGGCGACTCCAAAAGTGGGAGG + Intronic
1066463323 10:35631699-35631721 CTGGGGACTCCAAAAGTGGGAGG - Intergenic
1066471495 10:35702226-35702248 CTGGGGACTCTAGAAGGGGGAGG - Intergenic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066994790 10:42553583-42553605 TTAGAGACTCAGAAGGGGGCTGG + Intergenic
1067182079 10:43995867-43995889 CCGGAGACTCACAAGTGGGGAGG + Intergenic
1067784394 10:49233229-49233251 TGGGAGACTCAGAATGGGGGAGG + Intergenic
1067826793 10:49580218-49580240 CTGGAGTCTCTGAAAGGGCAGGG + Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1068833615 10:61526666-61526688 CTGGAGACTCAGGAGGGTGCAGG + Intergenic
1068981744 10:63070012-63070034 CTGTAGACTCAGAAAATGGTTGG + Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1070434474 10:76376154-76376176 CTGGAGGCTCCAAAAGGTGGAGG - Intronic
1071148294 10:82600948-82600970 CTGGAGACTCCAAAAGGGGTGGG - Intronic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071390686 10:85172305-85172327 CTGGAGTCTCCAAAAGAGGGAGG + Intergenic
1071435965 10:85648506-85648528 ATGGTGACTCAGAGAGAGGGAGG - Intronic
1071822354 10:89291363-89291385 CTGGAGACTGGGAAATAGGGTGG - Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1073681912 10:105714116-105714138 GTGGAGACTGAGGAAGGGAGTGG - Intergenic
1073763605 10:106657442-106657464 TTGGAGAGTCAGAAAGGGTGAGG + Intronic
1073790465 10:106934899-106934921 CTGGAAACTCAGAAAAGGGAGGG + Intronic
1074210448 10:111328269-111328291 CTGGAGACTCCGAAGGGAGTGGG + Intergenic
1074370547 10:112897736-112897758 ATGGGGACTCAGAGAGGTGGAGG + Intergenic
1074566625 10:114585253-114585275 CTGGAGACTAAAAAAGGGAAAGG - Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1074829747 10:117240518-117240540 CTGGTGACTTGGAAACGGGGGGG - Intergenic
1075232553 10:120693601-120693623 CTGGGGACTCCAAAAGGGTGGGG - Intergenic
1075690424 10:124390261-124390283 CTGGAGGCTCAGAGAGCGGAAGG - Intergenic
1075761024 10:124856774-124856796 CTGGAGCCTCAGGAAGGGAGGGG - Intergenic
1075953427 10:126501898-126501920 TCAGAGACTCAGAAAGGGGAGGG + Intronic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076290773 10:129343710-129343732 CTGGAGAGTCAAAAAGGGCTTGG + Intergenic
1076293065 10:129362316-129362338 CTGCAGACTCAGGTAGGGTGGGG + Intergenic
1076491047 10:130861956-130861978 CTGGAGACCCAGGAAGGCTGGGG + Intergenic
1076514107 10:131033533-131033555 CTGGATACGCAGAAAGATGGAGG + Intergenic
1076520926 10:131080800-131080822 CTGGAGATTCAGAAATGTGGAGG + Intergenic
1077076282 11:703629-703651 CTGGAGACGCAGGATGGGGTAGG + Intronic
1077166753 11:1145152-1145174 CTGGAGACTGGGAGAGGGGACGG + Intergenic
1077439828 11:2562624-2562646 CTGGAGACTCTGAAGAGGGGTGG - Intronic
1078019246 11:7641476-7641498 CAGGAGACACAGAAAGTGGCTGG + Exonic
1078079829 11:8195865-8195887 CTGGAGGCTCAGCTAGGGGCTGG + Intergenic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079879842 11:25913012-25913034 CTGGAGACTCAAAAGTGGGAAGG + Intergenic
1080047543 11:27825149-27825171 TTAGAGACTCAGAAAGGGCAGGG - Intergenic
1080208428 11:29756883-29756905 CTGCCAACTCAGAAAGGGGCAGG + Intergenic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082697351 11:56385730-56385752 TTAGAGACTCAGAAAAGGGGTGG + Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083159982 11:60848794-60848816 CTGGCCACTGAGAAAAGGGGTGG + Intronic
1083380000 11:62259171-62259193 CTCGGGACTCCAAAAGGGGGAGG + Intergenic
1084216389 11:67648954-67648976 CTGGAGCCTCAGCAAAGGGAGGG + Intronic
1084721357 11:70907459-70907481 CAGGAGCCTGAGAAGGGGGGAGG - Intronic
1084740527 11:71136475-71136497 CAGGAGACTCAGAAGGGTGGTGG + Intronic
1084909067 11:72373015-72373037 CTGAAGACACAGAGATGGGGAGG + Intronic
1085254998 11:75167513-75167535 CTGGAGAGTCAGAACAGGAGGGG - Intronic
1085624467 11:78061432-78061454 ACTGAGACTCAGAAAGGGAGAGG - Intronic
1085717591 11:78886688-78886710 CTGGAGAGTCAGCAAGGTGTTGG - Intronic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1087260933 11:96011554-96011576 CTGGGGACTCCAAAAGGGGGAGG + Intronic
1087567031 11:99874048-99874070 CTGGGAACTCTGAAAGAGGGAGG + Intronic
1087705591 11:101487536-101487558 TTGGAGACTTAGAAAAGTGGGGG - Intronic
1088180606 11:107104657-107104679 CTGGAGCAGGAGAAAGGGGGAGG + Intergenic
1088554126 11:111044332-111044354 AAGGAGACTCAGAAGGGTGGGGG - Intergenic
1089404757 11:118188246-118188268 CTGAGGACTCAGAAAGGGTGGGG - Intergenic
1089549099 11:119256722-119256744 TTAGAGACTCAGAAGCGGGGAGG - Intronic
1089813606 11:121152564-121152586 CTGGAGATTCAGATGGGCGGTGG + Intronic
1089910136 11:122090148-122090170 CTTGAGAATAAAAAAGGGGGAGG - Intergenic
1090733677 11:129592919-129592941 CTGGAGACTCACAGAGCAGGAGG - Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091747032 12:2999235-2999257 CTGGGGGCTCAGAATGGGGCTGG - Intronic
1091782102 12:3220435-3220457 CTGGAGAGTCAGGAAGGTGACGG - Intronic
1091810072 12:3389684-3389706 CTGGGGACACAGAAAAGGGAAGG + Intronic
1092001569 12:5036930-5036952 CTGGAGAGTCAGAGAAGGAGAGG + Intergenic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092184661 12:6470222-6470244 GTGGAGACTCGGAGAGGGCGGGG - Intronic
1092549104 12:9478384-9478406 CTGGAGACTTGGGAAGGGGTGGG + Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1092975009 12:13736303-13736325 CTTGAGAACCAGAAAGGGAGAGG - Intronic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093524297 12:20089869-20089891 CTGGGGACTCCGAAAGAGGCAGG + Intergenic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094174949 12:27531690-27531712 GTGGGGAGTCTGAAAGGGGGAGG + Intronic
1094415903 12:30214547-30214569 TTGGAAACTCAGAAGGGTGGTGG - Intergenic
1094503891 12:31044083-31044105 CTGGAGACTTGGGAAGGGGTGGG - Intergenic
1094619895 12:32069979-32070001 ATGGGGACTCAGAAGGGTGGCGG - Intergenic
1095154648 12:38837629-38837651 CTGGAGAAGCAGCAAGGGAGAGG + Intronic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1095739179 12:45588375-45588397 CTGGAGAGCCAGAAAGCTGGTGG - Intergenic
1097477657 12:60078625-60078647 TTGGAGACTCAGAAGGGGATAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097691610 12:62739384-62739406 CAGGAGAATTTGAAAGGGGGCGG + Intronic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098037934 12:66325360-66325382 CTGGAGACTCAGGCAGGGAGGGG - Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098158696 12:67626313-67626335 CTGGAGACCCAGAAAGCCAGTGG - Intergenic
1098480314 12:70950286-70950308 TTGGAGACTCAGAAGGGATGAGG - Intergenic
1098500105 12:71182168-71182190 TTGGAGACTTAGGATGGGGGAGG + Intronic
1098681142 12:73356415-73356437 CTTGAGACTGAGATAGGGAGAGG - Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099164156 12:79281519-79281541 CTGGAGACTCAAAAGTGGGAAGG + Intronic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100157983 12:91823856-91823878 GTGGAGATTCAGCAATGGGGTGG + Intergenic
1100354316 12:93814691-93814713 CTGGAGGCTCAGAGAGTTGGTGG - Intronic
1100637945 12:96453609-96453631 CTGGGGACTCCAAAAGGGGGAGG + Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101839174 12:108315618-108315640 ATGGAGGCTCAGAAAGGCTGTGG + Intronic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102066996 12:109985405-109985427 CTGGGGATTAAAAAAGGGGGGGG + Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1103361926 12:120359625-120359647 AAGGAGACTGGGAAAGGGGGAGG + Intronic
1103519859 12:121531098-121531120 GTGGAGACTCGGGAAGGAGGTGG - Intronic
1104247907 12:127060864-127060886 CAGGAGAGTCAGAAAGGAGATGG - Intergenic
1104394549 12:128421154-128421176 CTAGAGACTCGGAAGGGGAGAGG - Intronic
1104483460 12:129128755-129128777 CTGGAGACTCCCAAGGGTGGGGG - Intronic
1104536616 12:129623432-129623454 TTAGAGACTCAGAAGAGGGGAGG - Intronic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106070523 13:26406963-26406985 CTGGACAGCCAGAAGGGGGGAGG - Intergenic
1106456803 13:29934981-29935003 CTGCAGGCTCAGAAAGAGGCAGG + Intergenic
1106610491 13:31274857-31274879 CTGGGGACTCTAAAAAGGGGAGG - Intronic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108096691 13:46909118-46909140 CTGGAGACTCAGAAGTGAGGAGG - Intergenic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108976642 13:56452319-56452341 TTGGAGACTCAGAATAGGGGAGG - Intergenic
1109904385 13:68819405-68819427 CTGGAGACTCCAAAAGGAAGGGG + Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110270864 13:73588812-73588834 CTAGGGACTCCAAAAGGGGGAGG + Intergenic
1110707329 13:78609777-78609799 CTGGGGACTCCGAGAGGAGGCGG + Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111394831 13:87651779-87651801 CTGGGGACTCCAAAGGGGGGAGG - Intergenic
1112137371 13:96596101-96596123 CTGGAGATTCACAAGGGGAGAGG - Intronic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114567881 14:23645799-23645821 CTGGGGGCTCAGCAAGGTGGTGG + Intergenic
1114648809 14:24270325-24270347 CTGGAGACTCAGAAGTGCGTAGG - Exonic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116422464 14:44748793-44748815 CTAGAGACTAAGAAGGGTGGGGG + Intergenic
1116593897 14:46815378-46815400 CTGAAGACTCCAAAATGGGGTGG + Intergenic
1116693851 14:48147220-48147242 CTGGAGACTCAGAAGGGCAGAGG + Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116762786 14:49035343-49035365 CTGGAGATTCAGAAGGGTGGGGG + Intergenic
1116993654 14:51301232-51301254 CCGGAGACACAGAAAAGGGTGGG - Intergenic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1117921358 14:60728172-60728194 CTGGGGACTCCAAAAGGGGTGGG + Intergenic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118480916 14:66164589-66164611 TTGGAGACCCACAAAGGAGGAGG + Intergenic
1118918136 14:70125330-70125352 TTGGAGACTCGGAAGGGTGGGGG - Intronic
1119562164 14:75599211-75599233 CTGGAGGCACAGCATGGGGGAGG - Intronic
1119746001 14:77044407-77044429 CTGAGGACTCAGAAAAGAGGGGG - Intergenic
1119907175 14:78316437-78316459 CTGGAGATGCAGGAAGGGAGGGG + Intronic
1120075234 14:80149200-80149222 CGAGAGGCTCAGAAAGGGAGGGG - Intergenic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1120771644 14:88385945-88385967 CTGGCGACTCAGCCAGGGGTAGG - Intronic
1121784124 14:96642275-96642297 CTGGAGACTGATAAGTGGGGTGG - Intergenic
1122293725 14:100693542-100693564 CTGCAGACTCAGGCAGGGGCAGG - Intergenic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1124393643 15:29281981-29282003 CTGGGACCTGAGAAAGGGGGAGG + Intronic
1124938492 15:34195416-34195438 ATGGAGACTCAGAGAGGTAGGGG + Intronic
1125235827 15:37512380-37512402 ATGGAGGCTGAGAAAAGGGGAGG + Intergenic
1125552973 15:40561534-40561556 TTGGAGATTCAGAAGTGGGGAGG + Intronic
1126138531 15:45416393-45416415 GAAGAGACTCAGAAAGAGGGAGG - Intronic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126382147 15:48059960-48059982 CTGGAGTCTCAGGACGGGGAGGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127052475 15:55099250-55099272 CGGGAGACTCAGAAACGTGGCGG + Intergenic
1127564679 15:60175640-60175662 CTGGGGACTCAGCAAGGTGTGGG + Intergenic
1127714545 15:61636719-61636741 TTGGGGACTCAGAAGGGAGGTGG + Intergenic
1127729506 15:61786216-61786238 CTGGAGGCTTGGAAAGGGAGGGG - Intergenic
1127767425 15:62200508-62200530 TTGGAGACTCCAAAAGTGGGAGG + Intergenic
1128092024 15:64925787-64925809 GTGGAGGCTCAGAGAGGTGGAGG + Intronic
1129478217 15:75802209-75802231 CTGGAGACCCAGGCAGGGCGGGG - Intergenic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1129735560 15:77959608-77959630 CTGGAGACTCGGGCAGGGTGGGG + Intergenic
1129941654 15:79502197-79502219 GTGGAAACTCAGAGAGGGGCAGG + Intergenic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130361063 15:83186717-83186739 CTGGAGATTCAGAAGGGAAGAGG + Intronic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130680902 15:85995912-85995934 CTGGGGACTCCAAAAGAGGGGGG + Intergenic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130991232 15:88877268-88877290 ATGGAGACACAGAAAAGGGCTGG + Exonic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1131843962 15:96469164-96469186 CCTGAGATTCAGAAAGAGGGTGG + Intergenic
1132392263 15:101447604-101447626 CGGTGGACTCAGGAAGGGGGCGG + Intronic
1132435147 15:101794334-101794356 CAGGAGATTCAGATAGGGAGGGG + Intergenic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134380914 16:13725097-13725119 TTGGAGACTCAGAAATGGGGAGG + Intergenic
1134663381 16:16001013-16001035 CTGGAGATTCTGAAAGGCTGTGG - Intronic
1134740667 16:16540914-16540936 CTGGAGACTCAGAAGAGGAGAGG - Intergenic
1134926835 16:18171266-18171288 CTGGAGACTCAGAAGAGGAGAGG + Intergenic
1135194772 16:20385571-20385593 TTGGAGACTCAGATGCGGGGAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135376469 16:21951882-21951904 ATGGAGACTCCGAAAGGTGGAGG + Intergenic
1135400837 16:22165401-22165423 CTTGAGATTCTGAAAGGGGCAGG + Intergenic
1135725949 16:24854004-24854026 CCGGAGACTCAGGAAGGGCTTGG + Intronic
1135799604 16:25480351-25480373 CTGGAAACTCAGAAAGGGAGGGG + Intergenic
1135831061 16:25773802-25773824 CGGGAGACTCAGAAGAGAGGAGG - Intronic
1135871301 16:26153256-26153278 CTGGAGATACAGAAAGATGGCGG + Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136224708 16:28851294-28851316 TTGGAGAATCAGAACTGGGGAGG - Intronic
1137355833 16:47762906-47762928 CTGGGGACTCCAAAAGAGGGAGG + Intergenic
1137565866 16:49532224-49532246 CTGGAGACTCTGACGGTGGGTGG + Intronic
1137610188 16:49812756-49812778 CTGGAAAGTGAGAAAGGGTGAGG + Intronic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138057753 16:53853477-53853499 CTGGAGATTCAGAAGAGAGGAGG - Intronic
1138122389 16:54411158-54411180 CTGGAGACTGAGAGAGGTGAAGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138547138 16:57726633-57726655 CTGAAGACTCAGAAAAGCTGGGG - Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1138966697 16:62093298-62093320 CTGGAGACTCCAAAAGGGGGAGG - Intergenic
1139316736 16:66078387-66078409 TTGCAGACTCAGAAGAGGGGAGG - Intergenic
1139338899 16:66254218-66254240 CTGGAGGCAGAGACAGGGGGAGG + Intergenic
1140230363 16:73112758-73112780 CAGTAGACTGAGAAAGGGGAAGG + Intergenic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141258798 16:82431629-82431651 CTGGGGACTCCAAAAGTGGGAGG + Intergenic
1141685459 16:85567319-85567341 TTGGAAATTCAGAAAGGGTGTGG + Intergenic
1142018508 16:87765598-87765620 GTGGAGACTCAGGAGGGGGCGGG + Intronic
1142227959 16:88886568-88886590 ATGCAGGCTCAGAGAGGGGGAGG + Intronic
1142885481 17:2909825-2909847 CTGGGGACTCAGACTGGGTGGGG + Intronic
1143293124 17:5848113-5848135 CTGAAGACTCAGAAAGGAGGAGG - Intronic
1143579604 17:7817882-7817904 GTGGGGCCTCAGGAAGGGGGGGG - Intronic
1143674387 17:8421229-8421251 CTGGAAGATCAGAAAGGGGTAGG + Intronic
1143789939 17:9286801-9286823 CCAGAGACTCAGAAAAAGGGTGG + Intronic
1144634028 17:16892690-16892712 CTGGGGACTCAAAAAGTTGGGGG + Intergenic
1144788627 17:17845458-17845480 CTGGAGGCTCTGAAAGGAGCAGG - Intronic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146390511 17:32417967-32417989 CTGGGGACTCCTACAGGGGGAGG - Intergenic
1146582354 17:34049953-34049975 CTGGAGACTCAGAAATAGTTGGG - Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146636365 17:34508465-34508487 CTGGAGATTCAGATGTGGGGAGG - Intergenic
1146789502 17:35743377-35743399 ACAGAGACTCAGAATGGGGGTGG - Exonic
1147403256 17:40193407-40193429 CTGGGTACTCACAAAGGGGCCGG - Exonic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148627003 17:49077226-49077248 CTGGTGACTCAGAAAGGATGCGG - Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149277265 17:55055738-55055760 CTGGAGAATGAGTAAAGGGGTGG - Intronic
1149564460 17:57631159-57631181 AGGGGGACTCAGAAAGGGGCTGG - Intronic
1149943053 17:60891807-60891829 GTGGGGACTCCAAAAGGGGGAGG - Intronic
1150572757 17:66402057-66402079 CTGGAGAATGAGAATCGGGGTGG + Intronic
1150899706 17:69258539-69258561 CTGTGGACTCCAAAAGGGGGTGG + Intronic
1151514422 17:74583140-74583162 CTGGGGACAGAGTAAGGGGGAGG - Intronic
1151595759 17:75077286-75077308 CTGGAGCCCCTGACAGGGGGCGG + Intergenic
1152073152 17:78143985-78144007 CTGGGGACACAGTATGGGGGAGG + Intergenic
1152240409 17:79157857-79157879 CTGGAGACGCAGCACAGGGGAGG + Intronic
1152256438 17:79242750-79242772 GTGGAGGCCCAGTAAGGGGGTGG - Intronic
1152401029 17:80066208-80066230 GTGGAGACTACGAAAGGTGGAGG - Intronic
1152574368 17:81133618-81133640 ATGGAGACTCTGGGAGGGGGAGG + Intronic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1155236940 18:23829777-23829799 CTGGAGACTATGAAAAGTGGAGG - Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156020120 18:32589943-32589965 AAGGAGTCTCAGAAAGAGGGTGG + Intergenic
1156422850 18:36974327-36974349 TTGGAGACTCAGAAGAGTGGAGG - Intronic
1156468109 18:37360869-37360891 TTGGAGACCCAGCAAGGGTGAGG - Intronic
1156517074 18:37689026-37689048 CTACTGACTCAGAAAGGGAGAGG - Intergenic
1157319987 18:46626807-46626829 AAGGAGACTGAGGAAGGGGGAGG - Intronic
1158294312 18:55977936-55977958 TTGGAGATTCAGAAGGGAGGAGG + Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158859440 18:61578030-61578052 GTGGACACTCAGAAGGGTGGAGG + Intergenic
1161142229 19:2654579-2654601 CTGGGACCTCAGCAAGGGGGAGG - Intronic
1161530176 19:4784106-4784128 GTGGAGACTCAGAAGCGGGGAGG + Intergenic
1161634901 19:5381819-5381841 CTGGAGACTGGGGGAGGGGGCGG + Intergenic
1161810858 19:6470450-6470472 ATGGAGACTCAGAGAGGGAAAGG - Intronic
1161847227 19:6718843-6718865 GTGGAGTCTCAGAGAAGGGGAGG + Intronic
1162292719 19:9791957-9791979 ATGGGGACTCAGTGAGGGGGAGG - Intronic
1162947746 19:14054062-14054084 CTGGAGGCAGAGAAAAGGGGAGG - Exonic
1162964120 19:14148018-14148040 TTGGAGACAGAGAAAGGGGAAGG + Exonic
1163090291 19:15014711-15014733 CAGGAGACTCAGTGGGGGGGCGG + Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163381941 19:16975008-16975030 TTGGAGATTCAGAAATGGGTTGG - Intronic
1163774736 19:19211609-19211631 CTGGAGAATCAGGCAGGGCGAGG + Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164650461 19:29887460-29887482 CATGAGACCCAGAAAGGGGCTGG + Intergenic
1164762246 19:30736890-30736912 CCCTAGACTCAGAAAGGGTGTGG + Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1164944595 19:32282757-32282779 CTGGAGACTCAAAAGGGGAGAGG - Intergenic
1165595477 19:37008784-37008806 CGGGAGACACAGCAAGAGGGAGG - Intronic
1165654435 19:37520831-37520853 CTGGATTCTCAGAATGGTGGTGG + Intronic
1165905070 19:39188808-39188830 CTGGAGTCTGAGAGAGGGGTCGG - Intergenic
1166069321 19:40378039-40378061 CTGGTGACGCAGAATGGGAGGGG + Exonic
1166147076 19:40845234-40845256 CTGGGGACACAGAGAGGGGCTGG + Intronic
1166317250 19:41996171-41996193 ATGGAGACTGGGAAAGGGGGAGG + Intronic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1166744388 19:45133684-45133706 CTGAAGTCTCATAAAGGGGTGGG - Intronic
1167359069 19:49020319-49020341 CTGGAGACCCAGAAAGATAGGGG - Intergenic
1167366756 19:49058556-49058578 CTGGGGACCCAGAAAGATGGGGG - Exonic
1167373258 19:49097289-49097311 CTCGAGACACAGAAAAAGGGAGG - Intronic
1167646722 19:50710049-50710071 ATGGAGCCTCAAAGAGGGGGAGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1168327070 19:55543944-55543966 GTTGAGAATTAGAAAGGGGGAGG + Intronic
1168641997 19:58037019-58037041 CTGGAGACTCTGAAAAGAGAGGG - Intronic
1168684166 19:58337929-58337951 CTGGAGACAGAGAGAGAGGGAGG - Intronic
925144334 2:1570779-1570801 CTGGAGACTCAGAGGCGGGGAGG - Intergenic
925541678 2:4974261-4974283 CTGAAGACCCAGACAGGGAGGGG - Intergenic
926794314 2:16606373-16606395 CTGGAGAGAGAGAAAGGAGGAGG - Intronic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
927153557 2:20209292-20209314 CTAGAGACTCTGAAAGGTGAGGG + Intronic
927472062 2:23384708-23384730 CTGGAGTGTCATAAAGAGGGCGG + Intergenic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928734860 2:34276395-34276417 CTGGAGACTTTGATAAGGGGTGG + Intergenic
928870123 2:35965977-35965999 CTGGAGACCCAGGAAGCTGGTGG - Intergenic
929575208 2:43047346-43047368 CTGGAGACCCGGAAAGTGGGAGG - Intergenic
929880908 2:45836718-45836740 GTGGAGAGTGAGAAAGGAGGAGG - Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930539442 2:52686754-52686776 CTGGAGTCTCAGAATGGGGGAGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
930950131 2:57131332-57131354 TTGGAGACTCAAAAAGGAGGAGG - Intergenic
931584605 2:63811764-63811786 CTGGGGACTCCAAAATGGGGAGG - Intronic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933458335 2:82545669-82545691 ATGGAGACTAAGAAGGGTGGAGG - Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
934895098 2:98111112-98111134 CTGGAGAATCCAAAAGGTGGGGG - Intronic
935476811 2:103532331-103532353 TTGGAGATTCAGAAGTGGGGAGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
937975826 2:127581661-127581683 CTGGGGGCTGAGAAAGGGGCTGG - Intronic
937987059 2:127642676-127642698 CTTGAGACTCAGGAGGCGGGTGG - Intronic
938079707 2:128363176-128363198 CAGGGGACTCAGGAAGGGGGTGG + Intergenic
938115528 2:128600790-128600812 CGGCAGAGGCAGAAAGGGGGAGG - Intergenic
938132817 2:128732063-128732085 CTGGAGACACAGAAAGACAGAGG + Intergenic
938407717 2:131041758-131041780 CTGGAGACAGAGAAAGGGTGAGG - Intronic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
940197630 2:151113563-151113585 CTGTATAATCTGAAAGGGGGAGG + Intergenic
940690776 2:156917832-156917854 TTGAAGTCTCAGAAATGGGGAGG - Intergenic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
941841585 2:170090800-170090822 TTGGAGCCTCAGGAAGGGAGAGG + Intergenic
942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG + Intronic
942491770 2:176496432-176496454 CCGGAGTCTCACAATGGGGGTGG + Intergenic
942981130 2:182083408-182083430 TTGGAGACTCAGAAATGGGCAGG - Intronic
943196127 2:184752464-184752486 CTGGAGACTCCAAAATGTGGGGG + Intronic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
943436200 2:187868141-187868163 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436207 2:187868191-187868213 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436234 2:187868385-187868407 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436252 2:187868532-187868554 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436326 2:187869066-187869088 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943928168 2:193815325-193815347 CTTTAGACTGAGAAAGGGGAAGG + Intergenic
945119790 2:206444912-206444934 CTGTGGACTCAGAGAAGGGGTGG + Intronic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
945373916 2:209056534-209056556 TTGGAGATTCAGAAAAGGGGAGG + Intergenic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
946875545 2:224126139-224126161 CTGGAGCCTCAGCAAGGAGGTGG + Intergenic
947108563 2:226694184-226694206 ATGAAGACTGAGAAAGGAGGAGG - Intergenic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
948746781 2:240102205-240102227 TTAGAGACTAAGAAAGGGGAGGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169260641 20:4135820-4135842 CTGGTGACTCAGGTAGGGGGAGG - Intronic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169329935 20:4708384-4708406 CTGGAGACTCAGGAAAGCTGGGG - Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169935441 20:10878588-10878610 CTGGAGACTCCAAAAGCAGGAGG + Intergenic
1170092018 20:12599739-12599761 TTGGAGACTCAGAAAGCTGGAGG + Intergenic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1170834059 20:19868691-19868713 TTGGGGACCCAGAAAGGGGAAGG + Intergenic
1170961891 20:21032835-21032857 TTGGAGACTCAGAGGTGGGGAGG + Intergenic
1170963061 20:21042539-21042561 CTGGAGACCCAGAAAGCCAGTGG + Intergenic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171374537 20:24683374-24683396 CTGGAGACTCAGAACGGTGGGGG + Intergenic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1172275339 20:33676120-33676142 CTGGGGAATCAGCAAAGGGGAGG - Exonic
1172768724 20:37364618-37364640 ATGGAGGCTCAGAAAGGGAGAGG - Intronic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173408814 20:42791467-42791489 CTGGAGACCCACAAAGCAGGTGG + Intronic
1174100018 20:48120044-48120066 CTGGACACACAGACAGGGAGGGG - Intergenic
1174101069 20:48126543-48126565 CCGGAGACGCAGAAAGGAGCTGG - Intergenic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149524 20:48476308-48476330 CTGGAGACCCAGAAAGGAAATGG - Intergenic
1174149532 20:48476361-48476383 CTGGAGACCCAGAAAGGAGTTGG - Intergenic
1174149559 20:48476515-48476537 CTGGAGACCCAGAAAGGCAATGG + Intergenic
1174149593 20:48476707-48476729 CTGGAGACCCAGAAAGGAAATGG - Intergenic
1174149601 20:48476760-48476782 CTGGAGACCCAGAAAGGAGCTGG - Intergenic
1174149627 20:48476918-48476940 CTGGAGACCCAGAAAGGAACCGG - Intergenic
1174152967 20:48498922-48498944 CTGGACACACAGACAGGGAGGGG - Intergenic
1174153602 20:48502870-48502892 CTGGAGAACCAGAAAGGAGCTGG - Intergenic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1174916158 20:54656175-54656197 CTGGAGACTTCAAAAGTGGGAGG - Intergenic
1174943026 20:54952903-54952925 CTGAAAATTCAGAAAGGGGGAGG - Intergenic
1175343785 20:58254523-58254545 CTGAAGACTCAGAAGGGGAGAGG + Intergenic
1175345123 20:58267581-58267603 CATGAGACTTAAAAAGGGGGTGG + Intergenic
1175617556 20:60414020-60414042 CTTGAGAATCAGAAAGGGGGAGG - Intergenic
1175829828 20:61957559-61957581 CTGGAGAATCAAAGAGGAGGAGG + Intronic
1176271686 20:64238710-64238732 CTGGGGACTCTGAGAAGGGGAGG - Intronic
1176673663 21:9757309-9757331 CTCGAGACTCAGAAAGCTGCCGG + Intergenic
1177125473 21:17188150-17188172 TTGGGGACTCAGGAAGGGAGAGG + Intergenic
1177378921 21:20312538-20312560 CTGGAGACTTAGAAGGTGGGAGG + Intergenic
1177557212 21:22707316-22707338 CTGGGGACTCCAAAAGGAGGGGG + Intergenic
1177883849 21:26725004-26725026 ATGGAGACTTAGAAGTGGGGAGG - Intergenic
1178755710 21:35347479-35347501 TTGGGGACTCAGAAAGGTGAGGG - Intronic
1178918417 21:36722606-36722628 CTGGAGAGACAGAGACGGGGTGG + Intronic
1178925849 21:36774316-36774338 GTGGAGACTCAGACAGGGAACGG + Intronic
1179144798 21:38758468-38758490 CTGTAGAGTAAGAAAAGGGGAGG + Intergenic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1179318350 21:40267012-40267034 CGGGAGACTCAGAAGTGGGGAGG + Intronic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1181639773 22:24190394-24190416 CTGGGGATTCAGACAGTGGGAGG - Intergenic
1182087864 22:27573818-27573840 CTTGGGACTCAGAGAGGGGCTGG + Intergenic
1183087110 22:35493156-35493178 ACTGAGACTCAGAAAAGGGGAGG + Intergenic
1183363092 22:37393130-37393152 CAGGAGGCTCAGAGAGGGTGAGG - Intronic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1183505577 22:38206966-38206988 CTGGAGAATCAGAGCTGGGGTGG + Intronic
1183796884 22:40126402-40126424 CTGGGGACTCCAAAAGGGAGAGG - Intronic
1183947699 22:41336039-41336061 GTGGGGACACAGAAAGGGTGGGG + Intronic
1184751817 22:46490663-46490685 CTGCAGACTCAGGAAAGTGGTGG + Intronic
1184950670 22:47840529-47840551 CTGGGGAGGCAGAAAGGGGCAGG - Intergenic
1185111707 22:48903764-48903786 TTGGAGAATCAGAAAAGGCGTGG - Intergenic
949131154 3:502793-502815 CTGGAGAGTCAGAAAATGTGTGG + Intergenic
949159278 3:860529-860551 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
949159306 3:860776-860798 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
950128621 3:10526799-10526821 ATAGAGACTCAGAGAGGGGAAGG - Intronic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950413050 3:12851378-12851400 GTGGAGCCACAGAATGGGGGAGG + Intronic
951008409 3:17646900-17646922 CTGGGGACTCAAAAAGTGGGAGG - Intronic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951514730 3:23545989-23546011 TTGGAGACTCAGAAGAGAGGAGG + Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
953235698 3:41104197-41104219 CTGGGGACACAGAAAGGGGCGGG + Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953317329 3:41941140-41941162 CTGGAGGCTGAGAGAGGAGGAGG - Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953933225 3:47017500-47017522 CTGGGGACCCAGGAACGGGGAGG - Intronic
953971940 3:47354943-47354965 CTGGAGGCTCAGGAAGGCAGAGG - Intergenic
954035955 3:47851312-47851334 CTGCTACCTCAGAAAGGGGGAGG + Intronic
954091498 3:48287912-48287934 CTGGAGAGTGAGGAAGGGGGAGG + Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955397826 3:58569563-58569585 CTGGAGACTGAGGAAGGCTGAGG - Intronic
955457561 3:59140617-59140639 CTGGAGACTCAGGAGTGGGGAGG + Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956293814 3:67690635-67690657 CTGAAGGTTCTGAAAGGGGGTGG + Intergenic
956314503 3:67919515-67919537 TTGGAGACTCTGAAAGTGGGAGG - Intergenic
956553012 3:70482958-70482980 CTGGAGAATGAGAAAGGGGCTGG + Intergenic
957768278 3:84655446-84655468 CTAGAGACACAGAAAGGTGAAGG + Intergenic
958665176 3:97128014-97128036 CCGGAGACTCAGAAGTGGGGAGG - Intronic
958811821 3:98868610-98868632 TCGGAGACTCAGAAAGGGGGAGG - Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960752283 3:120968711-120968733 TTGGATACTCAGAACGGGGGAGG - Intronic
961063599 3:123854591-123854613 CTGGTGACTCCAAAAGGAGGGGG + Intronic
961243714 3:125433946-125433968 CTGCTGACTCAGAAATGGGGTGG - Intergenic
961449815 3:126997623-126997645 CAGGAGAGGCGGAAAGGGGGCGG - Intronic
961643871 3:128382066-128382088 CAGGAGACTCAGAGAGGAGAGGG - Intronic
961793410 3:129392700-129392722 CTGGTGACTCAGAGAGGGCATGG + Intergenic
961805209 3:129484200-129484222 GTGGAGCCACAGAATGGGGGAGG + Intronic
961807407 3:129499318-129499340 CTGGTGACTCAGAGAGGGCATGG + Intronic
961817496 3:129558813-129558835 CTGGAGGCTCAGGAGGGGGTTGG - Intronic
961902349 3:130225291-130225313 CAGGGGACTCTGAAAGGGGAGGG - Intergenic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962174115 3:133134781-133134803 CTACAGACTCAGAAGCGGGGAGG - Intronic
962870463 3:139486151-139486173 CTTGAGACTCAGAAATGGGGAGG - Intergenic
963106473 3:141651847-141651869 CTGGAGACTCAGAGAAGAGTGGG + Intergenic
963168667 3:142229952-142229974 TTGGAGACCCAGAAATGGGAGGG + Intergenic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
966596331 3:181727260-181727282 CTGGAGGCGGGGAAAGGGGGGGG - Intergenic
966934138 3:184694778-184694800 ATGGACACTTAGAAATGGGGCGG - Intergenic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
967224158 3:187275063-187275085 CTGGAGTCCCAGAAGGGGTGAGG - Intronic
967323475 3:188216610-188216632 AGTGAGACTCAGAAAGGGGCAGG - Intronic
967728501 3:192884336-192884358 TTGGAGACTCAGGTAGGTGGAGG + Intronic
968517522 4:1021148-1021170 GTGGGGACCCAGACAGGGGGTGG + Intronic
968734732 4:2289538-2289560 CTGGAGGGTCAGGCAGGGGGTGG + Intronic
969144618 4:5111600-5111622 CTGGAGACTTCAAAAGGGGTTGG + Intronic
969166739 4:5322641-5322663 CTGGAGACTAAGAAAGGTCTAGG + Intronic
969405212 4:6987116-6987138 CTGGAGACTCCCAAGGGGGCGGG - Intronic
969521097 4:7678156-7678178 CTGGAGACACAGCACAGGGGCGG + Intronic
969521170 4:7678521-7678543 CTGGAGACACAGCACAGGGGCGG + Intronic
970165722 4:13235849-13235871 TTGGAGACTCAGAAAAGGGGAGG + Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970509925 4:16771752-16771774 CTGGAGGCACAGAGAAGGGGTGG - Intronic
971464767 4:26945100-26945122 CTGGAGACTCCCAGAGGGTGGGG - Intronic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972213191 4:36863235-36863257 TTGGAGACTCAGACGGGGAGAGG + Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
972889456 4:43538363-43538385 CTGGAGATTCAGAAAGGGAGAGG + Intergenic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973695061 4:53482688-53482710 TTGGAGACTCAGAAAAGGGGAGG + Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974112554 4:57542569-57542591 CTGGAGAACTAGAAAGGTGGTGG + Intergenic
974490058 4:62553146-62553168 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
974962980 4:68726646-68726668 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976277553 4:83292845-83292867 TTGGAGACTCAGAAGGGAAGAGG + Exonic
976563987 4:86532720-86532742 TTGGAGATTCAGAAAAGTGGAGG - Intronic
976647212 4:87399352-87399374 CTGCCAACTCAGAAAGGGGGTGG - Intergenic
976855880 4:89604890-89604912 CAGGAGTCCCAGAAAGAGGGAGG + Intergenic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977814002 4:101392265-101392287 TTAGAGACTCAGAAGTGGGGAGG + Intergenic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979325953 4:119379719-119379741 TGGGAGACTCAGAAGTGGGGAGG - Intergenic
979663850 4:123289172-123289194 CTGGAGATTCAGAACGGGGTAGG - Intronic
979760787 4:124401229-124401251 TTGGAGACTCAGAATAGTGGGGG - Intergenic
980378769 4:131982129-131982151 TTGGAGACTCAGATGTGGGGAGG - Intergenic
980747638 4:137040303-137040325 TTGGAAACTCAGAATGGGGGAGG - Intergenic
980935511 4:139221952-139221974 CTGGAGGCTCAGGGAGGGAGTGG - Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981442782 4:144801849-144801871 TTGGAGATTCAGAAGAGGGGAGG - Intergenic
981738491 4:147977815-147977837 CTGGAGACTCCAAAAGGGGAGGG - Intronic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981913382 4:150008185-150008207 CTGGAGAAGCAGGGAGGGGGGGG - Intergenic
981923287 4:150110639-150110661 TTAGAGACTCAGAAGTGGGGAGG - Intronic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982422447 4:155213116-155213138 TTGGAGACTCATAAAGGAGAGGG + Intronic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
982499261 4:156132394-156132416 CTGGCATCTCAGAAAGGGAGAGG + Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982812293 4:159841056-159841078 TTGGAGGTTCAGAAAGGAGGAGG - Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983173399 4:164560303-164560325 CTGGAGATTCCAAAAGGGCGAGG - Intergenic
983243812 4:165264376-165264398 TGGGAGACTCAGAAGTGGGGAGG - Intronic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984602400 4:181743669-181743691 CCACAGACTCAGAAAAGGGGGGG + Intergenic
984919225 4:184749271-184749293 CTGGAGGCTGAGGAAGGGGAGGG + Intergenic
985074620 4:186201697-186201719 CTGGAACCTCAGAAAGCAGGTGG - Intronic
985233608 4:187848957-187848979 CTGGAGGCTCAGAGAGGGGCAGG - Intergenic
985401045 4:189594360-189594382 CTCGAGACTCAGAAAGCTGCCGG - Intergenic
985717014 5:1468346-1468368 CTGGAGCCTCAGAACGGGCCGGG + Intronic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
986328175 5:6696097-6696119 TTGAAGACTCAGAAGTGGGGAGG - Intergenic
986408586 5:7452252-7452274 TTGGAAACTCAGAAATGGGGAGG - Intronic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986879008 5:12147283-12147305 TTGAAGACTCAGAAGGGTGGGGG - Intergenic
987019955 5:13860070-13860092 AAAGAGACTCAGAAAAGGGGAGG - Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987141590 5:14952408-14952430 CTAGGGACTAAGAAACGGGGCGG - Intergenic
987223576 5:15816476-15816498 TTGAAGACTCAGAAGTGGGGAGG + Intronic
987399801 5:17463635-17463657 CTAGCCCCTCAGAAAGGGGGTGG - Intergenic
987625555 5:20395428-20395450 CTGGAGACTCAGAAATAGAGAGG + Intronic
987659226 5:20850924-20850946 CTAGAGACTCAGAAGCGAGGAGG + Intergenic
988065540 5:26226146-26226168 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065571 5:26226392-26226414 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065635 5:26226881-26226903 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065654 5:26227075-26227097 CTGGAGACCCAGACAGGAGCTGG - Intergenic
988065721 5:26227617-26227639 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988222331 5:28364241-28364263 ATGGAGACTCAGAAGGGTAGGGG + Intergenic
988348539 5:30070644-30070666 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
988764444 5:34355057-34355079 CTAGAGACTCAGAAGCGAGGAGG - Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
989191939 5:38678869-38678891 CTGGTCACTCAGAAAGAGGGAGG - Intergenic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989534024 5:42542788-42542810 CTGGAGACTGAGGAGGGGGTAGG - Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991403819 5:66282007-66282029 CTGGAGACTTGGACAGGGTGTGG - Intergenic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992276388 5:75124803-75124825 CTGGAGACTCAGAAGGGTAGGGG + Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992865638 5:80954454-80954476 CAGGAGAATCAGGAAGGGGCTGG + Intergenic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993195709 5:84742544-84742566 TTGGAGACTCAAAAGTGGGGAGG - Intergenic
993322757 5:86494319-86494341 CTGGACACTTAGAAGGGTGGAGG - Intergenic
993423669 5:87734645-87734667 CTGGAAACTGAGAAAAGGGTTGG + Intergenic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
995047690 5:107670213-107670235 CGGGAGACTCGGAAAAGGGCGGG - Intronic
995179306 5:109215388-109215410 CAGGGGATTCAGAAATGGGGAGG - Intergenic
995388956 5:111618054-111618076 CTGTAGACTGGGCAAGGGGGTGG + Intergenic
995601933 5:113807007-113807029 CTCAAGCCTCAGAAAGGAGGAGG - Intergenic
996446506 5:123559174-123559196 TTAGAGACTGAGAATGGGGGAGG + Intronic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997368867 5:133343333-133343355 CTGGACACTCAGCACGGGTGTGG + Intronic
997886729 5:137637115-137637137 GTTGAGACTCAGAGAGGTGGTGG - Intronic
999923577 5:156350069-156350091 TTGGAGACTCAGAAGAGGAGAGG + Intronic
1000441347 5:161267432-161267454 TTGGAGACTCAGAAGTGAGGAGG + Intergenic
1000821004 5:165983167-165983189 TTGGAGACTCTGAATGGGGGAGG + Intergenic
1000993466 5:167934957-167934979 CTGGAAGCAAAGAAAGGGGGTGG + Intronic
1001166415 5:169373297-169373319 TTGGAGACTAAGAAGTGGGGAGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001427018 5:171629392-171629414 ATGGAGGCTCAGAGAGAGGGAGG + Intergenic
1001529045 5:172449435-172449457 CTGCAGATTCAGAGAGGTGGAGG - Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002601753 5:180357573-180357595 CTGGGGCCTGAGAAAGGGGCAGG + Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004872307 6:19919250-19919272 CTGGAGACTACCAGAGGGGGAGG + Intergenic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005394866 6:25370920-25370942 TTGGTGACTCAGAAGAGGGGAGG - Intronic
1005518507 6:26577467-26577489 CAGGAGACTCAGGGAGGGAGTGG - Intergenic
1005825221 6:29628121-29628143 CTGGGGAGGCAGGAAGGGGGCGG + Intronic
1005994313 6:30922260-30922282 CTGGAGTCACAGAAAGCGGCAGG - Intronic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006452248 6:34111960-34111982 CTGGAGATTCTGAAATGGGGAGG + Intronic
1006467181 6:34202764-34202786 CTGCAGGGACAGAAAGGGGGTGG + Intergenic
1006664343 6:35679758-35679780 CTAGAGACTCAGAAGAGGGCAGG + Intronic
1006895195 6:37463727-37463749 CTGGAGAATCATAGAAGGGGAGG + Intronic
1007403843 6:41621162-41621184 TTGGAGACCCAGATAGGGTGAGG - Intergenic
1007412785 6:41674606-41674628 CAGGAGACTCTGAAAGTGGAAGG - Intergenic
1007602305 6:43090148-43090170 CTGGTGACCCAGAAAGGGGTAGG + Intronic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009278340 6:61714881-61714903 ATGGAGACTCAGAAGAGTGGGGG + Intronic
1009514503 6:64597694-64597716 CTGGAGACTTAAAAGGGTGGGGG + Intronic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011505860 6:88043211-88043233 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1011612791 6:89169512-89169534 CTGGGAACTCCAAAAGGGGGTGG - Intergenic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012351813 6:98260744-98260766 CTGGAGATTCAGAAGTGAGGAGG - Intergenic
1012700028 6:102444390-102444412 TTGGAGACTCACAAGGGAGGAGG - Intergenic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013858448 6:114604544-114604566 TTGGAGTCTCAGAAGTGGGGAGG + Intergenic
1014069661 6:117166891-117166913 CTGGAGACACAGAAGAGAGGTGG - Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1014809304 6:125867813-125867835 CTGGAACCAAAGAAAGGGGGTGG + Intronic
1014850905 6:126338625-126338647 CTGGAGATTGAGAATGGGGTAGG + Intergenic
1014992816 6:128103239-128103261 ATGGGGACCCGGAAAGGGGGTGG - Intronic
1015035693 6:128651557-128651579 CAGGAGACAGAGAAAGTGGGGGG - Intergenic
1015607757 6:134976738-134976760 CTGGAGACTCAGTAGCGGGTAGG + Intronic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015775806 6:136812916-136812938 TGGGACACTCAGAGAGGGGGTGG - Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016199887 6:141394571-141394593 CTGCCAACTCAGAAAGGGGAGGG - Intergenic
1016372485 6:143389911-143389933 CTGTAGATTCAGACAGGGTGAGG + Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016387540 6:143543060-143543082 GAGGATACTCAGAAAGGGTGTGG + Intronic
1016648373 6:146435387-146435409 CAGGAGACTCAGGAATGGAGCGG + Exonic
1016689563 6:146921169-146921191 CTGGAAACTCAGAAGGGAGCGGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1017009595 6:150054298-150054320 CTGGAGACTCAGGGAGGAGCTGG - Intergenic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1018049108 6:159992370-159992392 CTGGAGACTCAGAAAGGTTGGGG - Intronic
1018354774 6:163001152-163001174 CTGAAGACTCTGAAATGGGTGGG + Intronic
1019056464 6:169227158-169227180 GGGGTGGCTCAGAAAGGGGGTGG + Intronic
1019098440 6:169607612-169607634 CTGGAGACTCAGAAGGGTAGAGG + Intronic
1019098861 6:169610880-169610902 TTGGAGACTCACAAGGGGGCAGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019431352 7:1001250-1001272 CTGTAGGCTCAGCACGGGGGAGG + Intronic
1019708651 7:2508353-2508375 CTGGAGACTCCGGAAGGAGGAGG - Intergenic
1019978215 7:4601483-4601505 CTGGAGACTCTGAAGGGTGGGGG + Intergenic
1020560981 7:9728341-9728363 TTGGAGATTCAGAAATGGGTTGG + Intergenic
1020632093 7:10651737-10651759 CTGGGGACTCCAAAAGGTGGAGG + Intergenic
1021112747 7:16714193-16714215 CTGGAGACTACGAAAGGCAGGGG - Intergenic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022354165 7:29596281-29596303 CTGAAGACTCAGAAGTGGGGAGG + Intergenic
1022354585 7:29600832-29600854 CTGGGGACTTAGGAAGGGGCTGG + Intergenic
1023026857 7:36058533-36058555 CAGGAGTCCCAGGAAGGGGGAGG - Intergenic
1024272458 7:47652864-47652886 AGGGAGACTCAGAAGGGTGGAGG + Intergenic
1024584747 7:50832394-50832416 CTGGAAATTCAGAAATAGGGTGG + Intergenic
1025234122 7:57222382-57222404 CTGGACACACAGACAGGGAGGGG + Intergenic
1026286208 7:68965178-68965200 CTGTATAGTCAAAAAGGGGGAGG + Intergenic
1026506927 7:70992804-70992826 TTGGAGACTCACAAATGGGCAGG - Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026820362 7:73543683-73543705 CAGGAGACTCACAGAGAGGGAGG + Intronic
1027303817 7:76870697-76870719 TTAAAGACTCAGAAAGGGGTGGG + Intergenic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029551114 7:101237606-101237628 CTGGTGCCCCAGAGAGGGGGAGG + Exonic
1029805036 7:102987139-102987161 CTGGAGACTCTGAAAGGGAGAGG + Intronic
1030097815 7:105916781-105916803 CAAGTGACTCAGAAAGGGGCTGG + Intronic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031735369 7:125352980-125353002 CTGGGAACTCAAAAAGGGGAAGG + Intergenic
1032990263 7:137386686-137386708 CTGGGGACACAGAAAAGGGTAGG + Intronic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034071701 7:148192259-148192281 GTGGAGACTCAGAAGGGTGTAGG - Intronic
1034113575 7:148562466-148562488 CTGGAGACTCAGTCTTGGGGTGG + Intergenic
1034465464 7:151226009-151226031 ATGGAAACTGAGAAAGGGGCAGG + Intronic
1034560328 7:151876086-151876108 CTGGAGACGGAGAGAGGGGAGGG - Intronic
1034820946 7:154215794-154215816 CTGGCGACCCAGAGAGGGGAAGG - Intronic
1035018306 7:155785541-155785563 CTGGGGGCTCAGGAAGGGGATGG - Intergenic
1035124792 7:156600739-156600761 CTGGAGCCTCGGAAGGGCGGGGG + Intergenic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1035749380 8:1985141-1985163 CTGGAGACCCCCAAAGAGGGTGG + Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036612505 8:10362558-10362580 TAGGAAACTCAGAAAGGGGATGG - Intronic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037020610 8:13965888-13965910 CTGGAGACCCAGAAAGCCAGTGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1038908017 8:31928854-31928876 TTGGAGACTAAGAAGCGGGGAGG + Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1039052428 8:33507044-33507066 GTGGAGACTCAGGAATGTGGAGG + Intronic
1039208294 8:35182250-35182272 TTGCAGACTCAGAATGGGGGAGG + Intergenic
1039241746 8:35564751-35564773 CTGGATTCTCAGAAGTGGGGAGG - Intronic
1039380443 8:37079941-37079963 CTGAAGAGTCAGAATGGGGCGGG + Intergenic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1041499583 8:58525933-58525955 CTGGAAAGTCAGAAAGGTGAGGG + Intergenic
1041717419 8:60944700-60944722 GGAGAGACTCAGAAAGGGAGAGG + Intergenic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1042482737 8:69322568-69322590 CTGGAGACCCAGAAAGGAGCTGG + Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042999194 8:74736582-74736604 CTTGAGTCTCAGAATGGGGCTGG + Intronic
1043074665 8:75683186-75683208 TTGGAGAGTCAGAAGCGGGGAGG - Intergenic
1043082684 8:75785180-75785202 CTATAAACTCAGAAAGGGGTGGG + Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043366521 8:79539454-79539476 TTGGAGACTCAGAAGGGTAGTGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1044879529 8:96709252-96709274 TTGGAGACTCAGAAGCGGAGAGG - Intronic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046613807 8:116454179-116454201 CTGTAGAGTCTGAAATGGGGTGG - Intergenic
1046730569 8:117721263-117721285 TTGGAGACTCAGAAGGGTTGGGG - Intergenic
1046777957 8:118183832-118183854 CTTGAGATTCAGAAGGCGGGAGG - Intergenic
1046825875 8:118690799-118690821 TTGGAGTCTCAGAAGTGGGGAGG - Intergenic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047022640 8:120792333-120792355 TTGGAGACTCAGAAAAGGGGAGG + Intronic
1047345547 8:124024357-124024379 CTGAAAACTCAGAAAGGGGGAGG - Intronic
1047508445 8:125497856-125497878 ATGGAGAGTCAGCAAGGTGGGGG + Intergenic
1047560282 8:125979963-125979985 CTGGAGACTCAGAATTTGGGAGG + Intergenic
1047704905 8:127488569-127488591 GCTGAGACTCAGAAAGGGGGAGG + Intergenic
1047727578 8:127697256-127697278 CTGGAGAGTCAGAAAGGCCAAGG - Intergenic
1047899866 8:129408413-129408435 CTGGAGATTCAGAAGGGTTGGGG - Intergenic
1048168594 8:132084748-132084770 CTTGAGACACAGAGAAGGGGTGG + Intronic
1048285325 8:133136945-133136967 CTGGGGGCTCAGACAGGGGCAGG + Intergenic
1048570956 8:135655558-135655580 CTGGAGACAGAGGAAGGGGCTGG + Intronic
1048861986 8:138730351-138730373 CTGGAGACCCAGTATGGCGGTGG + Intronic
1049462429 8:142736294-142736316 CTGTAGGCCCAGAAAGGGTGGGG - Exonic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052208163 9:25869004-25869026 GTGAAGACTCAGAAAGGAGGAGG - Intergenic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052825526 9:33171302-33171324 CTGGAAACTCAGAATGGGTTGGG + Intergenic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053124904 9:35573014-35573036 ATGGAGAGACAGAAAGGGGGAGG + Intergenic
1053475498 9:38379335-38379357 CTGGAGCCTCAGAAAGGAGCAGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053749103 9:41235444-41235466 CTGGAGTCTCAGCGAGAGGGTGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054336761 9:63815305-63815327 CTGGAGTCTCAGCGAGAGGGTGG + Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1055261909 9:74447037-74447059 CTGGATCCTGAGAAAGGAGGAGG - Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1056281703 9:85047846-85047868 TTGGATACTCAGAAAGGGGGAGG - Intergenic
1056734646 9:89198431-89198453 TTAGAAACTCAGAATGGGGGAGG + Intergenic
1057836673 9:98451071-98451093 ACTGAGACTCAGAAAGGGGTGGG - Intronic
1057977146 9:99618137-99618159 CTGGAGACTCAGAAGAGTAGGGG + Intergenic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058402718 9:104636508-104636530 GTGGAGACTCAGAAATGGAGAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058634958 9:107029444-107029466 CTGGTGACTAAGTAAGGTGGGGG + Intergenic
1058844123 9:108938676-108938698 CTGGGGAATTACAAAGGGGGGGG + Intronic
1059258777 9:112955933-112955955 CTGGAGTCTCAGAGAGAGGCTGG - Intergenic
1059419800 9:114183769-114183791 CTGGAGACAGAGCCAGGGGGAGG + Intronic
1059643904 9:116245144-116245166 ATGGACACTCAGAAGGGTGGGGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059973528 9:119692108-119692130 CTGGGGACTCAGAAGAGGAGAGG - Intergenic
1060037044 9:120264492-120264514 TTGGACACTCAGAATAGGGGAGG - Intergenic
1060121700 9:120997479-120997501 AGAGAGACACAGAAAGGGGGGGG - Intronic
1061074805 9:128334607-128334629 ATGGGGACTCAGAGAGGGGAAGG - Intergenic
1061213672 9:129207953-129207975 ATGGAGACTCAGAGAGGTGGCGG + Intergenic
1061553003 9:131348880-131348902 CTGGAGACTTACAGAGGGGTGGG + Intergenic
1062142729 9:134968729-134968751 CGGGAGACTCACACAGAGGGTGG - Intergenic
1062604110 9:137336124-137336146 CTGGAGGCTCAGAGGTGGGGAGG + Intronic
1062610059 9:137369552-137369574 CTGGGGACACAGCAAGGGGCAGG + Intronic
1185783142 X:2866511-2866533 CTAGAGACTAGGAAAGGTGGGGG + Intronic
1185913671 X:4010375-4010397 CTGGAGACCCAGGAAGCTGGTGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1185943489 X:4347809-4347831 TTGGAGACTGGGAAAGGGGATGG + Intergenic
1186102068 X:6167806-6167828 CTTGAGTTTCAGGAAGGGGGAGG - Intronic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187149644 X:16669814-16669836 CTGGGGACTCAGGCAGGAGGGGG - Intronic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187551766 X:20313123-20313145 TTGGAAACTCAGAAGAGGGGAGG - Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187660003 X:21534095-21534117 CTGGAGGCTGAGAATGGGAGGGG - Intronic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187964181 X:24594498-24594520 GTGCAGATTCAGAAAGGGGGAGG - Intronic
1188101032 X:26088163-26088185 TTAGAGATTCAGAAAGGGGAGGG + Intergenic
1188154577 X:26725021-26725043 TTGGAGACTCAGACATGGGGAGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188181439 X:27060815-27060837 ATGGAGGCTCAGAAGGGTGGAGG - Intergenic
1188188771 X:27148250-27148272 TTGGAGACTCAAAAAGTGGGAGG + Intergenic
1188780209 X:34273961-34273983 TTGGACACTCAGAAAGGTGAGGG - Intergenic
1188964293 X:36531897-36531919 TTGGAGACTCAGAAAGCGTTGGG - Intergenic
1189167478 X:38874955-38874977 TTGAAGACTCAGAATGGGGGAGG - Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189268921 X:39736686-39736708 TTGGAGGCTCAGAGAGTGGGTGG - Intergenic
1189316790 X:40062363-40062385 CCGGAGATTCAGAAAGCGGCCGG - Exonic
1189507582 X:41627561-41627583 CTAGAGACTCAGAATAGGGGAGG - Intronic
1189607026 X:42689720-42689742 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
1189817645 X:44839988-44840010 TTGGAGACTCATAATGGGCGAGG + Intergenic
1190244694 X:48683586-48683608 CCAGAGAGTAAGAAAGGGGGAGG + Intronic
1190432284 X:50389834-50389856 CAGGAGAATAAGAAAGGGGAGGG - Intronic
1190690382 X:52908677-52908699 GTGGAGACTGGGAACGGGGGAGG + Intergenic
1190695601 X:52947115-52947137 GTGGAGACTGGGAACGGGGGAGG - Intronic
1191008159 X:55733124-55733146 CTGGAGACACAGAAACGGGGAGG - Intronic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1191897738 X:66011510-66011532 TTGGAGGCCCAGAAAGGGAGAGG + Intergenic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192215943 X:69158235-69158257 CTGGAGAATCAGAAACTGGCAGG + Intergenic
1192218586 X:69181079-69181101 CTGGAGCCTAAGGAAAGGGGAGG + Intergenic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192688908 X:73338488-73338510 CTAGAGACTGAGAAAGGTAGGGG + Intergenic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193222977 X:78948620-78948642 CTAGAGACTCAGAAGAGGGTGGG - Intronic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193525852 X:82587911-82587933 ATGGAGACTCAGACAGGTGGAGG - Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194047497 X:89026546-89026568 TTGGAGACTCAGAAGAGAGGAGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194465139 X:94225357-94225379 TTGGAGACTCAGAAACGGTGAGG + Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195966715 X:110435596-110435618 TTGGAGACTCAGAAAGAAAGTGG - Intronic
1196754199 X:119143595-119143617 CTGGAGAAGAGGAAAGGGGGAGG - Intronic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1196937499 X:120744106-120744128 CTGGAGGCTGAGAAATGGTGGGG - Intergenic
1197142937 X:123136709-123136731 CTGGGGACTGGGAAAGGTGGAGG + Intergenic
1197339405 X:125247355-125247377 CTGGAGACTTGAAAGGGGGGTGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197707626 X:129646088-129646110 CAGGAGACACAGAAAGGAAGGGG + Exonic
1198319684 X:135507590-135507612 TTGGCGACTCAGAAGTGGGGAGG - Intergenic
1198412883 X:136389636-136389658 CTCGAGTCTCAGAGAGGGGAAGG + Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199326733 X:146507430-146507452 TTGGAGAATCAGAAGGGGAGAGG + Intergenic
1199777155 X:151022194-151022216 CTGGAGACCCAGAAAGCCAGTGG - Intergenic
1199849553 X:151715629-151715651 CTGGGGACTCTGGATGGGGGAGG + Intergenic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200377259 X:155796259-155796281 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic
1200812653 Y:7501560-7501582 GTAGAGACACAGAAAAGGGGTGG - Intergenic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic